Anti-pd-1 antibodies

Abstract

The present invention relates to novel anti-PD-1 (Programmed Cell Death 1) antibodies and antigen-binding fragments thereof, and compositions using the same, for use in therapeutic and diagnostic methods.

Description

[0001] SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on April 29, 2021, is named 09-0701-WO-l_SL.txt and is 136,527 bytes in size. TECHNICAL FIELD

[0003] The present invention relates generally to anti-PD-1 (Programmed Cell Death 1) antibodies for therapeutic and diagnostic uses. More specifically, anti-PD-1 antibodies and methods of use are disclosed for treating various diseases or disorders characterized by cells expressing PD-1. Pharmaceutical compositions and kits comprising anti-PD-1 antibodies are also disclosed. BACKGROUND

[0004] Programmed cell death 1, also known as PD-1 and CD279 (cluster of differentiation 279), is a cell surface receptor protein that is primarily expressed on T cells, as well as other immune cells. The PD-1 pathway is a key regulator of the induction and maintenance of immune tolerance. The protein acts as an "immune checkpoint" inhibitor, that is, it regulates the activity of cells in the immune system in order to modulate and limit autoimmune disease. PD-1 has two ligands, PD-L1 and PD-L2, which interact with cell surface receptors. Upon binding, PD-1 induces intracellular signals that negatively regulate T cell responses. PD-1 expression is upregulated on the surface of activated T cells after the T cells recognize a peripheral antigen; subsequently, higher binding of PD-1 to PD-L1 and PD-L2 is a key step in downstream inhibitory signaling. PD-1 is also associated with increased Treg cell proliferation and enhanced immunosuppressive function.

[0005] It has been appreciated in recent years that many cancers can protect themselves from the immune system and thus avoid detection by modifying "immune checkpoint" inhibitors. PD-1 inhibitors, a new class of drugs that block PD-1, activate the immune system to attack tumors and to treat certain types of cancer.

[0006] In contrast, defective PD-1 inhibitory function is also associated with the pathophysiology of immune-mediated diseases, and expression of PD-1 or its ligands can be dysregulated or not fully engaged in certain autoimmune indications. Thus, inducing PD-1 activation and using the PD-1 / PD-L1 and / or PD-L2 system represents an alternative approach to dampen the immune response and provides treatment for various immune and inflammatory disorders.

[0007] Accordingly, there is a need for therapies that induce the PD-1 pathway, enhance inhibitory function, and provide treatment for immune and inflammatory disorders controlled by the PD-1 / PD-L1 and / or PD-L2 system. In particular, there is a need for biologic therapeutics, such as antibodies, that modulate the interaction between PD-1 and PD-L1 or PD-L2 without blocking this interaction. SUMMARY

[0008] The present invention provides antibodies that specifically bind to human PD-1. In one aspect of the invention, the antibodies of the invention do not block the interaction between PD-1 and PD-L1. In one aspect of the invention, the antibodies of the invention enhance the interaction between PD-1 and PD-L1. In one aspect of the invention, the antibodies of the invention activate the PD-1 signaling pathway. In one embodiment, the antibodies of the invention are anti-PD-1 agonist antibodies. For example, the antibodies of the invention are useful for treating and / or preventing a disease or disorder that can be alleviated by modulating the interaction between PD-1 and PD-L1, particularly by activating the PD-1 pathway.

[0009] In one aspect, the invention provides an anti-PD-1 antibody, particularly a monoclonal anti-PD-1 antibody, e.g., a humanized monoclonal anti-PD-1 antibody, having one or more of the properties described below. In one aspect, the anti-PD-1 antibodies of the invention bind to purified recombinant human PD-1 with high affinity, e.g., 20 nM or less, e.g., 10 nM or less, e.g., 5 nM or less. In one aspect, the anti-PD-1 antibodies of the invention bind to purified recombinant cynomolgus monkey PD-1 with an affinity of 50 nM or less. In one aspect, the anti-PD-1 antibodies of the invention selectively bind to PD-1, particularly human PD-1. In one aspect, the antibodies of the invention do not bind to mouse, rat, or rabbit PD-1. In one aspect, the anti-PD-1 antibodies of the invention do not block the binding of PD-L1 to PD-1. In one aspect, the anti-PD-1 antibodies of the invention enhance the binding of PD-L1 to PD-1. In one aspect, the anti-PD-1 antibodies of the invention attenuate T cell activity in functional cell assays, e.g., by inhibiting IFNγ production, inhibiting IL-17A production, or inhibiting IL-21 production. In one aspect, the anti-PD-1 antibodies of the invention inhibit human cell accumulation and reduce the levels of human inflammatory cytokines in a mouse model. In one aspect, the anti-PD-1 antibodies of the invention have favorable pharmacokinetic properties. In one aspect, the anti-PD-1 antibodies of the invention have favorable biophysical properties, e.g., yield, mass, stability, or solubility. In one aspect, the invention provides antigen-binding fragments of the antibodies of the invention.

[0010] In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof, comprising:

[0011] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 43 (H-CDR1); an amino acid sequence of SEQ ID NO: 44 (H-CDR2); and an amino acid sequence of SEQ ID NO: 45 (H-CDR3), and

[0012] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 1 (L-CDR1); an amino acid sequence of SEQ ID NO: 2 (L-CDR2); and an amino acid sequence of SEQ ID NO: 3 (L-CDR3),

[0013] or

[0014] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 43 (H-CDR1); an amino acid sequence of SEQ ID NO: 46 (H-CDR2); and an amino acid sequence of SEQ ID NO: 45 (H-CDR3), and

[0015] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 1 (L-CDR1); an amino acid sequence of SEQ ID NO: 2 (L-CDR2); and an amino acid sequence of SEQ ID NO: 3 (L-CDR3),

[0016] or

[0017] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 47 (H-CDR1); an amino acid sequence of SEQ ID NO: 48 (H-CDR2); and an amino acid sequence of SEQ ID NO: 49 (H-CDR3), and

[0018] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 4 (L-CDR1); an amino acid sequence of SEQ ID NO: 5 (L-CDR2); and an amino acid sequence of SEQ ID NO: 6 (L-CDR3),

[0019] or

[0020] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 50 (H-CDR1); an amino acid sequence of SEQ ID NO: 51 (H-CDR2); and an amino acid sequence of SEQ ID NO: 52 (H-CDR3), and

[0021] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 7 (L-CDR1); an amino acid sequence of SEQ ID NO: 8 (L-CDR2); and an amino acid sequence of SEQ ID NO: 9 (L-CDR3),

[0022] or

[0023] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 53 (H-CDR1); an amino acid sequence of SEQ ID NO: 54 (H-CDR2); and an amino acid sequence of SEQ ID NO: 55 (H-CDR3), and

[0024] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 10 (L-CDR1); an amino acid sequence of SEQ ID NO: 11 (L-CDR2); and an amino acid sequence of SEQ ID NO: 12 (L-CDR3),

[0025] or

[0026] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 56 (H-CDR1); an amino acid sequence of SEQ ID NO: 57 (H-CDR2); and an amino acid sequence of SEQ ID NO: 58 (H-CDR3), and

[0027] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 13 (L-CDR1); an amino acid sequence of SEQ ID NO: 14 (L-CDR2); and an amino acid sequence of SEQ ID NO: 15 (L-CDR3),

[0028] or

[0029] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 59 (H-CDR1); an amino acid sequence of SEQ ID NO: 60 (H-CDR2); and an amino acid sequence of SEQ ID NO: 61 (H-CDR3), and

[0030] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 16 (L-CDR1); an amino acid sequence of SEQ ID NO: 17 (L-CDR2); and an amino acid sequence of SEQ ID NO: 18 (L-CDR3),

[0031] or

[0032] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 62 (H-CDR1); an amino acid sequence of SEQ ID NO: 63 (H-CDR2); and an amino acid sequence of SEQ ID NO: 64 (H-CDR3), and

[0033] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 19 (L-CDR1); an amino acid sequence of SEQ ID NO: 20 (L-CDR2); and an amino acid sequence of SEQ ID NO: 21 (L-CDR3),

[0034] or

[0035] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 65 (H-CDR1); an amino acid sequence of SEQ ID NO: 66 (H-CDR2); and an amino acid sequence of SEQ ID NO: 67 (H-CDR3), and

[0036] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 22 (L-CDR1); an amino acid sequence of SEQ ID NO: 23 (L-CDR2); and an amino acid sequence of SEQ ID NO: 24 (L-CDR3),

[0037] or

[0038] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 68 (H-CDR1); an amino acid sequence of SEQ ID NO: 69 (H-CDR2); and an amino acid sequence of SEQ ID NO: 70 (H-CDR3), and

[0039] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 25 (L-CDR1); an amino acid sequence of SEQ ID NO: 26 (L-CDR2); and an amino acid sequence of SEQ ID NO: 27 (L-CDR3),

[0040] or

[0041] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 71 (H-CDR1); an amino acid sequence of SEQ ID NO: 72 (H-CDR2); and an amino acid sequence of SEQ ID NO: 58 (H-CDR3), and

[0042] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 28 (L-CDR1); an amino acid sequence of SEQ ID NO: 14 (L-CDR2); and an amino acid sequence of SEQ ID NO: 29 (L-CDR3),

[0043]

[0044] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 74 (H-CDR2); and an amino acid sequence of SEQ ID NO: 75 (H-CDR3), and

[0045] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 30 (L-CDR1); an amino acid sequence of SEQ ID NO: 31 (L-CDR2); and an amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0046]

[0047] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0048] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 30 (L-CDR1); an amino acid sequence of SEQ ID NO: 31 (L-CDR2); and an amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0049]

[0050] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 78 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0051] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 30 (L-CDR1); an amino acid sequence of SEQ ID NO: 31 (L-CDR2); and an amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0052]

[0053] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0054] ​​​​a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0055] or

[0056] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0057] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0058] or

[0059] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0060] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0061] or

[0062] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0063] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 76 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0064] or

[0065] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0066] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 165 (L-CDR1); an amino acid sequence of SEQ ID NO: 167 (L-CDR2); and an amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0067] or

[0068] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 80 (H-CDR1); an amino acid sequence of SEQ ID NO: 81 (H-CDR2); and an amino acid sequence of SEQ ID NO: 82 (H-CDR3), and

[0069] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 33 (L-CDR1); an amino acid sequence of SEQ ID NO: 14 (L-CDR2); and an amino acid sequence of SEQ ID NO: 34 (L-CDR3),

[0070] or

[0071] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 83 (H-CDR1); an amino acid sequence of SEQ ID NO: 84 (H-CDR2); and an amino acid sequence of SEQ ID NO: 85 (H-CDR3), and

[0072] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 16 (L-CDR1); an amino acid sequence of SEQ ID NO: 35 (L-CDR2); and an amino acid sequence of SEQ ID NO: 36 (L-CDR3),

[0073] or

[0074] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 86 (H-CDR1); an amino acid sequence of SEQ ID NO: 87 (H-CDR2); and an amino acid sequence of SEQ ID NO: 88 (H-CDR3), and

[0075] a light chain variable region comprising an amino acid sequence of SEQ ID NO: 37 (L-CDR1); an amino acid sequence of SEQ ID NO: 38 (L-CDR2); and an amino acid sequence of SEQ ID NO: 39 (L-CDR3),

[0076]

[0077] a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 89 (H-CDR1); the amino acid sequence of SEQ ID NO: 90 (H-CDR2); and the amino acid sequence of SEQ ID NO: 91 (H-CDR3), and

[0078] a light chain variable region comprising the amino acid sequence of SEQ ID NO: 40 (L-CDR1); the amino acid sequence of SEQ ID NO: 41 (L-CDR2); and the amino acid sequence of SEQ ID NO: 42 (L-CDR3).

[0079] In one embodiment, the present application provides an anti-PD-1 antibody or antigen binding fragment, comprising:

[0080] a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 73 (H-CDR1); the amino acid sequence of SEQ ID NO: 74 (H-CDR2); and the amino acid sequence of SEQ ID NO: 75 (H-CDR3), and

[0081] a light chain variable region comprising the amino acid sequence of SEQ ID NO: 30 (L-CDR1); the amino acid sequence of SEQ ID NO: 31 (L-CDR2); and the amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0082]

[0083] a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 73 (H-CDR1); the amino acid sequence of SEQ ID NO: 76 (H-CDR2); and the amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0084] a light chain variable region comprising the amino acid sequence of SEQ ID NO: 30 (L-CDR1); the amino acid sequence of SEQ ID NO: 31 (L-CDR2); and the amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0085]

[0086] a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 73 (H-CDR1); the amino acid sequence of SEQ ID NO: 78 (H-CDR2); and the amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0087] ​​​a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0088] or

[0089] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0090] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0091] or

[0092] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0093] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0094] or

[0095] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0096] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO: 73 (H-CDR1); an amino acid sequence of SEQ ID NO: 79 (H-CDR2); and an amino acid sequence of SEQ ID NO: 77 (H-CDR3), and

[0097] or

[0098] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:73 (H-CDR1); an amino acid sequence of SEQ ID NO: 78 (H-CDR2); and an amino acid sequence of SEQ ID NO:77 (H-CDR3), and

[0099] a light chain variable region comprising an amino acid sequence of SEQ ID NO:165 (L-CDR1); an amino acid sequence of SEQ ID NO:166 (L-CDR2); and an amino acid sequence of SEQ ID NO:32 (L-CDR3),

[0100] or

[0101] a heavy chain variable region comprising an amino acid sequence of SEQ ID NO:73 (H-CDR1); an amino acid sequence of SEQ ID NO:79 (H-CDR2); and an amino acid sequence of SEQ ID NO:77 (H-CDR3), and

[0102] a light chain variable region comprising an amino acid sequence of SEQ ID NO:165 (L-CDR1); an amino acid sequence of SEQ ID NO:167 (L-CDR2); and an amino acid sequence of SEQ ID NO:32 (L-CDR3).

[0103] In one embodiment, the present application provides an anti-PD-1 antibody or antigen binding fragment, comprising:

[0104] a heavy chain variable region comprising any one of:

[0105] an amino acid sequence of SEQ ID NO:73 (H-CDR1); an amino acid sequence of SEQ ID NO:74 (H-CDR2); and an amino acid sequence of SEQ ID NO:75 (H-CDR3),

[0106] an amino acid sequence of SEQ ID NO:73 (H-CDR1); an amino acid sequence of SEQ ID NO:76 (H-CDR2); and an amino acid sequence of SEQ ID NO:77 (H-CDR3),

[0107] an amino acid sequence of SEQ ID NO:73 (H-CDR1); an amino acid sequence of SEQ ID NO:78 (H-CDR2); and an amino acid sequence of SEQ ID NO:77 (H-CDR3), or

[0108] the amino acid sequence of SEQ ID NO: 73 (H-CDR1); the amino acid sequence of SEQ ID NO: 79 (H-CDR2); and the amino acid sequence of SEQ ID NO: 77 (H-CDR3);

[0109] and

[0110] a light chain variable region comprising any one of:

[0111] the amino acid sequence of SEQ ID NO: 30 (L-CDR1); the amino acid sequence of SEQ ID NO: 31 (L-CDR2); and the amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0112] the amino acid sequence of SEQ ID NO: 164 (L-CDR1); the amino acid sequence of SEQ ID NO: 31 (L-CDR2); and the amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0113] the amino acid sequence of SEQ ID NO: 165 (L-CDR1); the amino acid sequence of SEQ ID NO: 166 (L-CDR2); and the amino acid sequence of SEQ ID NO: 32 (L-CDR3),

[0114] the amino acid sequence of SEQ ID NO: 165 (L-CDR1); the amino acid sequence of SEQ ID NO: 167 (L-CDR2); and the amino acid sequence of SEQ ID NO: 32 (L-CDR3).

[0115] In one embodiment, the CDRs of the anti-PD-1 antibody or antigen-binding fragment thereof are defined according to Chemical Computing Group (CCG) numbering.

[0116] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof as set forth above, wherein the antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof.

[0117] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof as set forth above, wherein the antibody or antigen-binding fragment thereof is selected from the group consisting of a monoclonal antibody, a Fab, a F(ab')2, a Fv, and a scFv.

[0118] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 108 and SEQ ID NO: 92, respectively; SEQ ID NO: 109 and SEQ ID NO: 93, respectively; SEQ ID NO: 110 and SEQ ID NO: 94, respectively; SEQ ID NO: 111 and SEQ ID NO: 95, respectively; SEQ ID NO: 112 and SEQ ID NO: 96, respectively; SEQ ID NO: 113 and SEQ ID NO: 97, respectively; SEQ ID NO: 114 and SEQ ID NO: 98, respectively; SEQ ID NO: 115 and SEQ ID NO: 99, respectively; SEQ ID NO: 116 and SEQ ID NO: 100, respectively; SEQ ID NO: 117 and SEQ ID NO: 101, respectively; SEQ ID NO: 118 and SEQ ID NO: 102, respectively; SEQ ID NO: 119 and SEQ ID NO: 103, respectively; SEQ ID NO: 120 and SEQ ID NO: 104, respectively; SEQ ID NO: 121 and SEQ ID NO: 105, respectively; SEQ ID NO: 122 and SEQ ID NO: 106, respectively; or SEQ ID NO: 123 and SEQ ID NO: 107, respectively.

[0119] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence of any one of SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, or SEQ ID NO: 139; and a light chain variable region comprising the amino acid sequence of any one of SEQ ID NO: 125, SEQ ID NO: 127, or SEQ ID NO: 129.

[0120] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 131 and SEQ ID NO: 125, respectively.

[0121] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 133 and SEQ ID NO: 127, respectively.

[0122] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 135 and SEQ ID NO: 127, respectively.

[0123] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 137 and SEQ ID NO: 129, respectively.

[0124] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 139 and SEQ ID NO: 129, respectively.

[0125] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region having at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequences of SEQ ID NO: 131 and SEQ ID NO: 125, respectively.

[0126] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region having at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequences of SEQ ID NO: 133 and SEQ ID NO: 127, respectively.

[0127] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region having at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequences of SEQ ID NO: 135 and SEQ ID NO: 127, respectively.

[0128] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region that are at least 90%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequences of SEQ ID NO: 137 and SEQ ID NO: 129, respectively.

[0129] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region that are at least 90%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequences of SEQ ID NO: 139 and SEQ ID NO: 129, respectively.

[0130] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof as described above, wherein the antibody comprises a heavy chain constant region selected from the group consisting of an IgG1, IgG2, IgG3, IgG4, IgM, IgA, and IgE constant region, e.g., a human IgG1, IgG2, IgG3, IgG4, IgM, IgA, or IgE.

[0131] In one embodiment, the present application provides an anti-PD1 antibody as described above, wherein the heavy chain constant region is a heavy chain constant region of IgG4 having a Ser228Pro mutation.

[0132] In one embodiment, the present application provides an anti-PD1 antibody as described above, wherein the heavy chain constant region is a heavy chain constant region of IgG1.

[0133] In one embodiment, the present application provides an anti-PD1 antibody as described above, wherein the heavy chain constant region is a heavy chain constant region of IgG1 having Leu234Ala and Leu235Ala mutations.

[0134] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof as described above, wherein the antibody or antigen-binding fragment thereof comprises a light chain constant region selected from the group consisting of kappa and lambda.

[0135] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 143 and SEQ ID NO: 141, respectively.

[0136] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 147 and SEQ ID NO: 145, respectively.

[0137] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, which respectively comprise the amino acid sequences of SEQ ID NO: 149 and SEQ ID NO: 145.

[0138] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, which respectively comprise the amino acid sequences of SEQ ID NO: 153 and SEQ ID NO: 151.

[0139] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, which respectively comprise the amino acid sequences of SEQ ID NO: 155 and SEQ ID NO: 151.

[0140] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, wherein the amino acid sequence of the heavy chain consists of the amino acids of SEQ ID NO: 143 and the amino acid sequence of the light chain consists of the amino acids of SEQ ID NO: 141.

[0141] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, wherein the amino acid sequence of the heavy chain consists of the amino acids of SEQ ID NO: 147 and the amino acid sequence of the light chain consists of the amino acids of SEQ ID NO: 145.

[0142] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, wherein the amino acid sequence of the heavy chain consists of the amino acids of SEQ ID NO: 149 and the amino acid sequence of the light chain consists of the amino acids of SEQ ID NO: 145.

[0143] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, wherein the amino acid sequence of the heavy chain consists of the amino acids of SEQ ID NO: 153 and the amino acid sequence of the light chain consists of the amino acids of SEQ ID NO: 151.

[0144] In one embodiment, the present application provides an anti-PD1 antibody, wherein the antibody comprises a heavy chain and a light chain, wherein the amino acid sequence of the heavy chain consists of the amino acids of SEQ ID NO: 155 and the amino acid sequence of the light chain consists of the amino acids of SEQ ID NO: 151.

[0145] In one embodiment, the anti-PD1 antibody or antigen-binding fragment thereof as described above is a monoclonal antibody or antigen-binding fragment thereof.

[0146] In one embodiment, the anti-PD1 antibody or antigen-binding fragment thereof as described above is a humanized antibody or antigen-binding fragment thereof.

[0147] In one embodiment, the anti-PD1 antibody or antigen-binding fragment thereof as described above is an agonist anti-PD1 antibody or antigen-binding fragment thereof.

[0148] In one embodiment, the anti-PD1 antibody or antigen-binding fragment thereof as described above binds to human PD-1 with high affinity, e.g., 20 nM or less, e.g., 10 nM or less, e.g., 5 nM or less.

[0149] In one embodiment, the present application provides an anti-PD1 antibody or antigen-binding fragment thereof that competes for binding to PD-1 with an anti-PD-1 antibody or antigen-binding fragment thereof as described above. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof that competes for binding to PD-1 with antibody A, antibody B, antibody C, antibody D, or antibody E.

[0150] In one embodiment, the present application provides a pharmaceutical composition comprising an anti-PD-1 antibody or antigen-binding fragment thereof as described above, and a pharmaceutically acceptable excipient.

[0151] In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof as described above for use as a medicament.

