A method for screening wheat with different plant height, tillering and yield

Abstract

The present invention discloses a method for screening wheat with different plant height, tillering and yield, which comprises the following steps: detecting whether the haplotype of the wheat to be tested is haplotype Hap-5B-1 or haplotype Hap-5B-2 based on the TaSAG39-5B gene, the plant height, tillering and / or yield of the wheat with haplotype Hap-5B-1 being greater than that of the wheat with haplotype Hap-5B-2; and the wheat with haplotype Hap-5B-1 being a wheat with a genotype of GG homozygous based on the G206T SNP site, a genotype of GG homozygous based on the G295A SNP site, a genotype of missing based on InDel241-285 and / or a genotype of missing based on InDel296-402. By detecting the haplotype of the wheat to be tested based on the TaSAG39-5B gene, wheat plant height, tillering and yield traits can be screened. The present invention has important application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for screening wheat with different plant heights, tillers and yields. Background Art

[0002] Wheat (Triticum aestivum L.) is one of my country's most important staple crops. Increasing wheat yield is a key measure to meet the ever-increasing demand for food and a strategic goal for ensuring food security. Currently, researchers have identified a large number of QTLs that regulate wheat yield. However, because the phenotypic contribution of most QTLs is small and their reproducibility is poor across years and environments, their application in genetic improvement of wheat yield is difficult.

[0003] Molecular markers are genetic markers based on nucleotide sequence variations within genetic material between individuals and reflect polymorphism at the nucleotide sequence level. DNA markers can be broadly divided into four categories: the first category is based on molecular hybridization, primarily including restriction fragment length polymorphisms (RFLPs) and variable number of tandem repeats (VNTRs); the second category is based on PCR, primarily including random amplified polymorphism DNA (RAPDs), simple sequence repeats (SSRs), and sequence tagged sites (STSs); the third category is based on a combination of restriction endonuclease digestion and PCR, including amplified fragment length polymorphisms (AFLPs) and cleaved amplified polymorphism sequences (CAPSs); and the fourth category is a new generation of molecular markers based on whole-genome sequences, primarily including single nucleotide polymorphisms (SNPs) and insertion-deletion polymorphisms (InDels).

[0004] SNPs refer to nucleotide sequence polymorphisms caused by changes at the level of a single nucleotide base, including substitutions, transversions, insertions, and deletions. SNPs can exist at any position in a gene and can be divided into coding region SNPs and non-coding region SNPs according to their location. SNPs in the coding region can be further divided into synonymous mutations and non-synonymous mutations. In synonymous mutations, changes in bases will not cause changes in the amino acids of the translated protein, while changes in base sequences in non-synonymous mutations will cause changes in the translated protein sequence and thus affect the function of the protein. SNPs are the most abundant type of variation in plant genomes, and their detection methods are simple. They have been widely used in genetic research of crops, including whole-genome or candidate gene association analysis, construction of high-density linkage maps, fine-grained trait mapping, and genetic diversity analysis.

[0005] InDels are insertions or deletions of genomic base sequences at the same locus between individuals of the same species, typically small insertions or deletions ranging from 1 to 50 bp in length. InDels, larger insertions or deletions exceeding 50 bp in length, also exist within organisms and represent a significant form of genomic structural variation. Numerous studies have shown that these large deletions or insertions play a crucial role in explaining phenotypic differences that influence a range of important agronomic and quality traits in crops. InDels are widely distributed, densely distributed, and numerous throughout the genome, second only to single-nucleotide polymorphisms (SNPs). Compared to SNP markers, InDel markers are simpler, using PCR primers designed to amplify insertion / deletion sites within the genome and typing using agarose gel electrophoresis. InDel markers are widely used in crop genetic diversity analysis, gene mapping, and cultivar identification.

[0006] Association analysis is a new method that uses linkage disequilibrium as an experimental basis to identify the relationship between phenotypic traits and genetic markers or candidate genes in a natural population, thereby discovering functional loci that control the target traits. Depending on the scope of molecular marker scanning, association analysis can be divided into genome-wide association studies (GWAS) and candidate gene association studies (CGAS). GWAS mainly uses SNP markers at the genome-wide level to screen for variant sites that can cause differences in specific target traits, and then discovers candidate genes that are highly associated with the target traits to reveal the relationship between genotype and phenotypic traits. CGAS mainly uses sequencing analysis of candidate genes, and then conducts association analysis between the variant sites screened by the candidate gene reference sequence and the phenotypic traits of the natural population, thereby discovering allelic variants that have a positive regulatory effect on the target trait. Both have the advantages of less time, wider variation and higher positioning accuracy and are widely used in crop research; however, there are differences in specific operations. The molecular markers used by GWAS in analyzing LD, kinship, population structure, genotype and phenotypic trait association are the same; while the molecular markers used by CGAS in the analysis process are molecular functional markers developed based on the polymorphism of the candidate gene reference sequence. Summary of the Invention

[0007] The purpose of the present invention is to screen or assist in screening wheat with different plant heights, effective tillers and / or yields.