[0152] In one embodiment, the present application provides a method of treating a PD-1 pathway disorder comprising administering to a patient in need thereof a pharmaceutically effective amount of an anti-PD-1 antibody or antigen-binding fragment thereof as described above. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof as described above for use in treating a PD-1 pathway disorder. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment thereof as described above for the manufacture of a medicament for treating a PD-1 pathway disorder.

[0153] In one embodiment, the present application provides a method of modulating the interaction between PD-1 and PD-L1 in a human patient comprising administering to the human patient a composition comprising an anti-PD-1 antibody or antigen-binding fragment as described above in an amount sufficient to activate the PD-1 pathway of the human patient. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment as described above for use in modulating the interaction between PD-1 and PD-L1 in a human patient. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment as described above in the manufacture of a medicament for modulating the interaction between PD-1 and PD-L1 in a human patient.

[0154] In one embodiment, the present application provides a method of attenuating the activity of PD-1 expressing T cells in a human patient comprising administering to the human patient a composition comprising an anti-PD-1 antibody or antigen-binding fragment as described above in an amount sufficient to downregulate the immune response of the human patient. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment as described above for use in attenuating the activity of PD-1 expressing T cells in a human patient. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment as described above in the manufacture of a medicament for attenuating the activity of PD-1 expressing T cells in a human patient.

[0155] In one embodiment, in the above methods, in the anti-PD-1 antibody or antigen-binding fragment thereof for the above uses or in the use of the above anti-PD-1 antibody or antigen-binding fragment thereof, the disease is selected from the group consisting of systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease.

[0156] In one embodiment, in the above methods, in the anti-PD-1 antibody or antigen-binding fragment thereof for the above uses or in the use of the above anti-PD-1 antibody or antigen-binding fragment thereof, the antibody or antigen-binding fragment thereof is administered by a parenteral, intravenous, or subcutaneous route of administration.

[0157] In one embodiment, the present application provides an isolated polynucleotide encoding a heavy chain variable region and / or a light chain variable region as described above.

[0158] In one embodiment, the present application provides an isolated polynucleotide encoding a heavy chain and / or a light chain as described above.

[0159] In one embodiment, the present application provides an expression vector comprising a polynucleotide as described above.

[0160] In one embodiment, the present application provides a host cell comprising an expression vector as described above. In one embodiment, the host cell is a mammalian cell.

[0161] In one embodiment, the present application provides a method of making an antibody comprising the steps of:

[0162] - culturing a host cell comprising: an expression vector comprising an isolated polynucleotide encoding a heavy chain variable region as described above and an expression vector comprising a polynucleotide encoding a light chain variable region as described above, under conditions permitting formation of the antibody, and

[0163] - recovering the antibody.

[0164] In one embodiment, the present application provides a method of making an antibody comprising the steps of:

[0165] - culturing a host cell comprising: an expression vector comprising an isolated polynucleotide encoding a heavy chain as described above and an expression vector comprising a polynucleotide encoding a light chain as described above, under conditions permitting formation of the antibody, and

[0166] - recovering the antibody.

[0167] In one embodiment, the above method further comprises the step of purifying the antibody. In one embodiment, the above method further comprises the step of formulating the antibody into a pharmaceutical composition.

[0168] In one embodiment, the present application provides a multispecific antibody comprising a first anti-PD-1 agonist antigen binding site and a second antigen binding site.

[0169] In one embodiment, the second antigen binding site is an anti-CD48 binding site, an anti-CD-2 binding site, an anti-CD11a binding site or an anti-CD3 binding site.

[0170] In one embodiment, the first anti-PD-1 agonist antigen binding site comprises a heavy chain variable region and a light chain variable region as described above.

[0171] In one embodiment, the multispecific antibody is a bispecific antibody. BRIEF DESCRIPTION OF DRAWINGS

[0172] Figure 1 : Selectivity of anti-PD-1 antibodies for human PD-1 protein assessed by flow cytometry in a cell-based assay. MFI stands for "mean fluorescence intensity".

[0173] Figure 2: Competitive binding analysis of human PD-1-Fc to human PD-L1-Fc. Sensing spectra depicting the binding curves of 25 nM PD-1-Fc to PD-L1-Fc amines coupled to the surface of the GLM chip. Figure 2A Sensing patterns of antibody C, MK-3475, and PD1AB-6-4P (500 nM) with a 25 nM PD-1-Fc premix bound to PD-L1-Fc amine coupled to the surface of the GLM chip. Figure 2B ).

[0174] Figure 3: Enhanced binding of PD-L1 to PD-1 in the presence of anti-PD-1 agonist antibody. PD-1 Biotin:PD-L1 interaction analysis ( Figure 3A CHO PD-1-PD-L1 Delphia-Eu TRF analysis ( Figure 3B and 3D CHO PD-1: Biotin PD-L1 binding analysis ( Figure 3C ).exist Figure 3D In this study, only individual data points for antibody C are depicted. Figure 3D Individual data points for other antibodies are not depicted because they are very close to each other. POC stands for "Percentage of Control".

[0175] Figure 4: In the presence of antibodies derived from the parental 723C2 agonist ( Figure 4A ) or parental agonist antibody 820C3 ( Figure 4B T cell functional activity in the presence of anti-PD-1 agonist antibodies or F(ab')2 fragments. POC indicates "percentage of control".

[0176] Figure 5 Crosslinking induces PD-1 activation via anti-CD48 MAb.

[0177] Figure 6 Analysis of cell proliferation by labeling human pan-T cells with CellTrace-Violet, activation of CD3 MAb, and dilution by CellTrace.

[0178] Figure 7: Bispecific constructs ( Figure 7A The binding of each arm to PD-1 or CD48 was demonstrated by flow cytometry on Jurkat cells overexpressing PD-1. Figure 7B Human memory CD4+ T(PD-1) cells were stimulated with culture-bound anti-CD3e in the presence of culture-bound PD-1 / CD48 BsAb or control antibody. + )cell( Figure 7C MFI stands for "Mean Fluorescence Intensity". DETAILED DESCRIPTION

[0179] The present invention addresses the need for treatment of immune and inflammatory disorders, particularly immune and inflammatory disorders controlled by the PD-1 / PD-L1 and / or PD-L2 system. To address this need, the present invention provides anti-PD-1 antibodies that do not block the interaction between PD-1 and PD-L1. In one aspect, the present invention provides antibodies that enhance the interaction between PD-1 and PD-L1. In one aspect of the invention, the antibodies of the present invention activate the PD-1 signaling pathway. In one aspect, the antibodies of the present invention are anti-PD-1 agonist antibodies. PD-1 agonism restores immune balance by inhibiting the expansion and effector function of autoreactive T cells in human diseases in which PD-1 is expressed but can not be engaged or optimally engaged with its ligands. In one aspect, the antibodies of the present invention are useful for the treatment of immune and inflammatory disorders and transplant rejection. For example, the antibodies of the present invention are useful for the treatment and / or prevention of a disease or disorder that can be alleviated by modulating the interaction between PD-1 and PD-L1, particularly by activating the PD-1 pathway. In one aspect, the antibodies of the present invention are useful for the treatment and / or prevention of systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, or inflammatory bowel disease.

[0180] In one aspect, the present application provides an anti-PD-1 antibody, particularly a monoclonal anti-PD-1 antibody, e.g., a humanized monoclonal anti-PD-1 antibody, having one or more of the properties described below. In one aspect, an anti-PD-1 antibody of the present application binds to purified recombinant human PD-1 with high affinity, e.g., 20 nM or less, e.g., 10 nM or less, e.g., 5 nM or less. In one aspect, an anti-PD-1 antibody of the present application binds to purified recombinant cynomolgus monkey PD-1 with an affinity of 50 nM or less. In one aspect, an anti-PD-1 antibody of the present application selectively binds to PD-1, particularly human PD-1. In one aspect, an antibody of the present application does not bind to mouse, rat, or rabbit PD-1. In one aspect, an anti-PD-1 antibody of the present application does not block the binding of PD-L1 to PD-1. In one aspect, an anti-PD-1 antibody of the present application enhances the binding of PD-L1 to PD-1. In one aspect, an anti-PD-1 antibody of the present application attenuates T cell activity in several functional cellular assays as demonstrated below, e.g., by inhibiting IFNγ production, inhibiting IL-17A production, or inhibiting IL-21 production. In one aspect, an anti-PD-1 antibody of the present application inhibits human cell accumulation and reduces the amount of human inflammatory cytokines in a mouse model. In one aspect, an anti-PD-1 antibody of the present application has favorable pharmacokinetic properties. In one aspect, an anti-PD-1 antibody of the present application has favorable biophysical properties, e.g., yield, mass, stability, or solubility. These properties are demonstrated, e.g., in the examples below.

[0181] The general structure of antibodies or immunoglobulins is well known to those skilled in the art, and these molecules are heterotetrameric glycoproteins of about 150,000 daltons composed of two identical light (L) chains and two identical heavy (H) chains that are connected by disulfide bonds. Each light chain is covalently linked to a heavy chain by one disulfide bond at the hinge region, and the heterodimeric molecules are formed via a covalent disulfide bond between the two identical heavy chains. Although the light and heavy chains are linked together by one disulfide bond, the number of disulfide bonds between the two heavy chains varies depending on the immunoglobulin isotype. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at the amino-terminal end a variable domain (V H = variable heavy chain), followed by three or four constant domains (C H1 , C H2 , C H3 , and C H4 ) and a hinge region between C H1 and C H2 . Each light chain has two domains, a variable domain (V L = variable light chain) at the amino-terminal end and a constant domain (C L ) at the carboxy-terminal end. V LDomain non-covalent association V H Domain, however C L Domain is covalently linked to C H1 It is believed that certain amino acid residues form an interface between the light and heavy chain variable domains (Chothia et al., 1985, J. Mol. Biol. 186:651-663, Vargas-Madrazo E, Paz-Garcia E. J Mol Recognit. 2003; 16(3): 113-120). Variable domains are also referred to herein as variable regions, and constant domains are also referred to as constant regions.

[0182] That is, certain domains within the variable domains differ greatly between different antibodies are "hypervariable." These hypervariable domains contain residues directly involved in binding and specificity of each particular antibody to its specific antigenic determinant. Hypervariability in the light chain variable domain and the heavy chain variable domain is focused in three segments called complementarity determining regions (CDRs) or hypervariable loops (HVLs). CDRs are defined by sequence comparison, Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th Ed., Public Health Service, National Institutes of Health, Bethesda, Md., whereas HVLs are defined structurally according to the three-dimensional structure of the variable domain as described by Chothia and Lesk, 1987, J. Mol. Biol. 196:901-917. In cases where these two methods yield slightly different identifications of CDRs, the structural definition is preferred. As defined by Kabat, in the light chain variable domain, CDR-L1 is located at about residues 24-34, CDR-L2 at about residues 50-56, and CDR-L3 at about residues 89-97; in the heavy chain variable domain, CDR-H1 is located at about residues 31-35, CDR-H2 at about residues 50-65, and CDR-H3 at about residues 95-102. An alternative definition of CDRs is according to Chemical Computing Group (CCG) numbering (Almagro et al., Proteins 2011; 79:3050-3066 and Maier et al., Proteins 2014; 82:1599-1610). Thus, CDR1, CDR2, CDR3 definitions of the heavy and light chains have unique and functional properties specific to the given antibody.

[0183] The three CDRs within each of heavy and light chains are separated by framework regions (FRs) which contain sequences that tend to be more conserved. From the amino-terminus to the carboxy-terminus of the heavy and light chain variable domains, the FRs and CDRs are arranged, in order, as follows: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The primary beta sheet conformation of the FRs brings the CDRs within each chain close together and close to the CDRs from the other chain. The resulting conformation contributes to the antigen binding site (see Kabat et al., 1991, NIH Publication 91-3242, Vol. I, pp. 647-669), but not all CDR residues are essential for direct participation in antigen binding.

[0184] FR residues and Ig constant domains do not participate directly in antigen binding, but contribute to the antigen binding and / or mediate the effector functions of antibodies. It is thought that some FR residues have a significant effect on antigen binding in at least three ways: noncovalent direct binding to an epitope, interaction with one or more CDR residues, and influence on the interface between the heavy and light chains. Constant domains do not directly participate in antigen binding, but mediate various Ig effector functions, such as antibody participation in antibody-dependent cellular cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), and antibody-dependent cellular phagocytosis (ADCP).

[0185] The light chains of vertebrate immunoglobulins are classified, based on amino acid sequences of constant domains, into one of two clearly distinct types, kappa and lambda. By comparison, the heavy chains of mammalian immunoglobulins are assigned to one of five major classes: IgA, IgD, IgE, IgG, and IgM, on the basis of sequence of the constant domains. IgG and IgA are further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2, respectively. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of the classes of native immunoglobulins are well known.

[0186] The terms "antibody," "anti-PD-1 antibody," "humanized anti-PD-1 antibody," and "variant humanized anti-PD-1 antibody" are used herein in the broadest sense and specifically encompass monoclonal antibodies (including full length monoclonal antibodies), multispecific antibodies (e.g., bispecific antibodies), antibodies with minor modifications such as N- or C-terminal truncations, and antibody fragments such as variable domains of antibodies and other moieties that exhibit a desired biological activity, e.g., PD-1 binding.

[0187] The term "monoclonal antibody" (mAb) refers to an antibody of a substantially homogeneous antibody population; that is, the individual antibodies in the population are identical except for possibly minor naturally occurring mutations or alterations that can be known to occur, such as removal of the C-terminal lysine from the antibody heavy chain, or post-translational modifications such as amino acid isomerization or deamidation, methionine oxidation, or asparagine or glutamine deamidation. Monoclonal antibodies are highly specific, being directed against a single antigenic determinant, "epitope." Thus, the modifier "monoclonal" indicates the character of the antibody as being substantially homogeneous for the antigenic determinant that it recognizes, and is not to be construed as requiring production of the antibody by any particular method. It should be understood that monoclonal antibodies can be made by any technique which provides for the production of an antibody having substantially homogeneous antibody population; including, for example, the hybridoma methodology (Kohler et al., 1975, Nature 256:495), or recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567), or isolated using phage antibody libraries using the techniques described in Clackson et al., 1991, Nature 352:624-628 and Marks et al., 1991, J. Mol. Biol. 222:581-597 to produce recombinantly produced monoclonal antibodies.

[0188] A chimeric antibody consists of the heavy and light chain variable regions of an antibody from one species (e.g., a non-human mammal, such as a mouse) and the heavy and light chain constant regions of another species (e.g., human), and can be obtained by linking DNA sequences encoding the variable regions of an antibody from a first species (e.g., mouse) to DNA sequences for the constant regions of an antibody from a second (e.g., human) species, and transforming a host with the expression vector containing the linked sequences so that it produces a chimeric antibody. Alternatively, a chimeric antibody can also be one in which one or more variable regions or domains of a heavy and / or light chain are identical to corresponding sequences in a monoclonal antibody from another immunoglobulin class or isotype, or from a consensus or germline sequence. Chimeric antibodies can include fragments of such antibodies, with the proviso that the antibody fragment exhibits the desired biological activity of its parent antibody, e.g., binding to the same epitope (see, e.g., U.S. Patent No. 4,816,567; and Morrison et al., 1984, Proc. Natl. Acad. Sci. USA 81:6851-6855).

[0189] The terms "antibody fragment," "antigen binding fragment," "anti-PD-1 antibody fragment," "humanized anti-PD-1 antibody fragment," "variant humanized anti-PD-1 antibody fragment" refer to a portion of a full length anti-PD-1 antibody in which the variable region or functional ability, e.g., specific PD-1 epitope binding, is maintained. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fd, Fv, scFv and scFv-Fc fragments, diabodies, linear antibodies, single-chain antibodies, minibodies, bi-specific antibodies formed from antibody fragments, and multi-specific antibodies formed from antibody fragments.

[0190] Antibody fragments can be obtained, for example, by treating a full length antibody with an enzyme, such as papain or pepsin, to generate suitable antibody fragments. Papain digestion yields two identical antigen binding antibody fragments, called "Fab" fragments, each with a single antigen binding site, and a residual "Fc" fragment. Fab fragments also contain the constant domains of the light chain and the variable domain of one heavy chain. Pepsin treatment yields an F(ab')2 fragment that has two antigen binding sites and is still capable of cross-linking antigen. H1 H1 Pepsin treatment yields an F(ab')2 fragment that has two antigen binding sites and is still capable of cross-linking antigen.

[0191] Another embodiment of an antibody fragment according to the present application is a Fab' fragment. Fab' fragments differ from Fab fragments by the presence of additional residues at the C H1 terminus of the C domain, including one or more cysteines from the antibody hinge region. An F(ab')2 antibody fragment is a pair of Fab' fragments linked by disulfide bonds under the hinge region. Other chemical couplings of antibody fragments are also known.

[0192] An "Fv" fragment contains a dimer of one heavy chain variable domain and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody. H L An "Fv" fragment contains a dimer of one heavy chain variable domain and one light chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen binding site on the surface of the dimer. Collectively, the six CDRs confer antigen binding specificity to the antibody.

[0193] An antibody fragment can also include a "single-chain Fv" or "scFv" fragment. A "single-chain Fv" or "scFv" antibody fragment is a single chain Fv variant comprising the V H domain and the V L domain of an antibody, in which the domains are present in a single polypeptide chain. Single-chain Fv's are capable of recognizing and binding antigen. The scFv polypeptide can also optionally contain a polypeptide linker positioned between the V H and V LPolypeptide linkers between domains are to help the scFv form the three- dimensional structure required for antigen binding (see, e.g., Pluckthun, 1994, The Pharmacology of monoclonal Antibodies, Vol. 113, Rosenburg and Moore, eds., Springer- Verlag, New York, pp. 269-315).

[0194] Antibody fragments can also form the binding arm of an antibody-like binding protein. For example, various two-chain fragments of antibodies have been described, including but not limited to Fv, Fab, Fab', F(ab')2 fragments (see, e.g., Inbar et al., 1972, Proc. Natl. Acad. Sci. USA 69:265-267; and Nisonoff et al., 1961, Arch. Biochem. Biophys. 93: 436- 444). H -C H1 -V H -C H1 ) to form a pair of antigen binding regions. These "linear antibodies" can be bispecific or monospecific, as described in, e.g., Zapata et al., 1995, Protein Eng. 8(10): 1057-1062.

[0195] In one aspect, the anti-PD-1 antibodies of the present application are humanized antibodies or antibody fragments. Humanized antibodies or humanized antibody fragments are a specific type of chimeric antibodies that include immunoglobulin amino acid sequence variants or fragments thereof, are capable of binding to a predetermined antigen and comprise one or more FRs having substantially the amino acid sequence of a human immunoglobulin and one or more CDRs having substantially the amino acid sequence of a non-human immunoglobulin. This non-human amino acid sequence, often referred to as "imported" sequence, is typically obtained from the "imported" antibody domain, particularly the variable domain. Generally, a humanized antibody includes at least the CDRs or HVLs of a non-human antibody inserted between the FRs of a human heavy or light chain variable domain. Methods of humanizing antibodies are described in, e.g., Almagro et al., (2008) Frontiers in Bioscience 13, 1619-1633 or WO12092374A2.

[0196] Described herein are specific humanized anti-PD-1 antibodies that contain CDRs derived from mouse lead 723C2 inserted between the FRs of human germline sequences heavy and light chain variable domains. In addition, the cysteine in the heavy chain CDR3 of mouse lead 723C2 is replaced with tyrosine in the humanized anti-PD-1 antibodies derived from mouse lead 723C2 ("DC" to "DY").

[0197] In one aspect, the humanized anti-PD-1 antibody comprises substantially all of at least one, and typically two, variable domains (such as, for example, those contained in Fab, Fab', F(ab')2, Fabc, and Fv fragments) in which all or substantially all of the CDRs are those of a non-human immunoglobulin, and particularly, in this context, the CDRs are of the murine sequence of the mouse lead 723C2, and the FRs are those of a human immunoglobulin consensus or germline sequence. In another aspect, the humanized anti-PD-1 antibody also includes at least a portion of an immunoglobulin Fc region, typically a human immunoglobulin Fc region. Typically, the antibody will contain both a light chain as well as at least the variable domain of a heavy chain. The antibody can also include one or more of the C H1 , hinge, C H2 , C H3 , and / or C H4 regions of a heavy chain, as appropriate.

[0198] The humanized anti-PD-1 antibody according to the present application can be selected from any class of immunoglobulin, including IgM, IgG, IgD, IgA, and IgE, and any isotype, including IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2. For example, the constant domain can be a complement fixing constant domain, where the humanized antibody is required to exhibit cytotoxic activity and the isotype is typically IgGl. Where such cytotoxic activity is not required, the constant domain can have another isotype, for example IgG2. Alternative humanized anti-PD-1 antibodies can comprise sequences from more than one immunoglobulin class or isotype, and selection of a particular constant domain to optimize desired effector functions is within the ability of one of ordinary skill in the art.

[0199] In one aspect, the constant domain of the antibody of the present application is IgG4Pro, which has one substitution mutation (Ser228Pro) that prevents Fab arm exchange. This Ser to Pro mutation is in the IgG4 backbone hinge region and is commonly referred to as Ser228Pro, but its position in the heavy chain can vary by several amino acids, for example depending on the length of the variable region and / or the difference in hinge length between IgGl and IgG4. The Ser to Pro mutation in the hinge region (Cys-Pro-Ser-Cys-Pro) is referred to herein as "Ser228Pro" regardless of its position in the heavy chain. In another aspect, the constant domain of the antibody of the present application is IgGl KO, which has two mutations Leu234Ala and Leu235Ala in the hinge region to reduce effector function (ADCC).

[0200] The FR and CDR or HVL of a humanized anti-PD-1 antibody do not need to correspond precisely to the parental sequence. For example, one or more residues of the introduced CDR, or HVL, or common or germline FR sequence can be altered (e.g., mutagenesis) through substitution, insertion, or deletion, such that the resulting amino acid residues are no longer identical to the original residues at the corresponding positions in the parental sequence, but the antibody still retains its PD-1 binding function. Such alterations are generally not extensive and will be conserved. Typically, at least 75% of the humanized antibody residues will correspond to those residues in the parental common or germline FR and the introduced CDR sequence, more typically at least 90%, and most typically greater than 95%, or greater than 98%, or greater than 99%.

[0201] The interface (“V”) between the heavy chain variable region and the light chain variable region affects L -V H Immunoglobulin residues in the "interface" are residues that affect the proximity or orientation of two chains relative to each other. Some residues that can participate in interchain interactions include VL residues 34, 36, 38, 44, 46, 87, 89, 91, 96, and 98, and V... H Residues 35, 37, 39, 45, 47, 91, 93, 95, 100, and 103 (using the numbering system described in Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD., 1987)). U.S. Patent No. 6,407,213 also discusses residues such as V. L Residues 43, 85 and V H Residues 43 and 60 can also participate in this interaction. Although these residues are specific to human IgG indications, they are applicable across species. Important antibody residues reasonably expected to participate in inter-chain interactions are selected for substitution into the common sequence.

[0202] The terms "consensus sequence" and "consensus antibody" refer to an amino acid sequence that, at each position in the immunoglobulin of any particular class, subclass, or subunit structure (e.g., human immunoglobulin variable domain), contains the amino acid residue that occurs most frequently in all of the immunoglobulins of the species. It is understood that a "consensus" sequence, structure, or antibody encompasses a consensus human sequence as described in certain embodiments, and refers to an amino acid sequence that, at each position in all human immunoglobulins of any particular class, subclass, or subunit structure, contains the amino acid residue that occurs most frequently. Thus, a consensus sequence contains an amino acid sequence that has, at each position, an amino acid that occurs in one or more known immunoglobulins, but which does not exactly replicate the entire amino acid sequence of any single immunoglobulin. Variable region consensus sequences are not obtained from any naturally occurring antibody or immunoglobulin. Kabat et al., 1991, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md., and variants thereof. The FRs of the heavy and light chain consensus sequences, and variants thereof, provide sequences useful in the production of humanized anti-PD-1 antibodies. See, e.g., U.S. Patent Nos. 6,037,454 and 6,054,297.

[0203] Human germline sequences are found naturally in the human population. The combination of those germline genes gives rise to antibody diversity. The germline antibody sequences for the light chain of an antibody are from the conserved human germline kappa or lambda v and j genes. Similarly, the heavy chain sequences are from the germline v, d, and j genes (LeFranc, M-P and LeFranc, G, "The Immunoglobulin Facts Book" Academic Press, 2001).

[0204] An "isolated" antibody is one which has been separated from a component of its natural environment. Contaminant components of its natural environment are those materials that can interfere with diagnostic or therapeutic uses for the antibody, and can be enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In one aspect, the antibody will be purified to at least 95% by weight of antibody, for example, at least 96%, 97%, 98%, or 99% by weight of antibody.

[0205] An isolated antibody includes an antibody produced in situ within a recombinant cell, since at least one component of the antibody's natural environment will not be present. Ordinarily, however, an isolated antibody will be prepared by at least one purification step.

[0206] As used in accordance with the present application, the term "antibody potency" refers to factors / properties that contribute to the recognition of an antigen by an antibody or the in vivo effects of an antibody. Changes in the amino acid sequence of an antibody can affect the properties of the antibody such as folding and can affect physical factors such as the initial rate of binding of the antibody to an antigen (k a ), the dissociation constant of the antibody from the antigen (k d ), the affinity constant of the antibody for the antigen (Kd), the conformation of the antibody, the protein stability, and the half-life of the antibody.

[0207] As used in accordance with the present application, the term "agonist antibody" or "agonistic antibody" refers to an antibody that induces at least one biological activity induced by the PD-1 ligand, PD-L1, upon binding to PD-1. In one aspect, the induction is significant when compared to the induction in the absence of the agonist antibody. In one aspect, an antibody is an agonist antibody when at least one biological activity is induced at least about 20%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% greater than in the absence of the agonist antibody, for example, as measured in one of the embodiments described below. In some embodiments, an "agonist antibody" enhances the interaction between PD-1 and PD-L1. Exemplary assays for detecting PD-1 agonist properties are described herein or are known in the art.

[0208] "Multispecific" refers to a protein, such as an antibody, that specifically binds to two or more different antigens or two or more different epitopes within the same antigen.

[0209] "Bi-specific" refers to a protein, such as an antibody, that specifically binds to two different antigens or two different epitopes within the same antigen.

[0210] In some embodiments, the antibodies or antigen-binding fragments thereof of the present application that specifically bind to PD-1 are bi-specific antibodies. In some embodiments, the antibodies or antigen-binding fragments thereof of the present application are multispecific antibodies. The monospecific antibodies that specifically bind to PD-1 provided herein can be engineered to also encompass bi-specific antibodies that are within the scope of the present application.

[0211] Full-length bispecific antibodies can be produced, for example, using Fab arm exchange (e.g., half molecule exchange, exchanging one heavy chain-light chain pair) between two monospecific bivalent antibodies by introducing substitutions at the heavy chain CH3 interface in each half molecule to favor heterodimer formation in a cell-free environment or using co-expression of two antibody half molecules with different specificities. The Fab arm exchange reaction is a disulfide-bonded result.

[0212] Bispecific antibodies can also be generated using designs such as Triomab / Quadroma (Trion Pharma / Fresenius Biotech), knob-in-hole (Genentech), CrossMAb (Roche) and electrostatically induced CH3 interactions (Chugai, Amgen, Novo Nordisk, Oncomed), LUZ-Y (Genentech), strand-exchange engineered bodies (SEEDbodies) (EMD Serono), Biclonic (Merus) and products (Genmab A / S).

[0213] For example, bispecific PD-1 / CD2, bispecific PD-1 / CD48, bispecific PD-1 / CD11a or PD-1 / CD3 antibodies can be generated using the VH / VL domains of the PD-1 antibodies described herein or any of the VH / VL regions of the published anti-PD-1 agonist antibodies and any of the VH / VL regions of the published anti-CD2, anti-CD48, anti-CD11a or anti-CD3 antibodies, respectively.

[0214] Another embodiment of the application is a bispecific antibody comprising a first domain that binds PD-1 and a second domain that binds CD2, CD48, CD11a or CD3.

[0215] As used herein, in the context of two or more nucleic acid or polypeptide sequences, the term "identical" or percent "identity," means that two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence. To determine percent identity, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions (i.e., overlapping positions) x 100). In some embodiments, the two sequences that are compared are of the same length (e.g., excluding additional sequence that extends beyond the compared sequences, if appropriate), after introduction of gaps, if appropriate. For example, when comparing variable region sequences, leader sequences and / or constant domain sequences are not considered. For sequence comparison between two sequences, a "corresponding" CDR refers to a CDR at the same position in both sequences (e.g., CDR-H1 of each sequence).

[0216] Mathematical algorithms can be used to determine the percent identity or percent similarity between two sequences. A preferred, non-limiting example of a mathematical algorithm that is suitable for comparing two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87:2264-2268, as modified in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated in the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215:403-410. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to a nucleic acid encoding a protein of interest. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to a protein of interest. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the individual programs (e.g., XBLAST and NBLAST) can be used. Another preferred, non-limiting example of a mathematical algorithm that is suitable for comparing sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated in the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Additional algorithms for sequence analysis are known in the art and include ADVANCE and ADAM as described in Torellis and Robotti, 1994, Comput. Appl. Biosci. 10:3-5; and FASTA described in Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444-8. Within FASTA, ktup is a control option that sets the sensitivity and speed of the search. If ktup = 2, similar regions of the two sequences being compared are observed by looking at pairs of aligned residues; if ktup = 1, single aligned amino acids are examined. For protein sequences, ktup can be set to 2 or 1, or for DNA sequences, to 1 to 6. If ktup is not specified, the default value is 2 for proteins and 6 for DNA.Alternatively, protein sequence alignment can be performed using the CLUSTAL W algorithm, as described in Higgins et al., 1996, Methods Enzymol. 266:383-402.

[0217] A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a nucleic acid presequence or secretory leader is operably linked to a polypeptide-encoding nucleic acid if it is expressed as a precursor to the protein that is involved in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers are optionally contiguous. Linking can be accomplished by ligation at suitable restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers can be used.

[0218] As used herein, the expressions "cell", "cell line", and "cell culture" are used interchangeably and all such designations include their progeny. Thus, "transformant" and "transformed cell" include the primary target cell and cultures derived therefrom, without regard to the number of transfers, which can be trans fected with one or more expression vectors encoding one or more amino acid sequences of an antibody or antigen-binding fragment thereof of the application, for example.

[0219] For purposes of treatment according to the present application, the term "mammal" refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, and the like. Preferably, the mammal is a human.

[0220] A "disorder" as used herein is any condition that would benefit from treatment with an anti-PD-1 antibody described herein, particularly a humanized anti-PD-1 antibody described herein. Such disorders include chronic and acute disorders or diseases including those pathological conditions that predispose a mammal to the disorder in question.

[0221] As used herein, the term "PD-1 pathway disorder" or "PD-1 pathway disease" refers to a condition that can be alleviated by modulating the interaction between PD-1 and PD-L1, in particular by activating the PD-1 pathway. "PD-1 pathway disorder" or "PD-1 pathway disease" includes T cell related diseases that express PD-1, "PD-1 pathway disorder" or "PD-1 pathway disease" also includes conditions characterized by activated autoreactive T cells that express PD-1 and are drivers of chronic inflammation and autoimmune diseases, and in which it is desirable to attenuate the activity of T cells expressing PD-1 and / or downregulate the immune response. Examples of PD-1 pathway disorders include diseases or conditions such as systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease.

[0222] The term "specifically binds" or like terms means that an anti-PD-1 antibody or antigen-binding fragment thereof forms a complex with an antigen that is relatively stable under physiological conditions. Methods for determining whether two molecules specifically bind are described herein or are well known in the art, and include, for example, equilibrium dialysis, surface plasmon resonance, and the like. In one embodiment, specific binding is characterized by a K D of about 1 x 10 -7 M (100 nM) or less. In another embodiment, specific binding is characterized by a K D of about 5 x 10 -8 M (50 nM) or less. In another embodiment, specific binding is characterized by a K D of about 1 x 10 -8 M (10 nM) or less. In another embodiment, specific binding is characterized by a K D of about 5 x 10 -9 M (5 nM) or less. However, an isolated antibody that specifically binds human PD-1 can have cross-reactivity with other antigens, such as PD-1 molecules from other species. In addition, an isolated antibody can be substantially free of other cellular material and / or chemicals.

[0223] The term "subcutaneous administration" means introducing a drug, e.g., an anti-PD-1 antibody of the application or antigen-binding fragment thereof, from a drug container into the skin of an animal or human patient, preferably into a pocket between the skin and underlying tissue, by a relatively slow, sustained delivery. Pinching or lifting the skin away from the underlying tissue can create the pocket.

[0224] The term "subcutaneous infusion" refers to the introduction of a drug, e.g., an anti-PD-1 antibody or antigen-binding fragment thereof of the application, from a drug container into the skin of an animal or human patient, preferably into a pocket between the skin and subcutaneous tissue, by relatively slow, continuous delivery over a period of time, including but not limited to 30 minutes or less, or 90 minutes or less. Optionally, the infusion can be performed by subcutaneous implantation of a drug delivery pump implanted under the skin of the animal or human patient, wherein the pump delivers a predetermined amount of drug for a predetermined period of time, such as 30 minutes, 90 minutes, or a period of time spanning the length of a treatment regimen.

[0225] The term "subcutaneous bolus" refers to the administration of a drug under the skin of an animal or human patient, wherein the bolus drug delivery is less than about 15 minutes; in another aspect, less than 5 minutes, and in yet another aspect, less than 60 seconds. In even yet another aspect, the administration is into a pocket between the skin and underlying tissue, wherein the pocket can be created by pinching or pulling the skin away from the underlying tissue. For example, "subcutaneous bolus" refers to the administration of an anti-PD-1 antibody or antigen-binding fragment thereof of the application to a human patient in less than about 15 minutes; in another aspect, less than 5 minutes, and in yet another aspect, less than 60 seconds.

[0226] The term "therapeutically effective amount" is used to refer to an amount of an anti-PD-1 antibody or antigen-binding fragment thereof that relieves or ameliorates one or more of the symptoms of the disorder being treated. As such, it is an amount that has a beneficial patient outcome. Efficacy can be measured in routine fashion depending on the condition being treated.

[0227] As used herein, the terms "treatment" and "therapy" and like terms mean to include therapeutic as well as prophylactic or suppressive measures for a disease or disorder, producing any clinically desirable or beneficial effect, including but not limited to alleviating or abating one or more symptoms, causing regression, slowing down or stopping progression of the disease or disorder. Thus, for example, the term treatment includes administration of an anti-PD-1 antibody or antigen-binding fragment thereof prior to or following the onset of symptoms of a disease or disorder, thereby preventing or removing one or more signs of the disease or disorder. As another example, the term includes administration of an anti-PD-1 antibody or antigen-binding fragment thereof after clinical expression of the disease to combat the symptoms of the disease. Further, administration of an anti-PD-1 antibody or antigen-binding fragment thereof after onset and after clinical symptoms have occurred includes "treatment" or "therapy" as used herein, where administration affects a clinical parameter of the disease or disorder, such as the extent of tissue damage or the amount or extent of metastasis, whether the treatment results in improvement of the disease. Moreover, a result is considered effective treatment of the underlying disorder so long as the composition of the application, alone or in combination with another therapeutic agent, results in alleviation or improvement of at least one symptom of the disorder being treated as compared to that symptom without use of the anti-PD-1 antibody composition or antigen-binding fragment thereof, whether or not all symptoms of the disorder are alleviated.

[0228] The term "instructions for use" refers to the package insert that is typically included in the commercial packaging of a therapeutic product, which contains information about the indications, usage, administration, contraindications, and / or warnings for using the therapeutic product.

[0229] Antibody

[0230] This document describes and discloses anti-PD-1 antibodies, particularly humanized anti-PD-1 antibodies, and compositions and articles comprising the anti-PD-1 antibodies of the present invention. Antigen-binding fragments of the anti-PD-1 antibodies are also described. Anti-PD-1 antibodies and their antigen-binding fragments can be used to treat a variety of diseases or conditions, particularly those characterized by activated autoreactive T cells that express PD-1 and are drivers of chronic inflammation and autoimmune diseases. Each anti-PD-1 antibody and its antigen-binding fragment includes at least a portion of a specific epitope that recognizes PD-1. In one aspect, the anti-PD-1 antibody and its antigen-binding fragment of the present invention are agonist anti-PD-1 antibodies and their antigen-binding fragments.

[0231] The generation and characterization of the anti-PD-1 antibody according to the present invention are described in the examples. In the initial characterization, the anti-PD-1 chimeric leader 723C2 was selected based on its superior antibody efficacy, as described, for example, in the following examples. The variant library was generated by placing the CDR of the chimeric leader into the FR of the common heavy and light chain variable domains of humans, and further engineering the FR by various modifications. In addition, the cysteine ​​in the heavy chain CDR3 of the mouse leader 723C2 was replaced by a tyrosine derived from the mouse leader 723C2 in the humanized anti-PD-1 antibody (“DC” to “DY”). The change from “DC” to “DY” has no effect on the pharmacological properties of the antibody. The process for generating the humanized antibody is described in the examples.

[0232] The amino acid sequences of the variable regions of representative mouse leaders are shown in Tables 1 and 2. The CDR regions of these mouse leaders and the CDR regions of engineered variants of leader 723C2 are shown in Tables 3 and 4.

[0233] Table 1: Leader-VK sequence in anti-PD-1 mice

[0234]

[0235]

[0236] Table 2: Leader-VH sequence of anti-PD-1 mice

[0237]

[0238]

[0239]

[0240] The mouse light chain and heavy chain CDRs of various mouse antibodies are displayed in Tables 3 and 4, respectively. Tables 3 and 4 also display three light chain CDRs and three heavy chain CDRs derived from mouse antibody 723C2 via the humanization process.

[0241] Table 3: Light Chain CDR Sequences

[0242]

[0243]

[0244] Table 4: Heavy Chain CDR Sequences

[0245]

[0246]

[0247] The CDRs listed in Tables 3 and 4 above, defined using Chemical Computing Group (CCG) numbering, are underlined (Almagro et al., Proteins 2011; 79:3050-3066 and Maier et al., Proteins 2014; 82:1599-1610).

[0248] Representative numbers of humanized light and heavy chain variable regions derived from mouse antibody 723C2 are provided and displayed in Tables 5 and 6.

[0249] Table 5: Humanized 723C2-VK Sequences

[0250]

[0251]

[0252] Table 6: Humanized 723C2-VH Sequences

[0253]

[0254]

[0255]

[0256] A selection of combinations of humanized light and heavy chain variable regions derived from mouse antibody 723C2 resulted in antibodies A, B, C, D, and E:

[0257] Antibody A: 723C2-IgG4 Pro-463-60 with IgK-463-60 (heavy chain variable region 723C2 VH-463-60 and light chain variable region 723C2 VK-463-60);

[0258] Antibody B: 723C2-IgG4 Pro-461-41 with IgK-462-07 (heavy chain variable region 723C2 VH-461-41 and light chain variable region 723C2 VK-462-07);

[0259] Antibody C: 723C2-IgG4 Pro-461-47 with IgK-462-07 (heavy chain variable region 723C2 VH-461-47 and light chain variable region 723C2 VK-462-07);

[0260] Antibody D: 723C2-IgG4 Pro-461-44 with IgK-462-08 (heavy chain variable region 723C2 VH-461-44 and light chain variable region 723C2 VK-462-08);

[0261] Antibody E: 723C2-IgG4 Pro-461-40 with IgK-462-08 (heavy chain variable region 723C2 VH-461-40 and light chain variable region 723C2 VK-462-08).

[0262] Antibodies A, B, C, D, and E have the heavy and light chain sequences shown in Table 7.

[0263] Table 7: Heavy and light chain DNA and amino acid sequences of Antibodies A, B, C, D, and E

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276] The light and heavy chain variable regions of antibodies A, B, C, D, and E are underlined in Table 7. The hinge region in the heavy chain constant region is shown in bold with the Ser228Pro mutation boxed.

[0277] The mouse lead 723C2 was also converted into human IgGl WT, IgGl KO, and IgG4Pro formats. IgG4Pro has one mutation in the hinge region, Ser228Pro, which prevents Fab arm exchange. IgGl KO has two mutations in the hinge region, Leu234Ala and Leu235Ala, to reduce effector function (ADCC).

[0278] Chimeric 723C2 in human IgGl WT, IgGl KO, and IgG4Pro formats are shown in Table 8.

[0279] Table 8: Heavy and light chain DNA and amino acid sequences of chimeric 723C2 in human IgGl WT, IgGl KO, and IgG4Pro formats

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

[0287] The amino acid corresponding to the change from DC to DY in H-CDR3 is underlined in the amino acid sequence in Table 8.

[0288] Humanization and amino acid sequence variants

[0289] Other variant anti-PD-1 antibodies and antibody fragments can be engineered based on the CDR sets depicted in Tables 3 and 4. It will be appreciated that in the variant anti-PD-1 antibodies and antibody fragments, the amino acid sequences of the CDRs remain unchanged, but the surrounding regions, e.g., FR regions, can be engineered. Amino acid sequence variants of the anti-PD-1 antibodies can be prepared by introducing appropriate nucleotide changes into the anti-PD-1 antibody DNA, or by peptide synthesis. Such variants include, for example, deletions and / or insertions and / or substitutions of residues within the amino acid sequences of the anti-PD-1 antibodies of the examples herein. Any combination of deletion, insertion, and substitution is made to arrive at the final construct, provided that the final construct possesses the desired characteristics. The amino acid changes also can alter post- translational processes of the humanized or variant anti-PD-1 antibodies, such as changing the number or position of glycosylation sites.

[0290] In some embodiments, the present application includes an anti-PD-1 antibody or antibody fragment thereof having a variable heavy chain and a variable light chain, wherein the variable heavy chain amino acid sequence and the variable light chain amino acid sequence are at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequences disclosed in Tables 1, 2, 5, and 6.

[0291] In some embodiments, the present application includes an anti-PD-1 antibody or antibody fragment thereof having a variable heavy chain and a variable light chain, wherein the variable heavy chain amino acid sequence and the variable light chain amino acid sequence are at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequences of SEQ ID NO: 131, 133, 135, 137, or 139 and SEQ ID NO: 125, 127, or 129, respectively.

[0292] In some embodiments, the present application includes an anti-PD-1 antibody or antibody fragment thereof having a variable heavy chain and a variable light chain, wherein the variable heavy chain amino acid sequence and the variable light chain amino acid sequence are at least 80%, at least 85%, at least 90%, at least 92.5%, at least 95%, at least 98%, or at least 99% identical to the amino acid sequences disclosed in Tables 1, 2, 5, and 6.

[0293] Another type of amino acid variant of an antibody involves the alteration of the original glycosylation pattern of the antibody. In this context, the term "altering" means deleting one or more carbohydrate moieties found on the antibody, and / or adding one or more glycosylation sites that are not present in the antibody. For example, an antibody can comprise an amino acid substitution at position 297 of a human IgGl heavy chain to eliminate oligosaccharyltransferase complex-mediated glycosylation by substituting asparagine 297 (e.g., N297A, N297G).

[0294] In some aspects, the present application includes nucleic acid molecules encoding amino acid sequence variants of the anti-PD-1 antibodies described herein. Nucleic acid molecules encoding amino acid sequence variants of the anti-PD-1 antibodies are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or non-variant version of an anti-PD-1 antibody. For example, nucleic acid molecules in accordance with the present application also encompass nucleic acid molecules that hybridize to a nucleic acid molecule as disclosed herein under stringent conditions, wherein the term "stringent conditions" can include, within the scope of the present application, for example, hybridization at 42°C in a buffer containing 50% formamide, 5x SSC, and 1% SDS, or hybridization at 65°C in a buffer containing 5x SSC and 1% SDS, both with washes at 0.2x SSC and 0.1% SDS at 65°C. Exemplary stringent hybridization conditions can also include hybridization in a buffer of 40% formamide, 1 M NaCl, and 1% SDS at 37°C and washing in 1x SSC at 45°C.