[0008] The present invention firstly protects a method for screening or auxiliary screening of wheat with different plant heights, tillers and / or yields.

[0009] The method for screening or assisting in screening wheat with different plant heights, tillers and / or yields protected by the present invention may specifically be method 1, which may include the following steps: detecting whether the haplotype of the wheat to be tested is haplotype Hap-5B-1 or haplotype Hap-5B-2 based on the TaSAG39-5B gene; the plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 are greater than those of wheat with haplotype Hap-5B-2;

[0010] The wheat of the haplotype Hap-5B-1 is a wheat having a GG homozygous genotype based on the G206T SNP site, a GG homozygous genotype based on the G295ASNP site, a missing genotype based on InDel241-285, and / or a missing genotype based on InDel296-402;

[0011] The wheat of the haplotype Hap-5B-2 is a wheat having a genotype of TT homozygous based on the G206T SNP site, a genotype of AA homozygous based on the G295ASNP site, an insertion genotype based on InDel241-285, and / or an insertion genotype based on InDel296-402;

[0012] The G206T SNP site is the nucleotide at position 206 from the 5' end of SEQ ID NO: 1 in the wheat genome;

[0013] The G295A SNP site is the 295th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome;

[0014] InDel241-285 are nucleotides 241-285 from the 5' end of SEQ ID NO: 1 in the wheat genome;

[0015] InDel296-402 is the nucleotides 296 to 402 from the 5' end of SEQ ID NO: 1 in the wheat genome.

[0016] The method for screening or assisting in screening wheat with different plant heights, tillers and / or yields protected by the present invention may specifically be method 2, which may include the following steps in sequence:

[0017] (A1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1;

[0018] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0019] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0020] (A2) using the PCR amplification product P1 as a template, performing PCR amplification with primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2;

[0021] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;

[0022] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO: 7;

[0023] (A3) evaluating the PCR amplification product P2 as follows: if the PCR amplification product P2 contains only a 222 bp DNA fragment, the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the PCR amplification product P2 contains only a 374 bp DNA fragment, the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-2;

[0024] The plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 were greater than those of wheat with haplotype Hap-5B-2.

[0025] The method for screening or assisting in screening wheat with different plant heights, tillers and / or yields protected by the present invention may specifically be method three, which may include the following steps in sequence:

[0026] (B1) using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1;

[0027] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0028] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0029] (B2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2;

[0030] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;

[0031] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO: 7;

[0032] (B3) sequencing the PCR amplification product P2, and then performing the following evaluation: if the nucleotide sequence of the PCR amplification product P2 is as shown in SEQ ID NO: 2, positions 127 to 348 from the 5' end, the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the nucleotide sequence of the PCR amplification product P2 is as shown in SEQ ID NO: 3, positions 127 to 500 from the 5' end, the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-2;

[0033] The plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 were greater than those of wheat with haplotype Hap-5B-2.

[0034] In any of the above methods, the tillers may be effective tillers.

[0035] The present invention also protects a kit for identifying or assisting in identifying wheat plant height, tillering, and / or yield. The kit may include a substance for detecting whether the haplotype of the wheat to be tested is haplotype Hap-5B-1 or haplotype Hap-5B-2 based on the TaSAG39-5B gene;

[0036] The haplotype Hap-5B-1 is a TaSAG39-5B gene having a GG homozygous genotype based on the G206T SNP site, a GG homozygous genotype based on the G295A SNP site, a deletion genotype based on InDel241-285, and / or a deletion genotype based on InDel296-402;

[0037] The haplotype Hap-5B-2 is a TaSAG39-5B gene having a genotype of TT homozygous based on the G206T SNP site, a genotype of AA homozygous based on the G295A SNP site, an insertion genotype based on InDel241-285, and / or an insertion genotype based on InDel296-402;

[0038] The G206T SNP site is the nucleotide at position 206 from the 5' end of SEQ ID NO: 1 in the wheat genome;

[0039] The G295A SNP site is the 295th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome;

[0040] InDel241-285 are nucleotides 241-285 from the 5' end of SEQ ID NO: 1 in the wheat genome;

[0041] InDel296-402 is the nucleotides 296 to 402 from the 5' end of SEQ ID NO: 1 in the wheat genome.

[0042] The kit may specifically be composed of a substance for detecting whether the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2.