[0295] In certain embodiments, the anti-PD-1 antibody is an antibody fragment. There are techniques that have been developed for producing antibody fragments. Fragments can be derived from proteolytic digestion of whole antibodies (see, e.g., Morimoto et al., 1992, Journal of Biochemical and Biophysical Methods 24: 107-117; and Brennan et al., 1985, Science 229:81). Alternatively, fragments can be produced directly in recombinant host cells. For example, Fab'-SH fragments can be recovered directly from E. coli and chemically coupled to form F(ab')2 fragments (see, e.g., Carter et al., 1992, Bio / Technology 10: 163-167). By another approach, F(ab')2 fragments can be isolated directly from recombinant host cell culture. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner.

[0296] In one aspect, the anti-PD-1 antibodies and antigen-binding fragments thereof can include modifications, such as glycosylation or deamidation.

[0297] In certain embodiments, it can be desirable to use an anti-PD-1 antibody fragment rather than an intact antibody. It can be desirable to modify the antibody fragment to increase its serum half-life. This can be accomplished, for example, by incorporating a salvage receptor binding epitope into the antibody fragment. In one approach, an appropriate region of the antibody fragment can be altered (e.g., mutated), or an epitope can be incorporated into a peptide tag, which is then fused to the antibody fragment, either at either end or in the middle, by, for example, DNA or peptide synthesis. See, e.g., WO96 / 32478. For example, if it is not desirable to use a full-length IgGl scaffold, the antibody fragments of the application can also be fused to human serum albumin to increase serum half-life. Such fusion proteins of antibody fragments and human serum albumin can be advantageous in cases where it is desirable to fuse two different antibody fragments to increase avidity or to create a bispecific binding protein with an extended serum half-life (see, e.g., WO05077042A2).

[0298] In other embodiments, the application includes covalent modifications of the anti-PD-1 antibody. Covalent modifications include modifications of cyste residues, histidine residues, lysine and amino terminal residues, arginine residues, tyrosine residues, carboxyl side groups (aspartate or glutamate), glutamine and asparagine residues, or serine, or threonine residues. Another type of covalent modification involves chemically or enzymatically coupling glycosides to the antibody. Such modifications can be made by chemical synthesis or by enzymatic or chemical cleavage, where applicable. Other types of covalent modifications of the antibody can be introduced into the molecule by reacting targeted amino acid residues of the antibody with an organic derivatizing agent that is capable of reacting with selected side chains or the amino- or carboxy -terminal residues.

[0299] Removal of any carbohydrate moieties present on the antibody can be effected chemically or enzymatically. Chemical deglycosylation is described by Hakimuddin et al., 1987, Arch. Biochem. Biophys. 259:52 and by Edge et al., 1981, Anal. Biochem. 118:131. Enzymatic cleavage of carbohydrate moieties on antibodies can be effected by using various endo- and exoglycosidases as described by Thotakura et al., 1987, Meth. Enzymol 138:350.

[0300] Another type of useful covalent modification comprises linking the antibody to one of a variety of nonproteinaceous polymers, including those now known or yet to be discovered, in the manner set forth in one or more of U.S. Patent No. 4,640,835, U.S. Patent No. 4,496,689, U.S. Patent No. 4,301,144, U.S. Patent No. 4,670,417, U.S. Patent No. 4,791,192, and U.S. Patent No. 4,179,337.

[0301] Epitope binding

[0302] In another aspect, the present application relates to an antibody or antigen-binding fragment thereof recognizing a specific "PD-1 antigen epitope / PD-1 epitope" and "PD-1 epitope".

[0303] As used herein, the term "PD-1 antigen epitope / PD-1 epitope" refers to a molecule (e.g. a peptide) or a fragment of a molecule capable of binding to an anti-PD-1 antibody or antigen-binding fragment thereof. These terms further include, for example, a PD-1 antigenic determinant recognized by any of the antibodies or antibody fragments of the present application.

[0304] A PD-1 epitope can be comprised in a protein, a protein fragment, a peptide or an analogue thereof. The epitope most often is a protein, a short oligopeptide, an oligopeptide mimetic (i.e. an organic compound that mimics the binding properties of a PD-1 antigen) or a combination thereof.

[0305] In one aspect, the anti-PD-1 antibody or antigen-binding fragment thereof of the present application specifically binds to a PD-1 epitope in a manner that mimics the binding of a physiological ligand, resulting in antibody-mediated agonism.

[0306] The present application also provides an anti-PD-1 antibody or antigen-binding fragment thereof that competes for binding to PD-1 with an anti-PD-1 antibody according to the present application. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof that competes for binding to PD-1 with antibody A, antibody B, antibody C, antibody D or antibody E described herein. Competition analysis can be performed, for example, using a biosensor as described in PLoS One. 2014; 9(3): e92451, or PLoS One 2020 Mar 5; 15(3): e0229206, or by the methods disclosed herein.

[0307] Therapeutic uses

[0308] In one embodiment, the anti-PD-1 antibody or antigen-binding fragment thereof of the present application is useful for the treatment or prevention of a PD-1 pathway disorder.

[0309] In another embodiment, the anti-PD-1 antibody or antigen-binding fragment thereof of the present application is useful as a medicament.

[0310] Thus, in one embodiment, the present application provides a method of modulating the interaction between PD-1 and PD-L1 in a human patient, comprising administering to the human patient a composition comprising an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application in an amount sufficient to activate the PD-1 pathway in the human patient. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for use in modulating the interaction between PD-1 and PD-L1 in a human patient. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for the manufacture of a medicament for modulating the interaction between PD-1 and PD-L1 in a human patient.

[0311] In one embodiment, the present application provides a method of attenuating the activity of PD-1 expressing T cells in a human patient, comprising administering to the human patient a composition comprising an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application in an amount sufficient to down-regulate the immune response in the human patient. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for use in attenuating the activity of PD-1 expressing T cells in a human patient. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for the manufacture of a medicament for attenuating the activity of PD-1 expressing T cells in a human patient.

[0312] In one embodiment, the PD-1 pathway disease or disorder is systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease. Thus, in one embodiment, the present application provides a method of treating or preventing systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, or inflammatory bowel disease in a human patient, comprising administering to the human patient a composition comprising an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for use in treating or preventing systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, or inflammatory bowel disease in a human patient. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for the manufacture of a medicament for treating or preventing systemic sclerosis (SSc), systemic lupus erythematosus, polymyositis, giant cell arteritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, or inflammatory bowel disease in a human patient.

[0313] In one embodiment, the PD-1 pathway disease or disorder is chronic or acute, such as a chronic inflammatory disease or an acute inflammatory disease. In one embodiment, the PD-1 pathway disease or disorder is arthritis, rheumatoid arthritis, asthma, COPD, pelvic inflammatory disease, Alzheimer's Disease, inflammatory bowel disease, Crohn's disease, ulcerative colitis, Peyronie's Disease, coeliac disease, celiac disease, peritonitis, psoriasis, psoriatic arthritis, vasculitis, surgical adhesions, stroke, Type I diabetes, Lyme disease, meningoencephalitis, autoimmune uveitis, multiple sclerosis, lupus (such as systemic lupus erythematosus), Guillain-Barr syndrome, atopic dermatitis, autoimmune hepatitis, fibrosing alveolitis, Grave's disease, IgA nephropathy, idiopathic thrombocytopenic purpura, Meniere's disease, pemphigus, primary biliary cirrhosis, sarcoidosis, scleroderma, Wegener's granulomatosis, other autoimmune disorders, pancreatitis, trauma (surgery), graft versus host disease, transplant rejection, heart disease (including ischemic diseases such as myocardial infarction) and atherosclerosis, intravascular coagulation, bone resorption, osteoporosis, osteoarthritis, periodontitis, and gastric hypochlorhydria, infertility associated with lack of fetal-maternal tolerance, Sjogren's Syndrome, vitiligo, myasthenia gravis, or systemic sclerosis.

[0314] Thus, in one embodiment, the present application provides a method of treating or preventing one of the above diseases or disorders in a human patient, comprising administering to the human patient a composition comprising an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application. In one embodiment, the present application provides an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for use in treating or preventing one of the above diseases or disorders in a human patient. In one embodiment, the present application provides the use of an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application for the manufacture of a medicament for treating or preventing one of the above diseases or disorders in a human patient.

[0315] In one aspect, the PD-1 antibody or antigen-binding fragment thereof used or the use as described above or the method as described above is an agonist anti-PD-1 antibody or antigen-binding fragment thereof.

[0316] Non-therapeutic uses

[0317] The antibodies described herein are suitable for use as affinity purification agents. In this process, the antibody is immobilized on a solid phase, such as a protein A resin, using methods well known in the art. The immobilized antibody is contacted with a sample containing the PD-1 protein (or fragment thereof) to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all of the material in the sample except for the PD-1 protein, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that releases the PD-1 protein from the antibody.

[0318] The anti-PD-1 antibodies of the application, and fragments thereof, as disclosed herein are also suitable for use in diagnostic assays to detect and / or quantify PD-1 protein, e.g., to detect PD-1 expression in particular cells, tissues, or sera.

[0319] In some embodiments, it is advantageous to label the antibodies with a detectable moiety, e.g., for diagnostic purposes. Numerous detectable labels are available, including radioisotopes, fluorescent labels, enzyme substrate labels, quantum dots, and the like. The labels can be indirectly conjugated to the antibodies using various known techniques. For example, the antibodies can be conjugated to biotin, and any of the three general classes of labels mentioned above can be conjugated to the avidin protein, or vice versa. Biotin selectively binds to avidin, and thus the labels can be conjugated to the antibodies in this indirect manner. Alternatively, to achieve indirect conjugation between the labels and the antibodies, the antibodies can be conjugated to a small hapten such as digoxin, and one of the different types of labels mentioned above is conjugated to an anti-hapten antibody (e.g., an anti-digoxin antibody). Thus, indirect conjugation between the labels and the antibodies can be achieved.

[0320] Exemplary radioisotope labels include 35 S, 14 C, 125 I, 3 H, and 131 I. The antibodies can be labeled with a radioisotope using techniques described, e.g., in Current Protocols in Immunology, Vols. 1 and 2, 1991, Coligen et al. eds. Wiley-Interscience, New York, N.Y., Pubs. The radioactivity can be measured, e.g., by scintillation counting.

[0321] Exemplary fluorescent labels include labels derived from available rare earth chelates (europium chelates) or fluorescein and its derivatives, rhodamine and its derivatives, dansyl, Lissamine, phycoerythrin, and Texas Red, or for example any of the following fluorescent labels: dialkylaminocoumarin, rhodamine isothiocyanate, Alexa 350, Alexa 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 660, Alexa Fluor 680, AMCA, aminophthalimidine, BODIPY 630 / 650, BODIPY 650 / 665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR, BODIPY 530 / 550, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650, BODIPY 650 / 665, carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), Cascade Blue, Cascade Yellow, coumarin 343, cyanine dyes (Cy3, Cy5, Cy3.5, Cy5.5) dansyl, Dapoxyl, dialkylaminocoumarin, DM-NERF, Eosin, Erythrosin, Fluorescein, FA, Hydroxycoumarin, IRDyes (IRD 40, IRD 700, IRD 800), JOE, Lissamine rhodamine B, Marina Blue, Methoxycoumarin, Naphthofluorescein, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, PyMPO, 5-carboxy-4',5-dichloro-2',7'-dimethoxyfluorescein, 5-carboxy-2',4',5,7'-tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxyrhodamine, 6-carboxytetramethylamino, Cascade Blue, Cy2, Cy3, Cy5, 6-FAM, dansyl chloride, Fluorescein, HEX, 6-JOE, NBD (7-nitrobenz-2-oxa-l,3-diazole), Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, Phthalic acid, Terephthalic acid, Isophthalic acid, cresyl fast violet, cresyl blue violet, brilliant cresyl blue, p-aminobenzoic acid, erythrosin, phthalocyanine, azomethine, cyanine, xanthine, succinylfluorescein, rare earth cryptate, terbium cryptate, europium cryptate or chelate, diamine, biscyanin, La Jolla blue dye, allophycocyanin B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin B, phycoerythrin R, REG, Rhodamine Green, Rhodamine isothiocyanate, Rhodamine Red, TAMRA, TET, TRIT (tetramethyl rhodamine isothiocyanate), tetramethyl rhodamine, or Texas Red. Fluorescent labels can be conjugated to antibodies via, for example, known techniques such as those disclosed in Current Protocols in Immunology, supra. Fluorescence can be quantified using a fluorometer.

[0322] There are a variety of well-characterized enzyme substrate labels known in the art (for a review, see, e.g., U.S. Patent No. 4,275,149). Enzymes generally catalyze a chemical alteration of the substrate that can be measured using a variety of techniques. For example, the alteration can be a color change that can be measured spectrophotometrically. Alternatively, the alteration can be a change in fluorescence or chemiluminescence of the substrate. Techniques for quantifying fluorescent or chemiluminescent changes are described above. Chemiluminescent substrates are electronically excited by a chemical reaction and can then emit light that can be measured using, for example, a chemiluminescence detector, or to energize a fluorescent acceptor.

[0323] Examples of enzyme labels include luciferases such as Gaussia luciferase and bacterial luciferase (U.S. Patent No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, malate dehydrogenase, urease, peroxidases such as horseradish peroxidase (HRPO), alkaline phosphatase, beta-galactosidase, amylases, lysozymes, saccharide oxidizing enzymes such as glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase, heterocyclic oxidizing enzymes such as uricase and xanthine oxidase, lactoperoxidase, microperoxidase, and the like. Techniques for conjugating enzymes to antibodies are described, for example, in O'Sullivan et al., 1981, Methods for the Preparation of Enzyme-Antibody Conjugates for use in Enzyme Immunoassay, Methods in Enzym. (J. Langone and H. Van Vunakis, eds.), Academic press, N.Y., 73: 147-166.

[0324] Examples of enzyme-substrate combinations include, for example: horseradish peroxidase (HRPO) with hydrogen peroxide as a substrate, wherein the hydrogen peroxide oxidizes a dye precursor such as o-phenylenediamine (OPD) or 3,3',5,5'-tetramethylbenzidine hydrochloride (TMB); alkaline phosphatase (AP) with p-nitrophenyl phosphate as a chromogenic substrate; and beta-D-galactosidase (beta-D-Gal) with a chromogenic substrate such as p-nitrophenyl-beta-D-galactoside or a fluorescent substrate 4-methylumbelliferyl-beta-D-galactoside.

[0325] Many other enzyme-substrate combinations are available to the skilled artisan. For a general review on these combinations, see U.S. Patent No. 4,275,149 and U.S. Patent No. 4,318,980.

[0326] In another embodiment, the anti-PD-1 antibody or antibody fragment of the present application is used unlabeled and detected with a labeled antibody that binds to the anti-PD-1 antibody or fragment thereof. For example, a labeled anti-human Fc or anti-human Fab antibody can be used to detect an unlabeled anti-PD-1 antibody or fragment. The use of an unlabeled anti-PD-1 antibody or fragment thereof according to the present application can be advantageous to achieve a more preferred tissue penetration, as a fluorescent label will increase the molecular weight and / or increase the hydrophobicity of the antibody or antibody fragment to which it is fused, thereby decreasing tissue penetration.

[0327] The antibodies described herein can be used in any known analytical method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. See, e.g., Zola, Monoclonal Antibodies: A Manual of Techniques, pp. 147-158 (CRC Press, Inc. 1987). Diagnostic kits.

[0328] The humanized anti-PD-1 antibodies of the present application can be used in diagnostic kits, i.e., packaged combinations of predetermined amounts of reagents with instructions for performing a diagnostic assay. If the antibodies are labeled with an enzyme, the kit can include substrates and cofactors required by the enzyme, such as substrate precursors that provide detectable chromophores or fluorophores. In addition, other additives can be included, such as stabilizers, buffers (e.g., blocking or lysis buffers), and the like. The relative amounts of the various reagents can vary widely to provide essentially optimal concentrations of the reagents in solution for the sensitivity of the assay. The reagents can be provided in dry powder (usually lyophilized) form, including excipients that, upon dissolution, will provide reagent solutions having the appropriate concentrations.

[0329] Diagnostic kits

[0330] The anti-PD-1 antibodies or fragments thereof of the present application can be used in diagnostic kits, i.e., packaged combinations of predetermined amounts of reagents with instructions for performing a diagnostic assay. If the antibodies are labeled with an enzyme, the kit can include substrates and cofactors required by the enzyme, such as substrate precursors that provide detectable chromophores or fluorophores. In addition, other additives can be included, such as stabilizers, buffers (e.g., blocking or lysis buffers), and the like. The relative amounts of the various reagents can vary widely to provide essentially optimal concentrations of the reagents in solution for the sensitivity of the assay. The reagents can be provided in dry powder (usually lyophilized) form, including excipients that, upon dissolution, will provide reagent solutions having the appropriate concentrations.

[0331] Compositions and administration thereof

[0332] A composition comprising an anti-PD-1 antibody or antigen-binding fragment thereof according to the present application can be administered to an individual having or at risk of a PD-1 pathway disease or disorder described herein. The present application further provides the use of an anti-PD-1 antibody or antigen-binding fragment thereof for the manufacture of a medicament for the prevention or treatment of a PD-1 pathway disease or disorder. The term "individual" as used herein means any mammalian patient to which an anti-PD-1 antibody or antigen-binding fragment thereof can be administered, including, for example, humans and certain non-human mammals, such as primates and dogs. Individuals for whom treatment using the methods described herein is specifically intended include humans. The anti-PD-1 antibodies or antigen-binding fragments thereof of the present application can be administered alone or in combination with other compositions.

[0333] In one aspect, the present application also provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof of the present application.

[0334] Various delivery systems are known and can be used to administer the anti-PD-1 antibody or antigen-binding fragment thereof. Methods of introduction include, but are not limited to, intravitreal, eye drop, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The anti-PD-1 antibody or antigen-binding fragment thereof can be administered, for example, by infusion, bolus, or injection, and can be administered with other biologically active agents. Administration can be systemic or local. Formulations for such injection can be prepared, for example, in pre-filled syringes.

[0335] The anti-PD-1 antibody or antigen-binding fragment thereof can be administered in the form of a pharmaceutical composition comprising a therapeutically effective amount of the anti-PD-1 antibody or antigen-binding fragment thereof and one or more pharmaceutically compatible ingredients.

[0336] In typical embodiments, the pharmaceutical composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous or subcutaneous administration to human beings. Typically, compositions for injection are solutions in sterile isotonic aqueous buffer. Where necessary, the pharmaceutical also can include a solubilizing agent, and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or aqueous solution. Where the pharmaceutical is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the pharmaceutical is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients can be mixed prior to administration.

[0337] In addition, a pharmaceutical composition can be presented in a drug delivery device, e.g., in a pre-filled syringe. Further, a pharmaceutical composition can be provided in the form of a pharmaceutical kit comprising (a) a container housing the anti-PD-1 antibody or antigen-binding fragment thereof in lyophilized form and (b) a second container housing a pharmaceutically acceptable diluent for injection, e.g., sterile water. The lyophilized anti-PD-1 antibody or antigen-binding fragment thereof can be reconstituted or diluted using the pharmaceutically acceptable diluent. Optionally associated with such container(s) can be notices in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notices reflect approval by the agency of manufacture, use or sale of the item for human administration.

[0338] The amount of anti-PD-1 antibodies or their antigen-binding fragments that are effective in treating or preventing PD-1 pathway diseases or conditions can be determined using standard clinical techniques. In vitro analysis may also be used optionally to help identify the optimal dose range. The precise dose to be used in the formulation will depend on the route of administration and the stage of the disease, and should be determined based on the physician's judgment and the individual patient's condition. The effective dose can be extrapolated from dose-response curves derived from in vitro or animal model testing systems.

[0339] For example, the toxicity and therapeutic efficacy of anti-PD-1 antibodies or their antigen-binding fragments can be assessed by measuring ED. 50 The standard drug procedure (the dose that is therapeutically effective in 50% of the population) is determined in cell cultures or laboratory animals. Anti-PD-1 antibodies or their antigen-binding fragments exhibiting a high therapeutic index are preferred.

[0340] Data obtained from cell culture analysis and animal studies can be used to formulate dosage ranges for human use. Doses of anti-PD-1 antibodies or their antigen-binding fragments are typically within the range of EDTAs with minimal or no toxicity. 50 The dosage may vary within this range, depending on the dosage form and route of administration. For any anti-PD-1 antibody or its antigen-binding fragment used in the method, the therapeutically effective dose can initially be estimated by cell culture analysis. Dosage can be adjusted in animal models to achieve the range of circulating plasma concentrations, including IC50 as determined in cell cultures. 50 (That is, the concentration of the test compound that achieves maximal inhibition of half the symptoms). This information can be used to more accurately determine the dosage suitable for humans. The concentration in plasma can be measured, for example, by high-performance liquid chromatography, ELISA, and similar methods.

[0341] In one implementation, the anti-PD-1 antibody is administered at regular time intervals.

[0342] In some embodiments, the antibodies of the present invention can be formulated to doses including, for example, 1 mg / ml to 250 mg / ml, or, for example, 20 mg / ml to 200 mg / ml.

[0343] In some embodiments, a pharmaceutical composition comprising an anti-PD-1 antibody or an antigen-binding fragment thereof may further comprise a therapeutic agent, which may or may not be bound to the binder.

[0344] Such combination therapies can have an additive or synergistic effect on disease parameters such as symptom severity, number of symptoms, or frequency of recurrence.

[0345] With respect to therapeutic regimens for combination administration, in a particular embodiment, the anti-PD-1 antibody or antigen-binding fragment thereof is administered simultaneously with the therapeutic agent. In another particular embodiment, the therapeutic agent is administered prior to or after administration of the anti-PD-1 antibody or antigen-binding fragment thereof.

[0346] Polynucleotides, vectors, host cells, and recombinant methods

[0347] The present disclosure relates to isolated polynucleotides comprising sequences encoding anti-PD-1 antibodies or antigen-binding fragments thereof; vectors; and host cells comprising the polynucleotides; and recombinant techniques for producing antibodies. The isolated polynucleotides can encode any desired form of an anti-PD-1 antibody, including, for example, full-length monoclonal antibodies, Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, and multi-specific antibodies formed from antibody fragments.