[0043] Any of the above-mentioned substances for detecting whether the haplotype of the wheat to be tested is haplotype Hap-5B-1 or haplotype Hap-5B-2 based on the TaSAG39-5B gene may include primer pair A consisting of primer F1 and primer R1 and / or primer pair B consisting of primer F2 and primer R2;

[0044] The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4;

[0045] The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5;

[0046] The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6;

[0047] The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:7.

[0048] Any of the above-mentioned materials for detecting whether the haplotype of the wheat to be tested is haplotype Hap-5B-1 or haplotype Hap-5B-2 based on the TaSAG39-5B gene can specifically be composed of the primer pair A and the primer pair B.

[0049] Any of the above-mentioned substances for detecting whether the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2 can specifically be composed of the primer pair A.

[0050] In any of the above-mentioned kits, the tillers may be effective tillers.

[0051] The present invention also protects the molecular marker A shown in SEQ ID NO: 2 or the molecular marker B shown in SEQ ID NO: 3.

[0052] The present invention also protects the use of any of the above-mentioned kits, which may be at least one of (z1) to (z4):

[0053] (z1) screening or assisting in screening wheat with different plant height, tillering and / or yield;

[0054] (z2) Identifying or assisting in the identification of wheat plant height, tillering and / or yield;

[0055] (z3) Identify or assist in identifying the haplotype of the wheat TaSAG39-5B gene;

[0056] (z4) Wheat breeding.

[0057] The present invention also protects the use of the molecular marker A or molecular marker B, which can be at least one of (z1)-(z4):

[0058] (z1) screening or assisting in screening wheat with different plant height, tillering and / or yield;

[0059] (z2) Identifying or assisting in the identification of wheat plant height, tillering and / or yield;

[0060] (z3) Identify or assist in identifying the haplotype of the wheat TaSAG39-5B gene;

[0061] (z4) Wheat breeding.

[0062] In the above, if the wheat to be tested has a GG homozygous genotype based on the G206T SNP site, a GG homozygous genotype based on the G295A SNP site, a deletion based on InDel241-285, and / or a deletion based on InDel296-402, then the wheat is determined to be of haplotype Hap-5B-1. If the wheat to be tested has a TT homozygous genotype based on the G206T SNP site, a AA homozygous genotype based on the G295A SNP site, an insertion based on InDel241-285, and / or an insertion based on InDel296-402, then the wheat is determined to be of haplotype Hap-5B-2. The plant height of “wheat of haplotype Hap-5B-1” is greater than the plant height of “wheat of haplotype Hap-5B-2”; the effective tillers of “wheat of haplotype Hap-5B-1” are greater than the effective tillers of “wheat of haplotype Hap-5B-2”; the yield of “wheat of haplotype Hap-5B-1” is greater than the yield of “wheat of haplotype Hap-5B-2”; the “>” indicates statistical significance.

[0063] Experiments have shown that the method provided by the present invention can be used to detect the haplotype of the TaSAG39-5B gene in wheat, and can screen or assist in screening for wheat plant height, tillering, and / or yield traits. The present invention has important application value in the process of molecular marker-assisted breeding of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Wheat is divided into two haplotypes based on the differences in the wheat TaSAG39-5B gene.

[0065] Figure 2 These are the detection results of some wheat in natural populations based on TaSAG39-5B gene haplotype typing. DETAILED DESCRIPTION

[0066] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0067] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0068] In the following examples, the natural population consists of 389 wheat varieties from different regions. Since the wheat materials are all cultivated varieties, they are usually assumed to be highly homozygous plant materials, and all haplotypes are homozygous.

[0069] Example 1. Discovery of two SNP sites and two InDel sites in the wheat TaSAG39-5B gene and establishment of a wheat haplotype typing method based on the TaSAG39-5B gene

[0070] 1. Discovery of two SNPs and two InDel sites in the wheat TaSAG39-5B gene

[0071] The inventors analyzed the polymorphisms of 32 highly polymorphic wheat varieties and discovered two SNPs (designated G206T SNP and G295A SNP) and two InDel sites (designated InDel241-285 and InDel296-402) in the wheat TaSAG39-5B gene (nucleotide sequence shown in SEQ ID NO: 1). The names of the 32 wheat varieties are shown in Table 1.

[0072] Table 1

[0073] serial number Wheat variety name serial number name 1 Jin 2148-7 17 04-030 2 Linkang 5108 18 Beijing No. 14 3 Length 6878 19 Beijing No. 10 4 Changle No. 5 20 An 85 Middle School 124-1 5 White wheat 21 Beijing 8686 6 Changwu 131 22 04-044 7 Dali No. 1 23 Spring 229th-25th 8 Red Monk 24 Jingpin No. 10 9 rattle 25 Spring 049th-5-1 10 Jimai 41 26 Spring 454th-50-1 11 Jimai No. 6 27 Beijing 411 12 Cangzhou wheat 28 Single R8093 13 Yanzhan No. 1 29 Fengkang 13 14 Purple stalk and white awn 30 Beijing Nuclear 8922 15 Neixiang 188 31 Chinese Spring 16 White rough wheat 32 PANDAS

[0074] The G206T SNP is located at position 206 from the 5' end of SEQ ID NO:1, and the genotypes are GG homozygous and TT homozygous. The G295A SNP is located at position 295 from the 5' end of SEQ ID NO:1, and the genotypes are AA homozygous and GG homozygous. InDel241-285 is located at positions 241-285 from the 5' end of SEQ ID NO:1, and the genotypes are insertions or deletions. InDel296-402 is located at positions 296-402 from the 5' end of SEQ ID NO:1, and the genotypes are insertions or deletions. Since genomic DNA is a double-stranded DNA molecule composed of two reverse-complementary single-stranded DNA molecules, the DNA molecule encoding the protein is generally named a sense DNA molecule, and the DNA molecule that is reverse-complementary to the sense DNA molecule is named an antisense DNA molecule. The genotypes of G206T SNP, G295A SNP, InDel241-285, and InDel296-402 were all positive-sense DNA genotypes.

[0075] Wheat is divided into two haplotypes based on the difference of wheat TaSAG39-5B gene (see Figure 1):Hap-5B-1 and Hap-5B-2. The nucleotide sequence of the TaSAG39-5B gene of wheat haplotype Hap-5B-1 is shown in SEQ ID NO: 2. The nucleotide sequence of the TaSAG39-5B gene of wheat haplotype Hap-5B-2 is shown in SEQ ID NO: 3.

[0076] SEQ ID NO: 1 is:

[0077] ATGTCTCTGCCCACGTTCATCTTCGCACTCCTCGTCGTGAGCTGCGCCGTCGCCGCTCCCCGTGCGCTCGCGGTACG

[0078] GGAGCTCGCCGGCAACGACGCCATCGCCGTCGAAGCTGCCATGGTGTCGAGGCACGAGAAGTGGATGGCGGAGCACG

[0079] GGCGCACGTACGCGGACGAGGAGGAGAAGGCGCGGCGGCTGGAGGTATTCCKCGCCAACGCCAAGTTCATCGACTCG

[0080] TTTAACGCCGCGGAGGAGAGCAGCCACCGGCTGGCCACCAACAGGTTCGCCGACCTCACCGTCRAGGAGTTCCGCGC

[0081] CGCGAGGACCGGCCTCCAGCGCCCGGCGGCGGCCGTGGCTGGCGCCGGGAGAGGCGCTGGGGGGTTCAGGTACGAGA

[0082] ACTTCAGCCTGGCCGACGCAGCGGGGAGCATGGACTGGAGGGCCATGGGCGCCGTCACCGGGCTCAAGGACCAAGGC

[0083] TCTTGCGGTACGTACAATCAACACGACAACACTGGCACGCACGCTACTGCAGATGCATACAAATTAAGCTGCAGAAC

[0084] ATTGCAAGCACCGGAACATTTACCACCTGGATCAAGCTTTTTTAGACTTCTAAAAATGTTAAAAAAGAACTTGCAAG

[0085] TGGCAACACGCGCGTAGGAAAAGTAAAAAATTGACGTGAGATTGTACCGGGATGACCAGAGTCTACAAACAAGTCAT

[0086] GCGTGCACTTTTCGGTCAACCCAGACAGCAAGAGGAGTCAGCGTTCACTTTACTTCAATGATTGGAGTATCATTCTT

[0087] AATTTTCCATTTTGGACATGTCCTAAGCTTAATTGCCTCTGTTTCATCATTTAATCAAATAACTTGGGTGACATGCA

[0088] TATGCAGGCTGCTGCTGGGCGTTCTCGGCGGTGGCGGCGGTGGAAGGGCTGACCAAGATCCGCACGGGGCGGCTTAT

[0089] GTCACTGTCGGAGCAGCAGCTGGTGGACTGCGACGTGAACGGCGACGACGAGGGCTGCGCCGGCGGCCTCATGGACA

[0090] ACGCCTTCGAGTACATGGTCCGCCGCGGCGGCCTCACCACGGAGTCGTCCTACCCGTACCGCGGCACGGACGGGTCG

[0091] TGCCGCCGCTCGGCCTCGGCCGCGTCCATCCGGGGGTACGAGGACGTGCCGGCCAACAACGAGGCCGCGCTGATGGC

[0092] GGCCGTGGCGCACCAGCCCGTGTCCGTGGCCATCAACGGCGGCGACAGCGTGTTCCGGTTCTACGACAGCGGCGTGC

[0093] TGGGCGGGTCCGGCTGCGGCACGGAGCTCAACCACGCCATCACGGCGGTCGGGTACGGCACGGCGGGCGACGGCACC

[0094] AAGTACTGGATCATGAAGAACTCGTGGGGCGGGTCGTGGGGCGAGGGCGGCTACGTCAGGATCCGCCGCGGCGTGCG

[0095] CGGCGAGGGCGTCTGCGGCCTCGCCCAGCTCGCGTCCTACCCTGTCTAG

[0096] SEQ ID NO:2 is:

[0097] ATGTCTCTGCCCACGTTCATCTTCGCACTCCTCGTCGTGAGCTGCGCCGTCGCCGCTCCCCGTGCGCTCGCGGTACG

[0098] GGAGCTCGCCGGCAACGACGCCATCGCCGTCGAAGCTGCCATGGTGTCGAGGCACGAGAAGTGGATGGCGGAGCACG

[0099] GGCGCACGTACGCGGACGAGGAGGAGAAGGCGCGGCGGCTGGAGGTATTCCGCGCCAACGCCAAGTTCATCGACTCG

[0100] TTTAACGCCCTCACCGTCGGCAGCGGGGAGCATGGACTGGAGGGCCATGGGCGCCGTCACCGGCGTCAAGGACCAAG

[0101] GCTCTTGCGGTACGTACAATCAACACGACAACACTGGCACGCACGCTACTGCAGATGCATACAAATTAAGCTGCAGA

[0102] ACATTGCAAGCACCGGAACATTTACCACCTGGATCAAGCTTTTTTAGACTTCTAAAAATGTTAAAAAAGAACTTGCA [[ID=​​ATGCGTGCACTTTTCGGTCAACCCAGACAGCAAGAGGAGTCAGCGTTCACTTTACTTCAATGATTGGAGTATCATTC

[0105] TTAATTTTCCATTTTGGACATGTCCTAAGCTTAATTGCCTCTGTTTCATCATTTAATCAAATAACTTGGGTGACATG

[0106] CATATGCAGGCTGCTGCTGGGCGTTCTCGGCGGTGGCGGCGGTGGAAGGGCTGACCAAGATCCGCACGGGGCGGCTT

[0107] ATGTCACTGTCGGAGCAGCAGCTGGTGGACTGCGACGTGAACGGCGACGACGAGGGCTGCGCCGGCGGCCTCATGGA

[0108] CAACGCCTTCGAGTACATGGTCCGCCGCGGCGGCCTCACCACGGAGTCGTCCTACCCGTACCGCGGCACGGACGGGT

[0109] CGTGCCGCCGCTCGGCCTCGGCCGCGTCCATCCGGGGGTACGAGGACGTGCCGGCCAACAACGAGGCCGCGCTGATG

[0110] GCGGCCGTGGCGCACCAGCCCGTGTCCGTGGCCATCAACGGCGGCGACAGCGTGTTCCGGTTCTACGACAGCGGCGT

[0111] GCTGGGCGGGTCCGGCTGCGGCACGGAGCTCAACCACGCCATCACGGCGGTCGGGTACGGCACGGCGGGCGACGGCA

[0112] CCAAGTACTGGATCATGAAGAACTCGTGGGGCGGGTCGTGGGGCGAGGGCGGCTACGTCAGGATCCGCCGCGGCGTG

[0113] CGCGGCGAGGGCGTCTGCGGCCTCGCCCAGCTCGCGTCCTACCCTGTCTAG

[0114] SEQ ID NO:3 is as follows:

[0115] ATGTCTCTGCCCACGTTCATCTTCGCACTCCTCGTCGTGAGCTGCGCCGTCGCCGCTCCCCGTGCGCTCGCGGTACG

[0116] GGAGCTCGCCGGCAACGACGCCATCGCCGTCGAAGCTGCCATGGTGTCGAGGCACGAGAAGTGGATGGCGGAGCACG

[0117] GGCGCACGTACGCGGACGAGGAGGAGAAGGCGCGGCGGCTGGAGGTATTCCTCGCCAACGCCAAGTTCATCGACTCG

[0118] TTTAACGCCGCGGAGGAGAGCAGCCACCGGCTGGCCACCAACAGGTTCGCCGACCTCACCGTCAAGGAGTTCCGCGC

[0119] CGCGAGGACCGGCCTCCAGCGCCCGGCGGCGGCCGTGGCTGGCGCCGGGAGAGGCGCTGGGGGGTTCAGGTACGAGA

[0120] ACTTCAGCCTGGCCGACGCAGCGGGGAGCATGGACTGGAGGGCCATGGGCGCCGTCACCGGCGTCAAGGACCAAGGC <able>0000327< / able>TCTTGCGGTACGTACAATCAACACGACAACACTGGCACGCACGCTACTGCAGATGCATACAAATTAAGCTGCAGAAC