[0348] The polynucleotides comprising sequences encoding anti-PD-1 antibodies or fragments or chains thereof can be fused to one or more regulatory or control sequences as known in the art, and can be included in suitable expression vectors or host cells as known in the art. Each of the polynucleotide molecules encoding the heavy or light chain variable domains can independently be fused to a polynucleotide sequence encoding a constant domain, such as a human constant domain, to enable production of a whole antibody. Alternatively, the polynucleotides or portions thereof can be fused together to provide a template for production of single-chain antibodies.

[0349] For recombinant production, the polynucleotide encoding the antibody is inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Numerous vectors are available for expression of recombinant antibodies. Vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, a booster component, a promoter, and a transcription termination sequence.

[0350] Anti-PD-1 antibodies can also be produced as fusion polypeptides, in which the antibody is fused to a heterologous polypeptide, such as a signal sequence, with a specific cleavage site at the amino terminus of the mature protein or polypeptide. The selected heterologous signal sequence is typically one that is recognized and processed (i.e., cleaved by a signal peptidase) by the host cell. For prokaryotic host cells that do not recognize and process the signal sequence of an anti-PD-1 antibody, a prokaryotic signal sequence can be substituted. The signal sequence can be, for example, an alkaline phosphatase, penicillinase, lipoprotein, heat-stable enterotoxin II leaders, and the like. For yeast secretion, a native signal sequence can be substituted, such as the yeast (Saccharomyces and Kluyveromyces) alpha-factor leader, the acid phosphatase, C. albicans amylase, or the signal described in WO 90 / 13646. In mammalian cell systems, a mammalian signal sequence or a viral secretory leader, such as the herpes simplex gD signal, can be used. The DNA for such a precursor region is spliced into the DNA encoding the humanized anti-PD-1 antibody in reading frame.

[0351] Expression vectors and cloning vectors contain nucleic acid sequences that enable the vector to replicate in one or more selected host cells. Generally, in cloning vectors, this sequence is the origin of replication, or autonomously replicating sequence, enabling the vector to replicate independent of the host chromosome. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is commonly used in E. coli, the 2-υ. plasmid origin is commonly used in yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are commonly used in mammalian cells for cloning vectors. Generally, the origin of replication component is not needed for mammalian expression vectors (the SV40 origin can typically be used only because it contains the early promoter).

[0352] Expression vectors and cloning vectors can contain a gene encoding a selectable marker, to facilitate recognition of cells that have been transformed or transfected with these vectors. Typical selectable markers encode proteins that confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate or tetracycline, or complement an auxotrophic deficiency, or, in other alternatives, provide a specific nutrient that is not present in the complex media, e.g., a gene encoding a D-alanine racemase for bacilli.

[0353] One embodiment of the selection scheme utilizes drugs to block the growth of host cells that do not have the desired endogenous or heterologous gene. These cells that have been successfully transformed with the desired gene produce a protein conferring drug resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs neomycin, mycophenolic acid and hygromycin. Common selectable markers for mammalian cells are those that confer resistance to the antibiotics methotrexate (DHFR, dihydrofolate reductase), thymidine kinase, metallothionein-I and -II (such as primate metallothionein genes), adenosine deaminase, ornithine decarboxylase, and the like. Cells transformed with the DHFR selection gene are first identified by culturing in medium that contains methotrexate (Mtx), a competitive antagonist of DHFR. Appropriate host cells when wild-type DHFR is employed are Chinese hamster ovary (CHO) cell lines deficient in DHFR activity (e.g., DG44).

[0354] Alternatively, host cells (particularly wild-type hosts that contain endogenous DHFR) transformed with DNA sequences encoding an anti-PD-1 antibody, wild-type DHFR protein, and another selectable marker such as aminoglycoside 3'-phosphotransferase (APH) can be selected for by cell growth in medium containing a selection agent for the selectable marker such as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or G418. See, e.g., U.S. Patent No. 4,965,199.

[0355] In the case of recombinant production in yeast host cells, the TRP1 gene (Stinchcomb et al., 1979, Nature 282:39) present in the yeast plasmid YRp7 can be used as a selectable marker. The TRP1 gene provides a selection marker for yeast mutant strains deficient in tryptophan biosynthesis (e.g., ATCC No. 44076 or PEP4-1) (Jones, 1977, Genetics 85:12). The presence of the trp1 lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan. Similarly, Leu2p-deficient yeast strains such as ATCC 20,622 and 38,626 are complemented by known plasmids carrying the LEU2 gene.

[0356] In addition, vectors derived from the 1.6 μm plasmid pKDl can be used for transformation of K. marxianus. Alternatively, an expression system for the large-scale production of recombinant bovine chymosin has been reported for K. lactis (Van den Berg, 1990, Bio / Technology 8:135). A stable multicopy expression vector for secretion of mature recombinant human serum albumin by an industrial K. marxianus strain has also been disclosed (Fleer et al., 1991, Bio / Technology 9:968-975).

[0357] Expression and cloning vectors will typically contain a promoter that is recognized and operably linked to the nucleic acid molecule encoding the anti-PD-1 antibody or polypeptide chain thereof by the host organism. Suitable promoters for use with prokaryotic hosts include the phoA promoter, beta-lactamase and lactose promoter systems, alkaline phosphatase, a tryptophan (trp) promoter system, and hybrid promoters such as the tac promoter. Other known bacterial promoters are suitable.

[0358] Many eukaryotic promoter sequences are known. Almost all eukaryotic genes have an AT-rich region, which is located about 25 to 30 bases upstream from the site where transcription starts. Another sequence, denoted the CNCAAT region, is located about 70 to 80 bases upstream from the start site. The CNCAAT region contains a CNCAAT motif, where N can be any nucleotide. At the 3' end of most eukaryotic genes is a region of about 10 bases containing many A residues. This region can be the signal for addition of the poly A tail to the 3' end of the mRNA transcript. All of these sequences are suitably inserted into an eukaryotic expression vector.

[0359] Examples of suitable promoter sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase, and glucokinase.

[0360] Inducible promoters have the additional transcriptional advantage of being controlled by growth conditions. These promoters include the yeast promoter regions for alcohol dehydrogenase 2, isocytchrome C, acid phosphatase, enzymes related to nitrogen metabolism, metallothionein, glycerolaldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Vectors and promoters suitable for yeast expression are further described in EP 73,657 or Baghban et al., Molecular Biotechnology (2019) 61 :365-384. Yeast enhancers are also suitable for use with yeast promoters.

[0361] Transcription of the anti-PD-1 antibody from the vector in mammalian host cells can be controlled, for example, by promoters obtained from viruses such as polyoma, fowlpox, adenovirus (such as adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus, and Simian Virus 40 (SV40); from heterologous mammalian promoters, such as the actin promoter or an immunoglobulin promoter; or from heat shock promoters, with the proviso that such promoters are compatible with the host cell systems.

[0362] The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment containing the early and late promoters and the SV40 replication origin. The immediate early promoter of the human cytomegalovirus is conveniently obtained as an Hindlll E restriction fragment. A system for expressing DNA in mammalian hosts using the bovine papilloma virus as a vector is disclosed in U.S. Patent No. 4,419,446. Modifications of this system are described in U.S. Patent No. 4,601,978. See also Reyes et al., 1982, Nature 297:598-601, which discloses expression of human p-interferon cDNA in mouse cells under the control of a thymidine kinase promoter from herpes simplex virus. Alternatively, the long terminal repeat from the Rous Sarcoma Virus can be used as a promoter.

[0363] Another suitable element that can be used in recombinant expression vectors is an enhancer sequence, which is used to increase the transcription of DNA encoding anti-PD-1 antibodies in higher eukaryotes. Many enhancer sequences from mammalian genes (e.g., hemoglobin, elastase, albumin, alpha-fetoprotein, and insulin) are known. However, enhancers from eukaryotic viruses are commonly used. Examples include the SV40 enhancer located post-OMI (bp 100-270), the early promoter enhancer of cytomegalovirus, the polyomavirus enhancer located post-OMI, and the adenovirus enhancer. A description of components that enhance eukaryotic promoter activation can also be found in Yaniv, 1982, Nature 297:17-18. The enhancer can be spliced ​​into the vector at the 5' or 3' end of the anti-PD-1 antibody coding sequence, but is preferably located at the 5' end of the promoter.

[0364] Expression vectors used in eukaryotic host cells (yeast cells, fungal cells, insect cells, plant cells, animal cells, human cells, or nucleated cells from other multicellular organisms) may also contain sequences required to terminate transcription and stabilize mRNA. Such sequences are typically derived from the 5' and occasionally 3' untranslated regions of eukaryotic or viral DNA or cDNA. These regions contain nucleotide segments transcribed as polyadenylated fragments within the untranslated portion of the mRNA encoding anti-PD-1 antibodies. A useful transcription termination component is the bovine growth hormone polyadenylated region. See WO94 / 11026 and the expression vectors disclosed therein. In some embodiments, the CHEF system can be used to express anti-ANGPT2 antibodies. (See, for example, U.S. Patent No. 5,888,809, the disclosure of which is incorporated herein by reference).

[0365] Host cells for cloning or expression of DNA in a vector as used herein are prokaryotic, yeast, or higher eukaryotic cells described supra. Prokaryotes, including gram-negative and gram-positive organisms, such as Enterobacteriaceae, e.g., Escherichia species such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella e.g., S. typhimurium, Serratia e.g., S. marcescans, and Shigella, as well as Bacilli, such as B. subtilis and B. licheniformis, e.g., B. licheniformis 41 P disclosed in DD 266,710 published April 12, 1989, Pseudomonas, e.g., P. aeruginosa, and Streptomyces are suitable effectors. One preferred E. coli cloning host is E. coli 294 (ATCC 31,446), although other strains, such as E. coli B, E. coli X1776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325) are suitable. These examples are illustrative rather than limiting.

[0366] In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeasts are suitable cloning or expression hosts for vectors encoding anti-PD-1 antibodies. The most commonly used lower eukaryotic expression host is Saccharomyces cerevisiae or common baker's yeast. However, a variety of other genera, species and strains are commonly available and suitable, such as Schizosaccharomyces pombe; Kluyveromyce hosts, e.g., K. lactis, K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans, and K. marxianus; Yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces, such as S. occidentalis; and filamentous fungi, e.g., Neurospora, Penicillium, Tolypocladium, and Aspergillus hosts, such as A. nidulans and A. niger.

[0367] Host cells suitable for expression of glycosylated anti-PD-1 antibodies are derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells, including, for example, many baculovirus strains and variants, and corresponding permissive insect host cells, such as Spodoptera frugiperda (caterpillar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruit fly), and Bombyx mori (silk worm). Various strains of viruses can be used for transfection, for example, the L-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses can be particularly useful for transfection of Spodoptera frugiperda cells.

[0368] Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco, among others, can also be utilized as hosts.

[0369] Anti-PD-1 antibodies or antigen-binding fragments thereof of the present application can also be incorporated into viral vectors, i.e., polynucleotides encoding the anti-PD-1 antibodies or antigen-binding fragments thereof are introduced into a viral vector and then expressed in vivo following infection with the virus.

[0370] In another aspect, expression of the anti-PD-1 antibody or antigen-binding fragment thereof is performed in a vertebrate cell. Propagation of vertebrate cells in culture (tissue culture) has become a routine procedure and techniques are widely available. Examples of suitable mammalian host cell lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., 1977, J. Gen Virol. 36:59); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells / -DHFR (CHO, Urlaub et al., 1980, Proc. Natl. Acad. Sci. USA 77:4216; e.g., DG44); mouse Sertoli cells (TM4, Mather, 1980, Biol. Reprod. 23:243-251); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3R, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., 1982, Annals N.Y. Acad. Sci. 383:44-68); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2).

[0371] The host cells are transformed with the above-described expression or cloning vectors for production of the antibody or antigen-binding fragment thereof and cultured in an appropriate nutrient medium, supplemented with nutrients as necessary to induce the promoter, to select transformants, or to amplify the genes encoding the desired sequences.

[0372] Host cells used to produce the antibodies or antigen-binding fragments thereof described herein can be cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma-Aldrich Co., St. Louis, Mo.), Minimal Essential Medium ((MEM), (Sigma-Aldrich Co.), RPMI-1640 (Sigma-Aldrich Co.), and Dulbecco's Modified Eagle's Medium ((DMEM), Sigma-Aldrich Co.) are appropriate for culturing the host cells. In addition, any of the media described in one or more of Ham et al., 1979, Meth. Enz. 58:44; Barnes et al., 1980, Anal. Biochem. 102:255; U.S. Pat. No. 4,767,704; U.S. Pat. No. 4,657,866; U.S. Pat. No. 4,927,762; U.S. Pat. No. 4,560,655; U.S. Pat. No. 5,122,469; WO 90 / 103430; and WO 87 / 00195 can be used as culture media for the host cells. Any of these media can be supplemented as necessary with hormones and / or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (e.g., sodium chloride, calcium chloride, magnesium sulfate, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as gentamycin), trace elements (defined as inorganic compounds generally present at final concentrations in the range of micromolar), and glucose or an equivalent energy source. Other supplements can also include anything that can facilitate optimal growth or production of the desired product by the host cells. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cells selected for expression, and will be apparent to the ordinarily skilled artisan.

[0373] When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space, or directly secreted into the medium. If the antibody is produced intracellularly, the first step is to disrupt the cells to release the protein. Particulate debris, either host cells or lysed cells, can be removed, for example, by centrifugation or ultrafiltration. Carter et al., 1992, Bio / Technology 10: 163-167 describe a procedure for isolating antibodies which are secreted to the periplasmic space of E. coli. Briefly, cell paste is thawed in the presence of sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonyl fluoride (PMSF) over about 30 min. Cell debris can be removed by centrifugation. Where the antibody is secreted into the medium, the supernatant from such expression systems is generally first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. A proteinase inhibitor, such as PMSF, can be included in any of the foregoing steps to inhibit proteolysis. Various methods can be used to isolate the antibody from the host cell.

[0374] Antibody compositions prepared from cells can be purified using, for example, hydroxylapatite chromatography, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography typically being the most effective technique. The suitability of a particular matrix for use in affinity chromatography can depend on the species of immunoglobulin Fc domain, if any, in the antibody and the kind of matrix used. Protein A is suitable for antibodies that are based on human γ1, γ2, or γ4 heavy chains (see, e.g., Lindmark et al., 1983 J. Immunol. Meth. 62: 1-13). Protein G is appropriate for all mouse isotypes and for human γ3 (see, e.g., Guss et al., 1986 EMBO J. 5: 1567-1575). The matrix to which the affinity ligand is attached most frequently is agarose, but other matrices can be used. Mechanical resistance to flow properties of the matrix, such as controlled pore glass or poly(styrenedivinyl)benzene, allow for faster flow rates and shorter processing times than can be obtained with agarose. In the case of antibodies that contain a C H3 domain, Bakerbond ABX TM resin (J.T. Baker, Phillipsburg, N.J.) is suitable for purification. Other protein purification techniques can be employed, such as fractionation on an ion-exchange column, ethanol precipitation, reverse phase HPLC, chromatography on silica or on SEPHADEX TM chromatography, anion or cation exchange chromatography, chromatofocusing, SDS-PAGE, and ammonium sulfate precipitation, as well as techniques for the removal of contaminants and the like. The intermediate products of the antibody production process typically are recovered and purified by well-known techniques, such as protein concentration, dialysis, and chromatography.

[0375] Following any preliminary purification step(s), the mixture comprising the antibody of interest and contaminants can be subjected to low pH hydrophobic interaction chromatography at pH values between about 2.5 and 4.5, typically performed at low salt concentrations (e.g., about 0-0.25 M salt) using an elution buffer.

[0376] Also included are nucleic acids that hybridize under low, medium, and high stringency conditions, particularly under high stringency conditions as defined herein, to all or a portion of (e.g., a portion encoding a variable region) a nucleic acid sequence represented by an isolated polynucleotide sequence encoding an anti-PD-1 antibody or antibody fragment. The length of the hybridizing portion of the hybridizing nucleic acid is typically at least 15 (e.g., 20, 25, 30, or 50) nucleotides. The hybridizing portion of the hybridizing nucleic acid is at least 80%, e.g., at least 90%, at least 95%, or at least 98% identical to the sequence of all or a portion of the nucleic acid encoding an anti-PD-1 polypeptide (e.g., a heavy chain or light chain variable region) or its complement. Hybridizing nucleic acids of the type described herein can be used, e.g., as cloning probes, primers, e.g., PCR primers, or diagnostic probes. In one aspect, "high stringency conditions" mean prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 microgram / milliliter sheared and denatured salmon sperm DNA, and 50% formamide followed by two washes in 0.2X SSPE, 0.2% SDS at 65°C for 12-24 hours, using standard Southern blot procedures. The support material is finally washed three times for 15 minutes each at room temperature in 0.2X SSC, 0.2% SDS.

[0377] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain variable region, the heavy chain variable region comprising the amino acid sequence of any one of SEQ ID NOs: 108-123.

[0378] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a light chain variable region, the light chain variable region comprising the amino acid sequence of any one of SEQ ID NOs: 92-107.

[0379] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain variable region, the heavy chain variable region comprising the amino acid sequence of any one of SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, or SEQ ID NO: 139.

[0380] In one embodiment, the present application relates to an isolated polynucleotide comprising the nucleotide sequence of any one of SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, or SEQ ID NO: 138.

[0381] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain, the heavy chain comprising the amino acid sequence of any one of SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 153, or SEQ ID NO: 155.

[0382] In one embodiment, the present application relates to an isolated polynucleotide comprising the nucleotide sequence of any one of SEQ ID NO: 124, SEQ ID NO: 126, or SEQ ID NO: 128.

[0383] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain, the heavy chain comprising the amino acid sequence of any one of SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 153, or SEQ ID NO: 155.

[0384] In one embodiment, the present application relates to an isolated polynucleotide comprising the nucleotide sequence of any one of SEQ ID NO: 142, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 152, or SEQ ID NO: 154.

[0385] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain, the heavy chain comprising the amino acid sequence of any one of SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 153, or SEQ ID NO: 155.

[0386] In one embodiment, the present application relates to an isolated polynucleotide comprising the nucleotide sequence of any one of SEQ ID NO: 140, SEQ ID NO: 144, or SEQ ID NO: 150.

[0387] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain, the heavy chain comprising the amino acid sequence of any one of SEQ ID NO: 159, SEQ ID NO: 161, or SEQ ID NO: 163.

[0388] In one embodiment, the present application relates to an isolated polynucleotide comprising the nucleotide sequence of any one of SEQ ID NO: 158, SEQ ID NO: 160, or SEQ ID NO: 162.

[0389] In one embodiment, the present application relates to an isolated polynucleotide comprising a nucleotide sequence encoding a heavy chain, the heavy chain comprising the amino acid sequence of SEQ ID NO: 155.

[0390] In one embodiment, the present application relates to an isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO: 156.

[0391] Articles of manufacture

[0392] In another aspect, an article of manufacture includes a container that contains a material suitable for use in treating the disorders described above. The article of manufacture comprises a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic. The containers hold a composition which is effective for treating the condition and can have a sterile access port. For example, the container can be an intravenous solution bag or a vial of injectable material with a stopper pierceable by a hypodermic injection needle. The active agent in the composition is an anti-PD-1 antibody or antigen-binding fragment thereof. The label on, or associated with, the container indicates that the composition is used for treating the condition of choice. The article of manufacture can further include a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution, and dextrose solution. It can further include other materials from commercial and user perspectives, including other buffers, diluents, filters, needles, syringes, and medicine containers with

[0393] The present application is further described in the following examples, which are not intended to limit the scope of the application.

[0394] Examples

[0395] Example 1: Antibody production (immunization)

[0396] MHC class A, C, D, E, H, G strain mice were immunized with recombinant monomeric human PD-1 or human PD-1 -human Fc-His protein. The gene symbol for this recombinant protein is PDCD1 and the GeneID is 5133. Serology was subsequently assessed by flow cytometry using CHO-human PD-1 cells expressing the human PD-1 antigen for binding. A final boost immunization was given to selected seropositive mice prior to B cell isolation. All selected mice exhibited positive antibody titers in serum. Under positive serology, spleen cells were collected for recovery of antigen-specific B cells. All procedures were performed according to IACUC (Institutional Animal Care and Use Committee) approved protocols.

[0397] Example 2: Generation of humanized anti-PD-1 antibodies

[0398] Mouse lead antibody 723C2 was converted into chimeric antibodies consisting of the mouse variable domains of 723C2 and human constant IgGl WT, IgGl KO or IgG4Pro domains. The sequences of the mouse antibody 723C2 light chain variable region (Vkappa) and heavy chain variable region (VH) are shown in Tables 1 and 2 above. IgG4Pro has one substitution mutation (Ser228Pro) that prevents Fab-arm exchange. IgGl KO has two mutations Leu234Ala and Leu235Ala in the hinge region to reduce effector function (ADCC). Chimeric antibodies were generated to confirm the function of the antibody and to ensure that the correct sequences were obtained. The sequences of chimeric 723C2 in human IgGl WT, IgGl KO and IgG4Pro formats are shown in Table 8. Chimeric 723C2 in human IgGl WT and IgG4Pro contains a mutation in H-CDR3 from DC to DY. However, chimeric 723C2 in human IgGl KO does not have the mutation. The mutation in this site is highlighted in Table 8. The variable regions of the antibodies were then humanized via a design and screening process. A library was made where the human and mouse residues were varied in such a way that either a human or mouse residue could be present in any given position. This library was made for those amino acids that differ between the human germline antibody and the mouse antibody. Only clones that retained the function of the parental mouse antibody were selected. Representative humanized variable regions of antibody 723C2 are shown in Tables 5 and 6.

[0399] In this way, antibody A, antibody B, antibody C, antibody D and antibody E are humanized antibodies derived from mouse antibody 723C2 (cloned into a human IgG4Pro / kappa backbone). Antibodies A, B, C, D and E are shown in Table 7.