[0122] ATTGCAAGCACCGGAACATTTACCACCTGGATCAAGCTTTTTTAGACTTCTAAAAATGTTAAAAAAGAACTTGCAAG

[0123] TGGCAACACGCGCGTAGGAAAAGTAAAAAATTGACGTGAGATTGTACCGGGATGACCAGAGTCTACAAACAAGTCAT

[0124] It should be noted that in the original text, there seems to be an incorrect tag `<able>0000327< / able>` which should probably be `<\

[0121] `. The above translation is based on the provided text as accurately as possible while maintaining the integrity of the tags.GCGTGCACTTTTCGGTCAACCCAGACAGCAAGAGGAGTCAGCGTTCACTTTACTTCAATGATTGGAGTATCATTCTT

[0125] AATTTTCCATTTTGGACATGTCCTAAGCTTAATTGCCTCTGTTTCATCATTTAATCAAATAACTTGGGTGACATGCA

[0126] TATGCAGGCTGCTGCTGGGCGTTCTCGGCGGTGGCGGCGGTGGAAGGGCTGACCAAGATCCGCACGGGGCGGCTTAT

[0127] GTCACTGTCGGAGCAGCAGCTGGTGGACTGCGACGTGAACGGCGACGACGAGGGCTGCGCCGGCGGCCTCATGGACA

[0128] ACGCCTTCGAGTACATGGTCCGCCGCGGCGGCCTCACCACGGAGTCGTCCTACCCGTACCGCGGCACGGACGGGTCG

[0129] TGCCGCCGCTCGGCCTCGGCCGCGTCCATCCGGGGGTACGAGGACGTGCCGGCCAACAACGAGGCCGCGCTGATGGC

[0130] GGCCGTGGCGCACCAGCCCGTGTCCGTGGCCATCAACGGCGGCGACAGCGTGTTCCGGTTCTACGACAGCGGCGTGC

[0131] TGGGCGGGTCCGGCTGCGGCACGGAGCTCAACCACGCCATCACGGCGGTCGGGTACGGCACGGCGGGCGACGGCACC

[0132] AAGTACTGGATCATGAAGAACTCGTGGGGCGGGTCGTGGGGCGAGGGCGGCTACGTCAGGATCCGCCGCGGCGTGCG

[0133] CGGCGAGGGCGTCTGCGGCCTCGCCCAGCTCGCGTCCTACCCTGTCTAG

[0134] 2. Synthesis of Primer Pair A and Primer Pair B for Amplifying Target Sequences Including G206T SNP, G295A SNP, InDel241-285, and InDel296-402

[0135] Primer pair A and primer pair B were designed and synthesized for amplifying target sequences including the G206T SNP, the G295A SNP, InDel241-285, and InDel296-402. Primer pair A consisted of primer F1 and primer R1. Primer pair B consisted of primer F2 and primer R2.

[0136] The nucleotide sequences of each primer are as follows:

[0137] Primer F1: 5′-GCGTGAGAGGACGTGTATGG-3′ (SEQ ID NO: 4)

[0138] Primer R1: 5′-CCATACGGCAAGCTAGCG-3′ (SEQ ID NO: 5)

[0139] Primer F2: 5′-AGGCACGAGAAGTGGATG-3′ (SEQ ID NO: 6)

[0140] Primer R2: 5′-GTGCCAGTGTTGTCGTGT-3′ (SEQ ID NO: 7)

[0141] The target sequence amplified by primer pair B is shown in SEQ ID NO: 2 at positions 127 to 348 from the 5' end or in SEQ ID NO: 3 at positions 127 to 500 from the 5' end.

[0142] 3. Establishment of a wheat haplotype typing method based on the TaSAG39-5B gene

[0143] 1. Extract the genomic DNA of the wheat to be tested.

[0144] 2. Using the genomic DNA of the wheat to be tested in step 1 as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1.

[0145] 3. After completing step 2, using the PCR amplification product P1 as a template, PCR amplification is performed on primer pair B using primer F2 and primer R2 to obtain the PCR amplification product P2.

[0146] 4. The PCR amplification product P2 obtained in step 3 was subjected to 2% agarose gel electrophoresis for the following determination: if the size of the PCR amplification product P2 is 222 bp and / or the nucleotide sequence is as shown in SEQ ID NO: 2 from positions 127 to 348 from the 5' end, the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the size of the PCR amplification product P2 is 374 bp and / or the nucleotide sequence is as shown in SEQ ID NO: 3 from positions 127 to 500 from the 5' end, the haplotype of the wheat to be tested based on the TaSAG39-5B gene is haplotype Hap-5B-2.