[0400] Example 3: Binding of antibodies to recombinant PD-1 protein

[0401] A) Kinetics and affinity of chimeric anti-PD-1 antibodies in the human IgG4 Pro backbone binding to recombinant human PD-1 are shown below (Table 9). Kinetics and binding affinity were measured using ProteOn XPR36 (Biorad, Hercules, CA) using material produced from transient transfection followed by single column purification.

[0402] Table 9

[0403]

[0404] B) Affinity of humanized anti-PD-1 antibodies derived from mouse antibody 723C2 was measured. Kinetic binding data measured using ProteOn XPR36 (Biorad, Hercules, CA) and a global fit 1 : 1 binding model showed interactions with recombinant human PD-1 in the range of 1 nM to 10 nM (Table 10). Antibody PD1AB-6-4P (an antibody in the IgG4 Pro backbone disclosed in WO2017 / 058859 by Celgene) was also tested.

[0405] Table 10

[0406]

[0407]

[0408] C) Affinity and kinetic data of anti-PD-1 antibodies binding to cynomolgus monkey PD-1 were measured on ProteOn XPR36 and a global fit 1 : 1 binding model (Table 11). Antibody PD1AB-6-4P was also tested.

[0409] Table 11

[0410]

[0411] D) Molecular selectivity for human PD-1

[0412] In a cell-based assay, the selectivity of anti-PD-1 antibodies for human PD-1 protein was assessed by flow cytometry. Parental Jurkat cells that do not express human PD-1 protein or Jurkat cells that express human PD-1 protein were incubated with AlexaFluor 647-labeled anti-PD-1 antibodies at concentrations as shown below. As a control, parental and PD-1 expressing Jurkat cells were incubated with an anti-TNP isotype control antibody. Following incubation, cells were washed to remove unbound antibody, fixed in PFA, and then washed in staining buffer. Antibody binding to Jurkat cells was assessed by flow cytometry. Unstained cells were also assessed by flow cytometry as a negative control. Anti-PD-1 antibodies selectively bound to human PD-1 up to at least 1 micromolar, as indicated by the dose-dependent antibody binding to Jurkat cells expressing human PD-1 protein, and lack of binding of AlexaFluor 647-labeled anti-PD-1 antibodies to parental Jurkat cells without PD-1 expression. Results from a representative experiment using antibody C (Ab C) are shown in Figure 1 .

[0413] Example 4: Competition binding analysis of human PD-1-Fc binding to human PD-L1-Fc

[0414] Human PD-L1-Fc was amine coupled at a concentration of 60 μg / mL on channels 1-3 of a GLM chip on a BioRad ProteOn XPR36 instrument; three test antibodies (antibody C, MK-3475 (pembrolizumab), and PD1AB-6-4P) were amine coupled at 30 μg / mL on channels 4, 5, and 6, respectively. Human PD1-Fc was injected at a concentration of 25 nM in channels 1-6 on the chip surface. The sensorgrams indicate specific binding between PD-L1 and PD-1 receptor Figure 2A ). 500 nM of antibody C, MK-3475, and PD1AB-6-4P were pre-mixed with 25 nM PD1-Fc and injected as analytes in all channels on the chip to assess whether the individual antibodies inhibit the binding of PD-L1 to PD-1. As the sensorgrams indicate, both antibody C and PD1AB-6-4P non-competitively bind to the PD-1 antigen with PD-L1. Based on the non-binding sensorgrams observed in the competition analysis, MK-3475 and PD-L1 are potential binders to each other and to PD-1 Figure 2B

[0415] Example 5. Enhanced binding of PD-L1 to PD-1 in the presence of anti-PD-1 agonist antibodies

[0416] ​The PD-1 / PD-L1 interaction was investigated in the presence of the PD-1 agonist antibody 723C2 in the human IgG4Pro backbone and the absence of the DC-DY mutation in H-CDR3. Multiple analyses confirmed that antibody 723C2 enhances the binding of PD-L1 to PD-1. The binding of PD-1 to PD-L1 in culture dishes was assessed using ELISA-based biochemical analysis (BPSBioscience). White 96-well microplates were coated overnight at 4°C with 50 μl of PBS containing 2 μg / ml PD-L1. The supernatant was removed, and the culture dishes were washed three times with 1× immunobuffered buffer (Catalogue No. 72005) from the manufacturer BPS Bioscience. The dishes were then blocked with blocking buffer for one hour at room temperature (RT). Antibody and relevant controls were added, followed by the addition of 0.5 ng / ml (10 ng) PD-1 biotin at room temperature for two hours. The culture dishes were then blocked with blocking buffer for 10 minutes. Add streptavidin-horseradish peroxidase secondary antibody to the washing culture dish for one hour, followed by washing with PD-1 analysis buffer. Inhibit the culture dish for 10 minutes. Add the chemiluminescent substrate mixture to the culture dish just before reading. Read the chemiluminescence signal on an Envision meter or a microtiter plate capable of reading chemiluminescence.

[0417] As indicated by the increased chemiluminescence signal compared to samples treated with isotype control, enhanced interaction between PD-1 and PD-L1 was observed in the presence of antibody 723C2. Figure 3A Antibody 723C2 in Figure 3A The antibody PD1AB-6-4P was designated as 723C2-4P. This contrasts with MK3475 (a known anti-PD-1 antagonist antibody that blocks PD-L1-PD-1 interaction). In this analysis, antibody PD1AB-6-4P showed limited enhancement of PD-1-PD-L1 interaction. Figure 3A ).

[0418] Cell-based analyses were used to confirm the ELISA-based results, demonstrating that the PD-1 / PD-L1 interaction is enhanced in the presence of antibody 723C2. Here, the PD-1 / PD-L1 interaction was assessed by measuring the binding of soluble PD-1 to CHO cells overexpressing PD-1 using DELFIA (dissociation-enhanced lanthanum-based fluorescence immunoassay) receptor-ligand binding assay (Perkin Elmer).

[0419] Cells were seeded at 10,000 cells and incubated overnight at 37°C + 5% CO2 incubator (humidified). Biotin labeled PD-L1 EC 10 (130 nM) and 10 μΐ of PD-1 antibody were added to each well and incubated for 1 hour at room temperature. The plate was washed twice with 50 μΐ of 1 x TRF wash buffer. 20 μΐ of Eu-streptavidin reagent was added to the assay plate and incubated for one hour at room temperature. Enhancement solution was added and incubated for 30 minutes at room temperature. The plate was read on a fluorescent plate reader (excite: 320 or 340 nm, emit: 615 nm). In this assay and in confirmation of the ELISA assay, the presence of antibody 723C2 enhanced the PD-1 / PD-L1 interaction Figure 3B ) in this cell-based assay. Figure 3B Antibody 723C2 is designated as 723C2-4P in

[0420] A second cell-based assay in which PD-1 is expressed on CHO cells was also utilized to assess PD-1 / PD-L1 interaction. In this assay, PD-L1-multimer binding to PD-1 expressing CHO cells was measured by flow cytometry. 50 μΐ of 2 x 10 6 cells / ml was added to each well (100,000 cells / well). Cells were centrifuged and resuspended in 50 μΐ of the indicated antibody concentration and incubated on ice for 60 minutes. PDL1-biotin and streptavidin-APC were combined in staining buffer (1 μg / ml PDL1-biotin + 0.25 μg / ml streptavidin-APC). 50 μΐ of 2 x PDL1-biotin / streptavidin-APC mixture was added to the cells and incubated on ice for 60 minutes. Cells were washed and resuspended in 180 μΐ staining buffer + 20 μΐ PFA and data was acquired on a BD LSR II. As indicated in Figure 3C , this cell-based assay also showed that the binding of PD-L1 to PD-1 was enhanced in the presence of antibody 723C2. Antibody-6-4P had no effect on PD-L1 binding, while the MK3475 antagonist antibody inhibited the binding of PD-L1 to PD-1 Figure 3C ) in this assay. Antibody 723C2 is designated as 723C2-4P in Figure 3C .

[0421] The CHO PD-1-PD-L1 Delphia-Eu TRF assay as described above was also performed with antibody C, antibody PD1AB-6-4P, antibody 1-4Pro, antibody PD1B1090-4Pro, antibody PD1B1094-4Pro, and antibody ANB-030-4Pro. Antibody 1-4Pro comprises the heavy and light chain variable regions of antibody 1 described in WO2019 / 168745 by Eli Lilly in an IgG4-Pro backbone. Antibody PD1B1090-4Pro and antibody PD1B1094-4Pro comprise the respective heavy and light chain variable regions of PD1B1090 and PD1B1094 described in WO2018 / 226580 by Janssen Biotech in an IgG4-Pro backbone. Antibody ANB-030-4Pro comprises the heavy and light chain variable regions of antibody ANB-030 described under CAS Number CAS 2412764-40-8 (also corresponding to the heavy and light chain variable regions of APE12537 described in WO2020 / 247648 by Anaptysbio) in an IgG4-Pro backbone. Also included is an anti-TNP antibody in an IgG4-Pro backbone.

[0422] Antibody C showed a constant (N=3) enhancement of PD-1\PDL-1 binding in a concentration dependent manner Figure 3D ). All other anti-PD-1 agonists consistently showed no enhancement of PD-1\PDL-1 binding Figure 3D ).

[0423] Example 6: Functional cell assay, inhibition of NFAT activation in THP-1 / Jurkat-PD-1 agonist reporter assay

[0424] A THP-1 / Jurkat PD1 NFAT co-culture assay was developed to assess agonist activity of anti-PD1 antibodies generated from multiple campaigns. The THP-1 cell line was obtained from ATCC. The Jurkat reporter cell line was generated in-house. The Jurkat reporter cells overexpress human PD-1 (hPD-1) on the cell surface and also express a NFAT-driven luciferase reporter to measure the activation state of the cells in response to stimulation. Jurkat PD1 NFAT cells were activated with CD3xCD33 BiTE in the presence of THP-1 cells. The anti-CD33 arm of the BiTE binds to CD33 expressed on THP-1 cells, while the anti-CD3 arm binds to CD3 molecules on Jurkat cells. The BiTE serves to engage THP-1 and Jurkat cells, forming an immunological synapse between the two cells while activating the Jurkat cells. Activation of Jurkat PD-1 NFAT cells was measured via the NFAT-driven luciferase reporter. Molecules that exhibit a 20% or greater reduction in activation, as indicated by loss of luciferase signal, were classified as agonist antibodies (Table 12). Anti-PD-1 antibodies 306E6 to 820C3 in Table 12 are on a mouse IgGl backbone. Several of these antibodies were selected for additional profiling on a human IgG4 Pro backbone (denoted as chimeric antibodies in Table 12).

[0425] Table 12

[0426]

[0427]

[0428] Example 7: Functional cell assay - inhibition of IFNy production by human PD-1 knock-in splenocytes

[0429] The primary cell assay used to select top anti-PD1 antibodies was a hPD1 knock-in mouse splenocyte assay. Spleens were collected from C57BL / 6 mice that express human PD1 instead of mouse PD1. Splenocytes were isolated from the spleen and activated with anti-CD3 (clone 2C11) at a concentration of 0.1 pg / ml. T cell activation was measured 48 hours later by quantifying mIFNy content by MSD analysis (Meso Scale Discovery). The assay was run in the presence of anti-PD1 antibodies selected from the THP-1 / Jurkat PD1 NFAT screening assay. The top molecules identified from this assay were selected based on % inhibition of mIFNy (50% or greater) and sequence branching. Inhibition and IC50 values are shown in Table 13.

[0430] Table 13

[0431]

[0432] Example 8: Functional cell assay, inhibition of IFNy production in human PBMC assay

[0433] The ability of anti-PD-1 agonist antibodies to modulate T cell functional activity was further characterized as measured by IFNy production in a human primary cell assay. PBMC were isolated from human whole blood and activated with 1.5 pM of anti-CD3 (clone OKT3, BioLegend). T cell activation and function was assessed 72 hours later by quantifying hIFNy content by MSD assay. The identified anti-PD-1 agonist antibodies were able to reduce IFNy secretion compared to isotype control treated cells (Table 14A).

[0434] Table 14A

[0435]

[0436] Antibody C, Antibody 1-4Pro, Antibody PD1B1090-4Pro, Antibody PD1B1094-4Pro, Antibody ANB-030-4Pro and abatacept were also tested in this assay. Results are shown in Table 14B. Antibody C, Antibody 1-4Pro, Antibody PD1B1090-4Pro, Antibody PD1B1094-4Pro and Antibody ANB-030-4Pro in the variable region of the IgG1 wild-type backbone and the IgG1 KO backbone, as well as abatacept were also tested in this assay. Results are shown in Table 14C summarized below. In each experiment, five donors were tested.

[0437] Table 14B

[0438]

[0439] Table 14C

[0440]

[0441] The IFNy inhibition of Antibody 1-4Pro, Antibody PD1B1090-4Pro, Antibody PD1B1094-4Pro and Antibody ANB-030-4Pro in the variable region of the IgG1 KO backbone was less than 40% with IC 50 values higher than 30 nM.

[0442] Example 9: Functional cell assay, inhibition of IL-17A production in Th17-monocyte co-culture assay

[0443] Test the functional inhibition of IL-17 secretion by Th17 differentiated T cells by anti-PD-1 agonist antibodies. Develop a primary cell co-culture assay to assess IL-17 modulation by PD-1. Human primary T cells isolated from PBMCs are differentiated into Th17 under the following skewing conditions: CD4 T cells are stimulated with 0.5 μg / ml of plate bound anti-CD3 (clone UCHT1) in Th17 skewing media (X-VIVO 15 media + IL-1 β (10 ng / mL), IL-23 (10 ng / mL), IL-6 (10 ng / mL), IL-2 (2 ng / mL), TGFβ (0.5 ng / mL), 5 μg / mL anti-IL4, 5 μg / mL anti-IFNy) for 4 days. After 4 days, cells are removed from the anti-CD3 coated plates and transferred to flasks containing Th17 skewing media. Following differentiation, Th17 cells are rested for at least 3 days prior to co-culture with autologous monocytes and re-stimulation with 40 fM anti-CD3 (clone OKT3) in the presence of PD-1 antibodies. A co-culture system is required due to the Fc requirement necessary for anti-PD-1 antibodies to exhibit agonist activity. Inhibition of IL-17 is observed in the presence of anti-PD-1 agonist antibodies in this assay. Antibody IC 50 and maximum inhibition of IL-17 responses is shown in the table below (Table 15). Maximum inhibition is compared to isotype control antibody.

[0444] Table 15

[0445]

[0446] Example 10: Functional cell assay, inhibition of IL-21 production in Tfh-monocyte co-culture assay

[0447] An assay was developed to assess the ability of anti-PD-1 agonist antibodies to inhibit the in vitro activity of T follicular helper (Tfh) cells. CD4 T cells and autologous monocytes were obtained from ALLCELLS. T cells were biased towards the Tfh lineage by activating the cells for 5 days with Dynabeads Human T-Activator CD3 / CD28 (Gibco) in the presence of IL-23 (25 ng / ml) and TGFβ (5 ng / ml), and then, after washing the cells and removing the activation beads, were combined with autologous monocytes in the presence of 4.5 pM anti-CD3 (clone OKT3, BioLegend) and anti-PD-1 agonist antibodies. After 24 hours, supernatants were collected and analyzed for the presence of IL-21 (Meso Scale Discovery, MSD V-Plex Human IL-21 Kit). IL-21 production by restimulated Tfh differentiated cells was inhibited by anti-PD-1 agonist antibodies. Representative IC50 and Emax inhibition values are shown in Table 16.

[0448] Table 16

[0449]

[0450] Example 11: Effect of FcgR Interactions on PD-1 Agonist Activity

[0451] The effect of Fc-Fcg receptor interactions on the functional activity of agonist antibodies was characterized by using candidate anti-PD-1 agonist antibodies or bivalent antibody fragments (F(ab')2 fragments) of different backbone formats (IgG1 wild-type, IgG1 KO, or IgG4 Pro). The functional activity of antibody variants was assessed by their ability to modulate IFNγ production by activated T cells in the human PBMC assay described above. The functional agonist activity of bivalent F(ab')2 fragments of the parental 723C2 and 820C3 antibodies was lost as measured by a reduction in IFNg production Figure 4A and 4B ). In contrast, full-length antibodies in the human IgG4 Pro backbone inhibited IFNγ production in a dose-dependent manner Figure 4A and 4B , designated as 723C2-4P and 820C3-4P, respectively). In these assays, human PBMC were isolated from whole blood and activated with 1.5 pM of anti-CD3 clone OKT3 in the presence of anti-PD-1 antibodies or F(ab')2 fragments of the indicated anti-PD-1 antibodies. After 72 hours, human IFNγ cytokine content in the supernatants was measured by MSD analysis.

[0452] Since this indicated that Fc interactions were required for functional agonist activity of anti-PD-1 antibodies, 723C2 antibodies were generated on IgGl WT, IgGl KO and IgG4 Pro backbones to further characterize these interactions (723-IgGl WT, 723-IgGl KO and 723-IgG4 Pro, respectively, in Table 17 below). Both IgGl WT and IgG4 Pro bound to human Fc receptors to varying degrees, while the IgGl KO backbone greatly reduced binding to Fc receptors. The anti-PD-1 agonist antibody on IgG4 Pro exhibited the highest degree of inhibition of IFNy in the human PBMC assay, while the antibody on IgGl KO exhibited greatly reduced activity (Table 17). Overall, these data indicate that functional agonism of anti-PD-1 antibodies depends on Fc interactions.

[0453] Table 17

[0454]

[0455] Example 12: In vivo model - xenogenic CD4 + T cell GvHD model

[0456] In vivo xenogenic CD4 + T cell GvHD mouse model was used to test efficacy of PD-1 agonist antibodies. Eight NSG mice (NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ, The Jackson Laboratory) per group were injected IV with 5 x 10 6 CD4 + T cells (purified by negative selection) from a healthy donor leukopak. Mice were dosed IP twice per week at 0.625 mg / kg according to the following; Group 1 : 723 (IgG4-Pro), Group 2: PD1AB-6-4P (IgG4-Pro), Group 3: Anti-TNP isotype (IgG4-Pro), Group 4: Avelumab (hlgGl-LALAPG), Group 5: Anti-TNP isotype (hlgGl-LALAPG), Group 6: CTLA4-Ig (hlgGl-LALA). TNP is trinitrophenol. LALA indicates the Leu234Ala / Leu235Ala mutation commonly used to destroy antibody effector function. PG indicates the Pro329Gly mutation which eliminates effector function by preventing binding to Fcy receptors.

[0457] Three experimental replicates were run, each with a separate donor. At week 4, a significant inhibition of human cell accumulation was noted in Groups 1, 2, and 6 compared to isotype-matched controls for all test donors (Table 18). Quantification of cytokines at week 4 showed a significant decrease in the levels of human IFNy, TNFa, and IL-10 in all donors (Table 19). Human IL-1b, IL-2, IL-4, IL-6, IL-8, IL-12p70, and IL-13 were also tested, but were all below the limit of detection for the assay.

[0458] Table 18: Human CD45+ cell accumulation

[0459]

[0460] Table 19: Human plasma cytokine production

[0461]

[0462] Example 13: Pharmacokinetic study in cynomolgus monkeys

[0463] The pharmacokinetics (PK) of antibody C was evaluated following a single intravenous (IV) bolus dose of 0.1, 0.3, and 1.5 mg / kg or a subcutaneous (SC) dose of 1.5 mg / kg (n=3 / group) in male cynomolgus monkeys sourced in China. Serum concentrations of antibody C were determined using two different MSD immunoassay formats: (1) a "total" drug universal anti-human capture and detection assay and (2) a "free" drug assay with antigen (PD1-ECD) capture and anti-human detection. The PK profiles of the two assays overlapped, indicating that endogenous sPD-1 did not interfere with the measurement of antibody C and had little impact on TMDD. Antibody C exhibited dose-dependent CL (using both free and "total" assays), indicating a contribution of target-mediated drug disposition (TMDD) to overall clearance between 0.1 and 0.3 mg / kg. A summary of the NCA pharmacokinetic parameters for each of the individual doses is shown in Table 20 below.

[0464] Table 20

[0465]

[0466] Example 14: Transfection and production in CHO cells and biophysical data

[0467] Transfection and production in CHO cells:

[0468] CHO-E cells were transfected at approximately 2 x 10E6 cells / mL in Irvine BalanCD Transfectory CHO+ 4 mM L-glutamine (or Glutamax). The amount required for 1 L transfection was 0.15 mg HC DNA plus 0.3 mg LC DNA and 1.05 mg of stuffer DNA (Herring Sperm) and 0.15 mg XBP1 DNA. The DNA was diluted in 100 mL OptiPro SFM and sterile filtered through a 0.2 pm filter. 0.75 mL of Mirus TransIT Pro transfection reagent was added to the diluted DNA mixture and the DNA complex was immediately added to the prepared CHO-E cells and the shake flask was returned to a 37°C, 5% CO2 shaker at 140 rpm. Twenty-four hours post-transfection, the temperature was shifted to 32°C, 2 mL of Gibco Anti- Agglutinator and 100 ml of Irvine Transfectory Supplement were added to the transfected cells. Five days post-transfection, the shaker temperature was shifted to 30°C. Depending on the glucose level drop between 2 g / L to 1 g / L, 200 mL of Irvine Transfectory Supplement was added on day 5 or day 7. The transfected culture was maintained for 10 days. Harvesting was performed by a short centrifugation of the cells followed by sterile filtration through a 0.2 pm PES filter (Thermo Scientific).

[0469] After harvesting, the clarified cell culture supernatant was sampled for potency as follows by a ForteBio / Pall Octet Red 96 instrument with a protein A biosensor.

[0470] Potency of antibody A, antibody C and antibody E was between 18 and 38 mg / L with about 80% recovery from protein purification and greater than 98% monomer recovery after SEC purification. The protein was buffer exchanged into a final buffer containing 10 mM Histidine-HCl, pH 6.0 and was stable at 4°C for at least 4 months and solubility in this buffer was up to 180 mg / ml.