[0147] Example 2. Association analysis between wheat haplotype typing based on the TaSAG39-5B gene and wheat agronomic traits (such as plant height, effective tillering and yield)

[0148] 1. Haplotype typing of wheat in natural populations based on the TaSAG39-5B gene

[0149] Haplotypes were performed on each wheat variety in the natural population using the method described in step 3 of Example 1. The natural population consisted of 389 wheat varieties (all hexaploid). The wheat variety names are detailed in Table 2.

[0150] Some test results can be found in Figure 2 (M is a DNA marker, I is haplotype Hap-5B-2, and D is haplotype Hap-5B-1).

[0151] The haplotype typing of 389 wheat varieties based on the TaSAG39-5B gene is shown in Table 2: the haplotype of 251 wheat varieties based on the TaSAG39-5B gene is haplotype Hap-5B-1, and the haplotype of 138 wheat varieties based on the TaSAG39-5B gene is haplotype Hap-5B-2.

[0152] Table 2. Haplotypes based on the TaSAG39-5B gene in natural populations

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164] 2. Testing of plant height, effective tillering and yield

[0165] A total of 389 wheat varieties from a natural population were planted in five environments, E1 to E5. After harvest, the average plant height, average effective tillering, and average yield of the two haplotypes were calculated.

[0166] The five environments were 2021-SX-DS+LN(E1), 2020-SX-WW+LN(E2), 2019-SX-WW+N(E3), 2019-HB-WW+N(E4) and 2018-SX-WW+N(E5), and were named as planting year-planting location-water management+nitrogen treatment. SX was the Shenfeng experimental field of Shanxi Agricultural University, HB was the Zhaoxian experimental field in Hebei Province, DS was drought-fed (i.e., rain-fed during the entire growth and development period of wheat without artificial irrigation), WW was irrigated (i.e., watering during the three periods before wintering, jointing stage, and heading stage), and N was normal nitrogen treatment (i.e., nitrogen application at a rate of 18 kg / 667 m3). 2 (calculated as pure nitrogen), 30%, 40% and 30% of the total nitrogen fertilizer was applied during irrigation before wintering, at the jointing stage and at the heading stage respectively). LN was the low nitrogen treatment (i.e. no nitrogen was applied during the entire growth process of wheat).

[0167] The statistical results are shown in Table 3.

[0168] Table 3-1

[0169]

[0170] Note: P value is the significance level of association analysis. * indicates P < 0.05, ** Indicates P < 0.01, *** Indicates P<0.001.

[0171] Table 3-2

[0172]

[0173] Note: P value is the significance level of association analysis. * indicates P < 0.05,** Indicates P < 0.01, *** Indicates P<0.001.

[0174] Table 3-3

[0175]

[0176] Note: P value is the significance level of association analysis. * indicates P < 0.05, ** Indicates P < 0.01, *** Indicates P<0.001.

[0177] 3. Correlation Analysis

[0178] Using Tassel 5.0 software

[0179] The haplotypes of the wheat TaSAG39-5B gene in natural populations were associated with plant height, effective tillering, and yield. The results are shown in Table 3.

[0180] The results showed that, among a natural population of 389 wheat varieties, haplotype Hap-5B-1 had a higher plant height than haplotype Hap-5B-2; the number of effective tillers of haplotype Hap-5B-1 was higher than that of haplotype Hap-5B-2; and the yield of haplotype Hap-5B-1 was higher than that of haplotype Hap-5B-2. The ">" indicates a statistically significant difference. Studies on natural populations indicate that haplotype Hap-5B-1 is a superior haplotype for improving plant height, effective tillering, and yield in wheat.

[0181] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A method for screening or assisting in screening wheat with different plant height, tillering and / or yield, comprising the following steps: detecting the wheat to be tested based on TaSAG39-5B Whether the haplotype of the gene is haplotype Hap-5B-1 or haplotype Hap-5B-2; The plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 were greater than those of wheat with haplotype Hap-5B-2; The wheat of the haplotype Hap-5B-1 is a wheat having a genotype of GG homozygous based on the G206T SNP site, a genotype of GG homozygous based on the G295ASNP site, a genotype of missing based on InDel241-285, and a genotype of missing based on InDel296-402; The wheat of the haplotype Hap-5B-2 is a wheat having a genotype of TT homozygous based on the G206T SNP site, a genotype of AA homozygous based on the G295ASNP site, an insertion genotype based on InDel241-285, and an insertion genotype based on InDel296-402; The G206T SNP site is the nucleotide at position 206 from the 5' end of SEQ ID NO: 1 in the wheat genome; The G295A SNP site is the 295th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome; InDel241-285 are nucleotides 241-285 from the 5' end of SEQ ID NO: 1 in the wheat genome; InDel296-402 is the nucleotides 296 to 402 from the 5' end of SEQ ID NO: 1 in the wheat genome.

2. A method for screening or assisting in screening wheat with different plant heights, tillers and / or yields, comprising the following steps in sequence: (B1) Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using primer pair A consisting of primer F1 and primer R1 to obtain PCR amplification product P1; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; (B2) using the PCR amplification product P1 as a template, performing PCR amplification on primer pair B consisting of primer F2 and primer R2 to obtain a PCR amplification product P2; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO: 7; (B3) Sequencing the PCR amplification product P2, and then making the following judgment: If the nucleotide sequence of the PCR amplification product P2 is as shown in SEQ ID NO: 2 from the 127th to the 348th position from the 5' end, the wheat to be tested is based on TaSAG39-5B The haplotype of the gene is haplotype Hap-5B-1; if the nucleotide sequence of the PCR amplification product P2 is as shown in SEQ ID NO:3 from the 127th to the 500th position from the 5' end, the wheat to be tested is based on TaSAG39-5B The haplotype of the gene was haplotype Hap-5B-2; The plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 were greater than those of wheat with haplotype Hap-5B-2.

3. The method according to claim 1 or 2, characterized in that: The tillers are effective tillers.

4. A kit for identifying or assisting in identifying wheat plant height, tillering and / or yield, comprising: TaSAG39-5B Whether the haplotype of the gene is haplotype Hap-5B-1 or haplotype Hap-5B-2; The haplotype Hap-5B-1 is a GG homozygous genotype based on the G206T SNP site, a GG homozygous genotype based on the G295A SNP site, a deletion genotype based on InDel241-285, and a deletion genotype based on InDel296-402. TaSAG39-5B Gene; The haplotype Hap-5B-2 is a TT homozygous type based on the G206T SNP site, an AA homozygous type based on the G295A SNP site, an insertion type based on InDel241-285, and an insertion type based on InDel296-402. TaSAG39-5B Gene; The G206T SNP site is the nucleotide at position 206 from the 5' end of SEQ ID NO: 1 in the wheat genome; The G295A SNP site is the 295th nucleotide from the 5' end of SEQ ID NO: 1 in the wheat genome; InDel241-285 are nucleotides 241-285 from the 5' end of SEQ ID NO: 1 in the wheat genome; InDel296-402 is the nucleotides 296 to 402 from the 5' end of SEQ ID NO: 1 in the wheat genome.

5. The kit according to claim 4, wherein: The detection of wheat to be tested is based on TaSAG39-5B The material for determining whether the haplotype of the gene is haplotype Hap-5B-1 or haplotype Hap-5B-2 includes a primer pair A consisting of primer F1 and primer R1 and a primer pair B consisting of primer F2 and primer R2; The primer F1 is a single-stranded DNA molecule shown in SEQ ID NO: 4; The primer R1 is a single-stranded DNA molecule shown in SEQ ID NO: 5; The primer F2 is a single-stranded DNA molecule shown in SEQ ID NO: 6; The primer R2 is a single-stranded DNA molecule shown in SEQ ID NO:

7.

6. The kit according to claim 4 or 5, characterized in that: The tillers are effective tillers.

7. Molecular markers, comprising molecular marker A shown in SEQ ID NO: 2 and molecular marker B shown in SEQ ID NO:

3.

8. Use of the kit according to any one of claims 4 to 6, comprising at least one of (z1) to (z3): (z1) Screening or assisting in the screening of wheat with different plant height, tillering and / or yield; (z2) Identification or auxiliary identification of wheat plant height, tillering and / or yield; (z3) Identification or auxiliary identification of wheat TaSAG39-5B Haplotype of the gene; The plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 were greater than those of wheat with haplotype Hap-5B-2.

9. The use of the molecular marker according to claim 7, which is at least one of (z1)-(z3): (z1) Screening or assisting in the screening of wheat with different plant height, tillering and / or yield; (z2) Identification or assistance in identification of wheat plant height, tillering and / or yield; (z3) Identification or auxiliary identification of wheat TaSAG39-5B Haplotype of the gene; Haplotype Hap-5B-1 of wheat TaSAG39-5B The nucleotide sequence of the gene is shown in SEQ ID NO: 2; Haplotype Hap-5B-2 of wheat TaSAG39-5B The nucleotide sequence of the gene is shown in SEQ ID NO: 3; The plant height, tillering and / or yield of wheat with haplotype Hap-5B-1 were greater than those of wheat with haplotype Hap-5B-2.

Images