[0471] Table 21

[0472]

[0473] Table 22

[0474]

[0475] AUC: analytical ultracentrifugation as measured by sedimentation velocity method at a concentration of 0.5 to 1 mg / ml; SEC: size exclusion chromatography; %M: monomer percentage.

[0476] Example 15: Bispecific antibodies

[0477] Materials and methods

[0478] Mouse antibodies and reagents. Anti-hPD1 (EH12.2H7) (Biolegend, 329912); anti-hCD48 (Bio-gems, 10511-25-500); IgGl from eBiosciences (cat# 16-4714-85), anti-hCD3 (OKT3) (16-0037-85), anti-hCD3 (UCHT1) (16-0038-85), and anti-CD11a (140011982) from eBiosciences; anti-hCD71 (SouthernBiotech, 9670-14). aCD3 / aCD28 human T cell activator Dynabeads (Gibco, 11131D)

[0479] Imagestream. Jurkat PD-1 cells were incubated with AF-488 cholera toxin (Life Technologies, V-34403) and cross-linking antibody (Jackson ImmunoResearch) and APC aCD3 (Biolegend, 317318), PV786 aPD-1 (Biolegend, 329930), or APC aCD48 (Sigma, SAB4700193) in ice-cold X-VIVO 15 media (Lonza) for 10 minutes. Cells were activated by transfer to pre-warmed X-VIVO 15 and incubated for an additional 12 minutes. Cell activation was stopped by addition of cold PBS-2% PFA (roughly 1:10 ratio, cells:PFA) and cells were incubated in fixative solution on ice for 20 minutes. Cells were washed and resuspended in X-VIVO for analysis of end cap formation and perimeter cutoffs using Imagestream software.

[0480] Flow cytometry. 1 x 10 5Jurkat, Jurkat-PD-1 or aCD3 / aCD28 stimulated primary human T cells were incubated with 1 mg / ml of primary mAb for 1 h at 4°C, or in case of testing bispecific molecules, an 8-point binding curve was generated from a starting concentration of 6.25 mg / ml and serial dilution 1 :4. Cells were washed and stained with PE-anti-mouse Ig (Life Technologies, P852) or PE-goat anti-human F(ab')2 (Invitrogen AHI1707) at 1 : 100 and 1 :800 dilution, respectively, for 1 h at 4°C. Samples were washed, fixed in 1 x Fixation / Lysis Buffer (eBioscience, 00-5333-57) and analyzed on a LSR2 (BD)

[0481] PD-1 complementation assay. 2 x 105Jurkat T cells overexpressing full-length PD-1-PK and intracellular full-length SHP1-EA fusion protein were purchased from DiscoverX (DRX-BI-080515A) and cultured according to manufacturer's instructions. Cells were resuspended in cell seeding media (DiscoverX, 93-0563R4B) and pre-incubated with primary mouse or human antibodies for 30 min at 4°C. Depending on the experiment, cells were additionally pre-incubated with 10 mM of the pan-Src kinase inhibitor PP2 (Abeam, ab120308) or the inactive analogue PP3 (Abeam, ab120617). Cells were washed and treated with or without cross-linking secondary goat anti-mouse IgG (Thermo Scientific, 31170). Cells were transferred to 384-white Opti-plates (PerkinElmer), received a rapid assay reagent (DiscoverX, 93-0247) and read on an EnVision plate reader (PerkinElmer). 4

[0482] Primary huT cell activation. Primary human Pan-T cells (AllCells, PB009-1F) were labeled with 500 nM Cell Trace Violet (Life Technologies, Cat# c34557). Epoxy-dynabeads M450 (Invitrogen, 14011) were covalently coated with 2.5 mg of mouse Ab / 10 7 ​Individual beads. Cells were left unstimulated or stimulated with plate-bound anti-CD3 (UCHT1) (250 and 500 ng / mL) in the presence of Ab-coated epoxy beads. Cells were harvested after 96 h, stained with BV510 anti-CD4 (BD, 562970) and PeCy7 anti-CD8 (BD, 335787) Abs, and cell proliferation was analyzed by LSR2 (BD) with Cell Trace Violet dilution. Primary memory CD4 + / CD45RO + T cells (AllCells, PB009-7F) were stimulated with 1 mg / well of plate-bound anti-CD3 (UCHT1) in the presence of 1 mg / well of plate-bound isotype control (ISO) or BsAb, respectively. Culture supernatants were harvested at 72 h and analyzed for IL-2 and IL-10 secretion (MSD).

[0483] BsAb generation and construct design. Bispecific antibodies (BsAb) were generated from published anti-CD48 (US 2012 / 0076790) and anti-PD1 (WO 2011 / 110621 Al) sequences used as building blocks. Bispecific constructs were designed using the knob-into-hole technology to facilitate heterodimerization of two different target variable regions (IgGl-KO) to generate BsAb containing anti-PD-1 and anti-CD48 (PD-1 / CD48), or anti-PD-1 and anti-TNP as control (PD-1 / ISO) Figure 7A). Variable region sequences obtained for individual targets were cloned into pTT-5 (licensed by National Research Council Canada) expression vectors containing human constant regions. Briefly, variable region amino acid sequences were codon optimized for mammalian expression. Light and heavy chains of the target V-genes were cloned into the same expression vector containing a junction linker segment. Vectors were linearized by restriction enzyme digestion using EcoRI and NheI recognition sites. DNA sequences of the variable regions were sequenced as G-blocks (dsDNA) with overlapping homologous ends to the vector and adjoining junction segment by Integrated DNA Technologies (IDT DNA). G-blocks were then joined via the Gibson Assembly method (NEBuilder HiFi Kit, New England Biolabs, Cat# E5510S) according to the manufacturer’s protocol. Traditional cloning was then completed by transforming the assembly mixture into competent cells (NEB 5-alpha C2987, New England Biolabs) and then grown overnight at 37°C on LB agar plates with 100 pg / ml carbenicillin (Teknova). Individual colonies were picked and grown overnight at 37°C in LB media with carbenicillin. Positive clones of the insert were confirmed by sequence analysis using the Lasergene software package (DNAstar). Sequence confirmed plasmid DNA was scaled up in 0.5 L cultures and then purified via the Plasmid Plus megaprep kit (Qiagen, Cat# 12981) according to the manufacturer’s protocol.

[0484] CHO-E transient transfection. CHO-E cells were transfected at 2e6 cells / mL in FS-CHO supplemented with 2 mM glutamine. For a 1 L mAb transfection volume, 1 mg of light chain (LC) plasmid DNA and 0.5 mg of heavy chain (HC) plasmid DNA were diluted in 100 mL of OptiPro SFM (Gibco) and sterile filtered through a 0.2 pm filter (Millipore). 1.5 mL of TransIT Pro (Mirus Bio LLC) transfection reagent was added and allowed to incubate for 15-30 minutes at room temperature. The complex was then added to the prepared CHO-E cells and the shake flask was returned to the shaker. Twenty-four hours post-transfection, 10 mL of anticoagulant and 150 mL of CHO CD Efficient Feed B (both from Gibco) were added to the transfected cells and the temperature was shifted to 32°C. The infected culture was maintained for 6 to 12 days and cell growth, viability, and nutrient consumption were routinely monitored throughout the culture period. Culture harvest was completed by centrifugation at 4700 rpm at 4°C followed by sterile filtration.

[0485] BsAb purification. Harvested culture supernatant was loaded at 1.0 ml / min onto a 1 ml HiTrap MabSelect SuRe column from GE (cat# 11003493) pre-equilibrated with Buffer A (DPBS, pH 7.2). The column was washed with 10 ml each of Buffer A, Buffer B (DPBS plus 1.0 M NaCl), and again with Buffer A at 1 ml / min. Bound protein was then eluted with 30 mM sodium acetate, pH 3.5. The 5 ml elution fraction was neutralized with 1% volume to volume of 3 M sodium acetate, pH ~9. The final buffer after protein A elution was 60 mM NaOAc, pH ~5. By aSEC, the monomer percentage was 71% for PD1 / ISO and 63% for PD1 / CD48.

[0486] Further polishing of MabSelect Sure purified material to remove aggregates by cation exchange. Ion exchange was performed using a Poros GoPure HS pre-packed column from Thermo Fisher (cat# 4481316). Protein A samples were loaded onto a 1 ml Poros HS column pre-equilibrated with Buffer A (60 mM NaOAc, pH 5.0) and the column was washed with 10 column volumes of Buffer A. Bound protein was then eluted with a 20 column volume gradient of 0% to 40% Buffer B (60 mM NaOA, 1 M NaCl, pH 5.0) at 0.5 ml / min. Elution fractions around the peak were pooled and the salt concentration was adjusted to 100 mM NaCl. Samples were sterile filtered with a filter unit, protein concentration was measured, endotoxin content was determined, and SDS-PAGE and aSEC were run.

[0487] NFAT luciferase assay. An in-house generated Jurkat PD-1 NFAT reporter cell line. Human PD-1 from GeneCopoeia (EX-B0169-M02) was cloned into a vector that was transfected into Jurkat cells (ATCC) via electroporation. The NFAT luciferase reporter (Promega E8481) was then transfected into the PD-1 expressing clone via electroporation. THP-1 cell line was purchased from ATCC (TIB-202) and cultured according to manufacturer’s instructions.

[0488] Jurkat PD-1 and NFAT reporter cells were resuspended in assay media (RPMI, 2% HI-FBS), and 3 x 10 4Cells / condition were pre-incubated with a dose of BsAb (starting concentration of 100 nM and 1 :3 dilutions) for 15 min in 384 flat bottom Opti-plates. THP-1 cells (3 x 10 4 NFAT reporter was analyzed by Luciferase assay reagent format 15 min (Promega, E2520) and read in EnVision plate reader.

[0489] Results

[0490] CD48 and PD-1 cross-linking enhances PD-1 phosphorylation. CD48 is a well-recognized lipid raft and IS resident protein in mouse and human lymphocytes (Elishmereni and Levi-Schaffer, 2011). To more optimally define the presence and abundance of CD48 in lipid rafts relative to that of PD-1 and CD3, we performed ImageStream experiments to quantify the co-localization of these receptors with cholera toxin (CT)-induced lipid raft coalescence (capping) in PD-1 over-expressing Jurkat cells at the single cell level. Analysis of the co-localization of CD48, CD3 and PD-1 within CT-induced lipid raft caps was performed using fluorophore-labeled MAbs. This analysis showed that unlike PD-1, CD3 and CD48 are readily observed within CT-induced caps. Quantification of perimeter values, where smaller perimeter values correlate with capping, revealed that CD48 caps were evident following activation, but were slightly less abundant than CD3. In contrast, PD-1 was generally not co-localized with CT, consistent with the hypothesis that PD-1 requires an active process (e.g., interaction with PDL-1) in order to recruit to lipid raft-enriched IS (Yokosuka et al., 2012).

[0491] ​CD48 exists in lipid rafts and constitutively associates with Src kinases (Lck in T cells), leading us to hypothesize that, similar to CD3, CD48 would induce PD-1 activation / phosphorylation proximal to PD-1, as the positive mechanism of PD-1 activation requires Lck-mediated phosphorylation of PD-1's intracellular ITSM and ITIM domains (Chemnitz et al., 2004; Parry et al., 2005; Sheppard et al., 2004). To test this hypothesis, custom Jurkat cell lines were generated to express a human PD-1 fusion protein with one half b-galactose (PK), and a cytosolic full-length SHP1 fusion protein with one half complementary b-galactose (EA). Since SHP1 is recruited to phosphorylated PD1 that produces a functional b-galactose, PD-1 activation is thus measured as PK / EA recruitment. After confirming the expression of PD-1, CD48, and CD3 in these cells, experiments were set up to assess the potential of MAb anti-CD48 to induce PD-1 activation upon cross-linking Figure 5 ). In the absence of PD-1 MAbs or Fc-specific secondary F(ab')2 antibodies, PD-1 activation was not induced. Cross-linking with secondary antibodies induced PD-1 activation by about 3-fold; however, in the presence of CD48 or CD3 Mabs, PD-1 activation was enhanced by about 9-fold, indicating that the close association of CD48 or CD3 with PD-1 can enhance PD-1 activation. The low level of PD-1 activation induced by self-cross-linking was unexpected, as studies have demonstrated that a small fraction of Lck constitutively associates with PD-1 in T cells (Sheppard et al., 2004).

[0492] CD48-dependent activation of PD-1 requires Src-kinase activity. To determine whether the enhancement of PD-1 activation / phosphorylation by CD48 is dependent on Src-kinase activity, cross-linking experiments were performed in the presence of the pan-Src kinase inhibitor PP2 or the inactive analog PP3. Src-kinase inhibition abolished PD-1 activation upon self-cross-linking or co-cross-linking with CD48, indicating that Lck activity is required for PD-1 activation. To further validate this concept, PD-1 activation was assessed by cross-linking PD-1 with suboptimal amounts of anti-PD-1 in the presence of anti-CD71, a receptor that does not traffic to lipid rafts or associate with Src-kinases (Schatzlmaier et al., 2015). Cross-linking of PD-1 with CD71 did not cause PD-1 activation, supporting the finding that translocation of PD-1 into an environment rich in activated Src kinases enables PD-1 phosphorylation and activation.

[0493] CD48-dependent PD-1 activation inactivates AR-induced primary human T cell proliferation. To functionally assess the ability of CD48-dependent PD-1 activation to regulate T cell function, magnetic beads were covalently coated with CD48, PD-1 MAb, and isotype controls, and tested on anti-CD3 stimulated primary human T cells (CD4+ and CD8+) bound to a culture dish. First, we demonstrated that CD48 and PD-1 inactivate pre-activated human CD48+ T cells. + and CD8 + Expression in T lymphocytes. To assess the effect of bead-coated cells on cell activation, human pan-T cells were labeled with CellTrace-Violet, subsequently activated with CD3 MAb, and cell proliferation was analyzed by CellTrace dilution. Figure 6 ).like Figure 6 As shown, compared to cells treated with beads coated with either CD48 or PD-1MAb alone, beads coated with both CD48 and PD-1MAb significantly reduced T cell proliferation and had a greater effect on CD48. + The inhibitory effect is greater than that of CD8 + Cellular activity was more pronounced. As an additional control, we also tested beads co-coated with PD-1 and CD11a Mab; CD11a was chosen assuming it was not a constitutively lipid raft resident protein. As expected, PD-1 did not exhibit inhibitory function when co-recruited with CD11a. These results further support the hypothesis that PD-1 activation via lipid raft resident molecules (i.e., CD48) can effectively activate PD-1 to inhibit T cell proliferation.

[0494] Bispecific antibodies against PD-1 and CD48 induce PD-1 activation to regulate cytokine secretion and NFAT activation in AR-stimulated human T cells. Results obtained using beads coated with individual monoclonal antibodies suggest that generating bispecific antibodies (BsAbs) to test the molecular localization of PD-1 and CD48 will provide a hypothesis for inhibitory signals on activated human T cells (Figure 7). The published antibodies (an agonist anti-PD-1 antibody from patent application WO 2011 / 110621A1) and the anti-CD48 Ab and BsAb from US2012 / 0076790 were engineered into single-heavy / light chain constructs to produce BsAbs containing anti-PD-1 and anti-CD48 (PD-1 / CD48), or anti-PD-1 and anti-TNP as controls (PD-1 / ISO). Figure 7A The binding of each arm to PD-1 or CD48 was demonstrated by flow cytometry on Jurkat cells overexpressing PD-1 to detect PD-1 and CD48 binding, or by flow cytometry on Jurkat cells lacking PD-1 expression to detect CD48 binding only.Figure 7B ) Using the Jurkat PD-1 complementation assay system described above, we confirmed that the PD-1 / CD48 BsAb was ~3-fold more potent in inducing PD-1 activation than the PD-1 / ISO control, demonstrating that PD-1 / CD48 co-localization using this BsAb format also leads to enhanced PD-1 phosphorylation Figure 6 ) To assess the functional effects of the PD-1 / CD48 BsAb, human memory CD4+ T (PD1 + ) cells were stimulated with plate-bound anti-CD3e in the presence of plate-bound PD-1 / CD48 BsAb or control antibodies, and cytokine secretion was analyzed Figure 7C ) This assay revealed the immunomodulatory effects of the PD-1 / CD48 BsAb, as it significantly reduced the secretion of the pro-inflammatory cytokine IL2, but enhanced the production of the anti-inflammatory cytokine IL-10. Since IL-2 secretion requires NFAT transcriptional activation (Chow et al., 1999), the effect of the PD-1 / CD48 BsAb on NFAT activation was assessed in Jurkat T cells expressing a PD-1 and NFAT-luciferase reporter, and activated with anti-CD3e in the presence of THP-1 cells for co-stimulation. This assay showed that the PD-1 / CD48 BsAb was able to reduce the NFAT reporter by >10-30% compared to control antibodies, and indicated that CD48-dependent activation of PD-1 also inhibits key T cell effector transcriptional events leading to IL-2 production. SEQUENCE LISTING <110> Boehringer Ingelheim International GmbH <120> Anti-PD-1 antibody <130> 09-0701-WO-1 <140> <141> <150> 63 / 039,686 <151> 2020-06-16 <150> 63 / 029,962 <151> 2020-05-26 <160> 167 <170> PatentIn version 3.5 <210> 1 <211> 16 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 1 Arg Ser Ser Lys Ser Leu Leu His Arg Asn Gly Ile Thr Tyr Leu Tyr 1 5 10 15 <210> 2 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 2 Glu Met Ser Asn Leu Ala Ser 1 5 <210> 3 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 3 Gly Gln Asn Leu Glu Phe Pro Leu Thr 1 5 <210> 4 <211> 11 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 4 Lys Ala Ser Gln Asn Val Gly Thr Ala Val Ala 1 5 10 <210> 5 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 5 Ser Val Ser Asn Arg Tyr Thr 1 5 <210> 6 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 6 Gln Gln Tyr Ser Ser Tyr Pro Phe Thr 1 5 <210> 7 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 7 His Ala Ser Gln Gly Ile Asn Asn Asn Ile Gly 1 5 10 <210> 8 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 8 His Lys Ser Asn Leu Glu Asp 1 5 <210> 9 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 9 Val Gln Tyr Ala Gln Phe Pro Tyr Thr 1 5 <210> 10 <211> 16 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 10 Arg Ser Ser Lys Ser Leu Leu His Arg Asn Gly Ile Thr Tyr Leu Tyr 1 5 10 15 <210> 11 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 11 Gln Met Ser Asn Leu Ala Ser 1 5 <210> 12 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 12 Ala Gln Asn Leu Glu Leu Pro Leu Thr 1 5 <210> 13 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 13 Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu 1 5 10 15 Ala <210> 14 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 14 Trp Ala Ser Thr Arg Glu Ser 1 5 <210> 15 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 15 His Gln Tyr Tyr Ser Ser Pro Leu Thr 1 5 <210> 16 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 16 Arg Ala Ser Gln Glu Ile Ser Gly Tyr Leu Ser 1 5 10 <210> 17 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 17 Ala Ala Ser Thr Leu Asp Ser 1 5 <210> 18 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 18 Leu Gln Tyr Ala Ser Tyr Pro Leu Thr 1 5 <210> 19 <211> 10 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 19 Ser Ala Asn Ser Ser Val Ser Phe Met His 1 5 10 <210> 20 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 20 Ser Thr Ser Ser Leu Ala Ser 1 5 <210> 21 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 21 Gln Gln Arg Ser Ser Tyr Pro Leu Thr 1 5 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 22 Lys Ala Ser Gln Asn Val Val Thr Tyr Val Ala 1 5 10 <210> 23 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 23 Ser Ala Ser Tyr Arg Tyr Ser 1 5 <210> 24 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 24 Gln Gln Tyr His Ser Tyr Pro Tyr Thr 1 5 <210> 25 <211> 15 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 25 Arg Ala Ser Glu Ser Val Asp lie Tyr Gly lie Ser Phe Leu His 1 5 10 15 <210> 26 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 26 Arg Ala Ser Asn Leu Asp Ser 1 5 <210> 27 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 27 Gln Gln Ser Asn Lys Asp Pro Leu Thr 1 5 <210> 28 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 28 Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Ile Tyr Leu 1 5 10 15 Ala <210> 29 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 29 Gln Gln Tyr Tyr Asn Ser Pro Leu Thr 1 5 <210> 30 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 30 Ser Ala Ser Ser Ser Ile Ser Ser Asp Tyr Leu His 1 5 10 <210> 31 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 31 Arg Thr Ser Asn Leu Ala Ser 1 5 <210> 32 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 32 Gln Gln Gly Thr Ser Leu Pro Arg Ala 1 5 <210> 33 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 33 Lys Ser Ser Gln Ser Leu Leu His Ser Gly Asn Gln Lys Asn Tyr Met 1 5 10 15 Thr <210> 34 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence describing: synthetic peptide" <400> 34 Gln Asn Asp Tyr Ser Tyr Pro Leu Thr 1 5 <210> 35 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 35 Val Ala Ser Thr Leu Asp Ser 1 5 <210> 36 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 36 Leu Gln Tyr Ala Asn Tyr Pro Tyr Thr 1 5 <210> 37 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 37 Ser Ala Ser Gln Asp Ile Ile Asn Tyr Leu Asn 1 5 10 <210> 38 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 38 Ser Thr Ser Ser Leu His Ser 1 5 <210> 39 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 39 His Gin Tyr Ser Gin Leu Pro Tyr Thr 1 5 <210> 40 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 40 Ser Ala Ser Gin Asp He Phe Asn Tyr Leu Asn 1 5 10 <210> 41 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 41 Tyr Thr Ser Ser Leu His Ser 1 5 <210> 42 <211> 9 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 42 Gln Gln Tyr Ser Asn Leu Pro Tyr Thr 1 5 <210> 43 <211> 10 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 43 Gly Tyr Thr Phe Thr Asp Tyr Tyr Val Asn 1 5 10 <210> 44 <211> 17 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / peptide <400> 44 Asp Ile His Pro Asn Ser Gly Asp Thr Thr Tyr Asn Gln Lys Phe Lys 1 5 10 15 Asp <210> 45 <211> 10 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 45 Arg Arg Tyr Asp Tyr Asp Gly Phe Ala Tyr 1 5 10 <210> 46 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 46 Asp Ile His Pro Asn Asn Gly Gly Ile Thr Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 47 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 47 Gly Phe Thr Phe Ser Asp Tyr Gly Met His 1 5 10 <210> 48 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 48 Tyr Ile Asn Ser Asp Ser Asn Thr Ile Tyr Tyr Ala Asp Thr Val Lys 1 5 10 15 Gly <210> 49 <211> 6 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 49 Leu Val Ala Pro Asp Tyr 1 5 <210> 50 <211> 10 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 50 Gly His Thr Phe Thr Ser Asn Trp Ile His 1 5 10 <210> 51 <211> 17 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 51 Glu Ile Asp Pro Ser Asp Ser Tyr Thr Tyr Tyr Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 52 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 52 Pro Gly Arg Asn Ser Asn Phe Ala Tyr 1 5 <210> 53 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 53 Gly Phe Ser Leu Ser Thr Ser Gly Met Gly Val Thr 1 5 10 <210> 54 <211> 16 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 54 His Ile Phe Trp Asp Gly Asp Lys Arg Tyr Asn Pro Ser Leu Lys Ser 1 5 10 15 <210> 55 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 55 Tyr Tyr Tyr Phe Asp Tyr Gly Tyr Ala Ile Asp Tyr 1 5 10 <210> 56 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic Peptide <400> 56 Gly Tyr Thr Phe Thr Ser Tyr Val lie His 1 5 10 <210> 57 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic Peptide <400> 57 Tyr lie Asp Pro Ser Asn Asp Asp Thr Lys Tyr Asn Glu Lys Phe Lys 1 5 10 15 Gly <210> 58 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic Peptide <400> 58 Glu Ala Tyr Tyr Gly Gly Leu Tyr Gly Met Asp Tyr 1 5 10 <210> 59 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic Peptide <400> 59 Gly Tyr Thr Phe lie Asp Tyr Thr lie His 1 5 10 <210> 60 <211> 18 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 60 Trp lie Phe Pro Gly Ser Thr Asn Asp Thr Lys Tyr Asn Asp Lys Phe 1 5 10 15 Lys Gly <210> 61 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 61 Tyr Arg Thr Asp Phe Asp Tyr 1 5 <210> 62 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 62 Gly Tyr Ser Phe Thr Ser Tyr Trp Met His 1 5 10 <210> 63 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 63 Asp Ile Asp Pro Ser Asn Ser Tyr Ala Tyr His Ser Gin Lys Phe Lys 1 5 10 15 Gly <210> 64 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 64 Ala Asp Gly Thr Ser His Trp Tyr Phe Asp Val 1 5 10 <210> 65 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 65 Gly Tyr Thr Phe Thr Asp Tyr Tyr Leu Asn 1 5 10 <210> 66 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 66 Trp Ile Tyr Pro Gly Ser Ser Asp Thr Lys His Asn Glu Asn Phe Lys 1 5 10 15 Gly <210> 67 <211> 8 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 67 Tyr Ser Asn Phe Phe Phe Asp Tyr 1 5 <210> 68 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 68 Gly Phe Ser Leu Ser Thr Ser Gly Met Gly Val Ser 1 5 10 <210> 69 <211> 16 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 69 His Ile Tyr Trp Asp Asp Asp Lys Arg Tyr Asn Pro Ser Leu Lys Ser 1 5 10 15 <210> 70 <211> 11 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 70 Ser Ser Gln Gly Leu Tyr Ser Ser Tyr Asp Tyr 1 5 10 <210> 71 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 71 Gly Tyr Thr Phe Thr Ser Tyr Val Met His 1 5 10 <210> 72 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 72 Tyr Ile Asp Pro Asp Asn Asp Gly Thr Lys Tyr Asn Glu Lys Phe Lys 1 5 10 15 Gly <210> 73 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 73 Gly Phe Thr Phe Ser Asp Tyr Tyr Met Ser 1 5 10 <210> 74 <211> 17 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 74 Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ser Val Lys 1 5 10 15 Gly <210> 75 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 75 Leu Pro His Tyr Phe Ala Met Asp Cys 1 5 <210> 76 <211> 17 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 76 Tyr Ile Ser Ser Gly Gly Gly Ser Lys Tyr Tyr Pro Asp Leu Val Lys 1 5 10 15 Gly <210> 77 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" peptide <400> 77 Leu Pro His Tyr Phe Ala Met Asp Tyr 1 5 <210> 78 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 78 Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ala Val Lys 1 5 10 15 Gly <210> 79 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 79 Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val Lys 1 5 10 15 Gly <210> 80 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic peptide" <400> 80 Gly Phe Thr Phe Ser Asp Tyr Tyr Met Ala 1 5 10 <210> 81 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 81 Asn Ile Asn Tyr Asp Gly Phe Asn Thr Tyr Tyr Leu Asp Ser Leu Lys 1 5 10 15 Ser <210> 82 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 82 Gly Gly Tyr Trp Ser Leu Tyr Phe Asp Tyr 1 5 10 <210> 83 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 83 Gly Tyr Thr Phe Thr Asp Tyr Tyr Ile Asn 1 5 10 <210> 84 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic Peptide <400> 84 Trp lie Tyr Pro Gly Gly Gly His Thr Lys Tyr Asn Glu Lys Phe Lys 1 5 10 15 Gly <210> 85 <211> 8 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic Peptide <400> 85 Tyr Ser Asn Tyr Tyr Phe Asp Phe 1 5 <210> 86 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic Peptide <400> 86 Gly Tyr Thr Phe Thr Ser Tyr Tyr lie Gin 1 5 10 <210> 87 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic Peptide <400> 87 Trp lie Tyr Pro Gly Asp Gly Thr Thr Asn Tyr Asn Glu Asn Phe Lys 1 5 10 15 Gly <210> 88 <211> 8 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 88 Tyr Gly Leu Val Pro Phe Asp Tyr 1 5 <210> 89 <211> 10 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 89 Gly Asn Thr Phe Asn Ser Asn Tyr Ile Gln 1 5 10 <210> 90 <211> 17 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic peptide” <400> 90 Trp Ile Tyr Pro Gly Asp Gly Ser Thr Asn Tyr Ser Glu Lys Phe Lys 1 5 10 15 Gly <210> 91 <211> 8 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial sequence description: synthetic Peptides <400> 91 Tyr Gly Pro Val Pro Phe Asp Tyr 1 5 <210> 92 <211> 112 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic Polypeptides <400> 92 Glu Ile Val Met Thr Gln Ala Ala Phe Ser Asn Pro Val Thr Leu Gly 1 5 10 15 Thr Ser Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Arg 20 25 30 Asn Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45 Pro Gln Leu Leu Ile Tyr Glu Met Ser Asn Leu Ala Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Ser Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gln Asn 85 90 95 Leu Glu Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 110 <210> 93 <211> 112 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“ARTIFICIAL SEQUENCE DESCRIPTION: Synthetic polypeptide” <400> 93 Glu Ile Val Met Thr Gin Ala Ala Phe Ser Asn Pro Val Thr Leu Gly 1 5 10 15 Thr Ser Ala Ser Ile Ser Cys Arg Ser Ser Lys Ser Leu Leu His Arg 20 25 30 Asn Gly Ile Thr Tyr Leu Tyr Trp Tyr Leu Gin Lys Pro Gly Gin Ser 35 40 45 Pro Gin Leu Leu Ile Tyr Glu Met Ser Asn Leu Ala Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Arg Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Gly Gin Asn 85 90 95 Leu Gin Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Gin Leu Lys 100 105 110 <210> 94 <211> 107 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Synthetic sequence: synthetic polypeptide" <400> 94 Asp Ile Val Met Thr Gln Ser Gln Lys Phe Met Ser Thr Thr Val Gly 1 5 10 15 Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asn Val Gly Thr Ala 20 25 30 Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 35 40 45 Tyr Ser Val Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Met Gln Ser 65 70 75 80 Glu Asp Leu Ala Asp Tyr Phe Cys Gln Gln Tyr Ser Ser Tyr Pro Phe 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 95 <211> 107 <212> PRT <213> Artificial sequence <220> <221> source <223> / note= "Synthetic sequence: synthetic polypeptide" <400> 95 Asp Ile Val Met Thr Gln Ser Gln Lys Phe Met Ser Thr Thr Val Gly 1 5 10 15 Asp Arg Val Ser Ile Thr Cys Lys Ala Ser Gln Asn Val Gly Thr AlaAsp Ile Leu Met Thr Gln Ser Pro Ser Ser Met Ser Val Ser Leu Gly 1 5 10 15 Asp Thr Val Ser Ile Thr Cys His Ala Ser Gln Gly Ile Asn Asn Asn 20 25 30 Ile Gly Trp Leu Gln Gln Lys Pro Gly Lys Ser Phe Lys Gly Leu Ile 35 40 45 Tyr His Lys Ser Asn Leu Glu Asp Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Ala Asp Tyr Ser Leu Thr Ile Ser Ser Leu Glu Ser 65 70 75 80 Glu Asp Phe Ala Asp Tyr Tyr Cys Val Gln Tyr Ala Gln Phe Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 96 <211> 112 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 96 Asp Ile Val Met Thr Gln Ala Ala Phe Tyr Asn Pro Val Thr Leu Gly 1 5 10 15 Thr Ser Ala Ser lie Ser Cys Arg Ser Ser Lys Ser Leu Leu His Arg 20 25 30 Asn Gly lie Thr Tyr Leu Tyr Trp Tyr Leu Gin Lys Pro Gly Gin Ser 35 40 45 Pro Gin Leu Leu lie Tyr Gin Met Ser Asn Leu Ala Ser Gly Val Pro 50 55 60 Asp Arg Phe Ser Ser Ser Gly Ser Gly Ala Asp Phe Thr Leu Arg lie 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Ala Gin Asn 85 90 95 Leu Gin Leu Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Gin Leu Gin 100 105 110 <210> 97 <211> 113 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 97 Asp lie Val Met Ser Gin Ser Pro Ser Ser Leu Ala Val Ser Val Gly 1 5 10 15 Glu Lys Val Thr Met Thr Cys Lys Ser Ser Gin Ser Leu Leu Tyr Ser 20 25 30 Ser Asn Gin Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Ser Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 lie Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys His Gin 85 90 95 Tyr Tyr Ser Ser Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 100 105 110 Lys <210> 98 <211> 107 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 98 Asp lie Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Glu Arg Val Ser Leu Thr Cys Arg Ala Ser Gin Glu lie Ser Gly Tyr 20 25 30 Leu Ser Trp Leu Gin Gin Lys Pro Asp Gly Thr lie Lys Arg Leu lie 35 40 45 Tyr Ala Ala Ser Thr Leu Asp Ser Gly Val Pro Lys Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Ser Asp Tyr Ser Leu Thr Ile Ser Ser Leu Glu Ser 65 70 75 80 Glu Asp Phe Ala Asp Tyr Tyr Cys Leu Gln Tyr Ala Ser Tyr Pro Leu 85 90 95 Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 99 <211> 106 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 99 Gln Ile Val Leu Thr Gln Ser Pro Gly Ile Met Ser Ala Ser Pro Gly 1 5 10 15 Glu Lys Val Thr Ile Thr Cys Ser Ala Asn Ser Ser Val Ser Phe Met 20 25 30 His Trp Phe Gln Gln Lys Pro Gly Thr Ser Pro Lys Ile Trp Ile Tyr 35 40 45 Ser Thr Ser Ser Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Ser Tyr Ser Leu Thr lie Ser Arg Met Glu Ala Glu 65 70 75 80 Asp Ala Ala Thr Tyr Tyr Cys Gin Gin Arg Ser Ser Tyr Pro Leu Thr 85 90 95 Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 <210> 100 <211> 107 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 100 Asp lie Val Met Thr Gin Ser Gin Lys Phe Leu Ser Thr Ser Val Gly 1 5 10 15 Asp Arg Val Arg Val Thr Cys Lys Ala Ser Gin Asn Val Val Thr Tyr 20 25 30 Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro Lys Ser Leu lie 35 40 45 Tyr Ser Ala Ser Tyr Arg Tyr Ser Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Tyr Phe Thr Leu Thr lie Asn Asn Val Gin Phe 65 70 75 80 Glu Asp Leu Ala Glu Tyr Phe Cys Gin Gin Tyr His Ser Tyr Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 101 <211> 111 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 101 Asp Ile Val Leu Thr Gin Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Ile Tyr 20 25 30 Gly Ile Ser Phe Leu His Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro 35 40 45 Lys His Leu Ile Tyr Arg Ala Ser Asn Leu Asp Ser Gly Ile Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asn 65 70 75 80 Pro Val Glu Thr Asp Asp Val Ala Thr Tyr Tyr Cys Gin Gin Ser Asn 85 90 95 Lys Asp Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 100 105 110 <210> 102 <211> 113 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" polypeptide <400> 102 Asp Ile Val Met Ser Gln Ser Pro Ser Ser Leu Thr Val Ser Val Gly 1 5 10 15 Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser 20 25 30 Ser Asn Gln Lys Ile Tyr Leu Ala Trp Phe Gln Gln Lys Pro Gly Gln 35 40 45 Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Tyr Asn Ser Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 100 105 110 Lys <210> 103 <211> 108 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Synthetic sequence description: Synthetic polypeptide” <400> 103 Glu Ile Val Leu Thr Gln Ser Pro Thr Thr Met Ala Ala Ser Pro Gly 1 5 10 15 Glu Lys Ile Thr Ile Thr Cys Ser Ala Ser Ser Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Phe Ser Pro Glu Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Gly Ser Met Glu 65 70 75 80 Ala Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 104 <211> 113 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" polypeptide <400> 104 Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Thr Val Thr Ala Gly 1 5 10 15 Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu His Ser 20 25 30 Gly Asn Gln Lys Asn Tyr Met Thr Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Val Gln Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Asn 85 90 95 Asp Tyr Ser Tyr Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 100 105 110 Lys <210> 105 <211> 107 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" polypeptide <400> 105 Asp Ile Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly 1 5 10 15 Glu Arg Val Ser Leu Thr Cys Arg Ala Ser Gin Gin Ile Ser Gly Tyr 20 25 30 Leu Ser Trp Leu Gin Gin Lys Pro Asp Gly Thr Ile Lys Arg Leu Ile 35 40 45 Tyr Val Ala Ser Thr Leu Asp Ser Gly Val Pro Lys Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Ser Asp Tyr Ser Leu Thr Ile Ser Ser Leu Gin Ser 65 70 75 80 Glu Asp Phe Ala Asp Tyr Tyr Cys Leu Gin Tyr Ala Asn Tyr Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Gin Ile Lys 100 105 <210> 106 <211> 107 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 106 Asp Ile Gin Met Thr Gin Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr lie Ser Cys Ser Ala Ser Gin Asp lie lie Asn Tyr 20 25 30 Leu Asn Trp Tyr Gin Gin Lys Pro Asp Gly Thr Val Lys Leu Leu lie 35 40 45 Tyr Ser Thr Ser Ser Leu His Ser Gly Val Ser Leu Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr lie Ser Asn Leu Glu Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys His Gin Tyr Ser Gin Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys 100 105 <210> 107 <211> 107 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 107 Asp lie Gin Met Thr Gin Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr lie Ser Cys Ser Ala Ser Gin Asp lie Phe Asn Tyr 20 25 30 Leu Asn Trp Tyr Gin Gin Lys Pro Asp Gly Thr Val Lys Leu Leu Ile 35 40 45 Tyr Tyr Thr Ser Ser Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile Ser Asn Leu Glu Pro 65 70 75 80 Glu Asp Ile Ala Thr Tyr Tyr Cys Gin Gin Tyr Ser Asn Leu Pro Tyr 85 90 95 Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 108 <211> 119 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 108 Glu Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Val Asn Trp Val Lys Gin Ser His Gly Lys Ser Leu Glu Trp Phe 35 40 45 Gly Asp Ile His Pro Asn Ser Gly Asp Thr Thr Tyr Asn Gin Lys Phe 50 55 60 Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Arg Tyr Asp Tyr Asp Gly Phe Ala Tyr Trp Gly Gin Gly 100 105 110 Thr Leu Val Thr Val Ser Ala 115 <210> 109 <211> 119 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 109 Glu Val Gin Leu Gin Gin Ser Gly Pro Gin Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Val Asn Trp Val Lys Gin Ser His Gly Lys Ser Leu Glu Trp Phe 35 40 45 Gly Asp He His Pro Asn Asn Gly Gly He Thr Tyr Asn Gin Lys Phe 50 55 60 Lys Gly Lys Ala Ser Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Arg Arg Tyr Asp Tyr Asp Gly Phe Ala Tyr Trp Gly Gin Gly 100 105 110 Thr Leu Val Thr Val Ser Ala 115 <210> 110 <211> 115 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 110 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gly Met His Trp Val Arg Gin Thr Pro Glu Lys Gly Leu Glu Trp He 35 40 45 Ala Tyr Ile Asn Ser Asp Ser Asn Thr Ile Tyr Tyr Ala Asp Thr Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Arg Lys Thr Leu Tyr 65 70 75 80 Leu Gln Met Thr Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ser Pro Leu Val Ala Pro Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr 100 105 110 Val Ser Ser 115 <210> 111 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 111 Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly His Thr Phe Thr Ser Asn 20 25 30 Trp Ile His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Glu Ile Asp Pro Ser Asp Ser Tyr Thr Tyr Tyr Asn Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Ser Cys 85 90 95 Ala Cys Pro Gly Arg Asn Ser Asn Phe Ala Tyr Trp Gly Gln Gly Thr 100 105 110 Thr Leu Thr Val Ser Ser 115 <210> 112 <211> 122 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 112 Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30 Gly Met Gly Val Thr Trp Ile Arg Lys Pro Ser Gly Gln Gly Leu Glu 35 40 45 Trp Leu Ala His Ile Phe Trp Asp Gly Asp Lys Arg Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Leu Thr lie Ser Lys Asp Ser Ser Ser Asn Gin Val 65 70 75 80 Phe Leu Met lie Thr Gly Val Gly Thr Ala Asp Ala Ala Thr Tyr Tyr 85 90 95 Cys Ala Arg Tyr Tyr Tyr Phe Asp Tyr Gly Tyr Ala lie Asp Tyr Trp 100 105 110 Gly Gin Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 113 <211> 121 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 113 Glu Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Val lie His Trp Val Lys Gin Lys Pro Gly Gin Gly Leu Glu Trp lie 35 40 45 Gly Tyr lie Asp Pro Ser Asn Asp Asp Thr Lys Tyr Asn Glu Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Ala Tyr Tyr Gly Gly Leu Tyr Gly Met Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Ser Val Thr Val Ser Ser 115 120 <210> 114 <211> 117 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 114 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ile Asp Tyr 20 25 30 Thr Ile His Trp Val Lys Gln Ser Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile Phe Pro Gly Ser Thr Asn Asp Thr Lys Tyr Asn Asp Lys 50 55 60 Phe Lys Gly Lys Ala Thr Met Thr Ala Asp Lys Ser Ser Ser Thr Ala 65 70 75 80 Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe 85 90 95 Cys Ala Arg Tyr Arg Thr Asp Phe Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 <210> 115 <211> 120 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 115 Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30 Trp Met His Trp Val Arg Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Asp Ile Asp Pro Ser Asn Ser Tyr Ala Tyr His Ser Gln Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gin Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Ala Asp Gly Thr Ser His Trp Tyr Phe Asp Val Trp Gly Ala 100 105 110 Gly Thr Ala Val Thr Val Ser Ser 115 120 <210> 116 <211> 117 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 116 Gln lie Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys lie Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Leu Asn Trp Val Lys Gin Arg Pro Gly His Gly Leu Glu Trp lie 35 40 45 Gly Trp lie Tyr Pro Gly Ser Ser Asp Thr Lys His Asn Glu Asn Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Val Asp Thr Tyr Ser Ser Thr Ala Tyr 65 70 75 80 Met Gin Leu Gly Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Thr Arg Tyr Ser Asn Phe Phe Phe Asp Tyr Trp Gly Gin Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 <210> 117 <211> 121 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 117 Gln Val Thr Leu Lys Glu Ser Gly Pro Gly lie Leu Gin Pro Ser Gin 1 5 10 15 Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30 Gly Met Gly Val Ser Trp lie Arg Gin Pro Ser Gly Lys Gly Leu Glu 35 40 45 Trp Leu Thr His lie Tyr Trp Asp Asp Asp Lys Arg Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Leu Thr lie Ser Lys Asp Thr Ser Arg Asn Gin Val 65 70 75 80 Phe Leu Glu lie Thr Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Phe 85 90 95 Cys Ala Arg Ser Ser Gin Gly Leu Tyr Ser Ser Tyr Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Thr Leu Thr Val Ser Ser 115 120 <210> 118 <211> 121 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 118 Glu Val Gin Leu Gin Gin Ser Gly Pro Gin Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Val Met His Trp Val Arg Gin Lys Pro Gly Gin Gly Leu Gin Trp He 35 40 45 Gly Tyr He Asp Pro Asp Asn Asp Gly Thr Lys Tyr Asn Gin Lys Phe 50 55 60 Lys Gly Lys Ala Thr Leu Thr Ser Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Gin Leu Ser Ser Leu Thr Ser Gin Asp Ser Gin Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Ala Tyr Tyr Gly Gly Leu Tyr Gly Met Asp Tyr Trp Gly 100 105 110 Gln Gly Ser Ser Val Thr Val Ser Ser 115 120 <210> 119 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 119 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45 Ala Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Cys Trp Gly Gin Gly Thr 100 105 110 Ser Val Thr Val Ser Ser 115 <210> 120 <211> 119 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic Polypeptide" <400> 120 Glu Val Lys Leu Val Glu Ser Glu Gly Gly Leu Val Gin Pro Gly Ser 1 5 10 15 Ser Met Lys Leu Ser Cys Thr Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ala Trp Val Arg Gin Val Pro Glu Lys Gly Leu Glu Trp Val 35 40 45 Ala Asn He Asn Tyr Asp Gly Phe Asn Thr Tyr Tyr Leu Asp Ser Leu 50 55 60 Lys Ser Arg Phe He He Ser Arg Asp Asn Ala Lys Asn He Leu Tyr 65 70 75 80 Leu Gin Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Gly Gly Tyr Trp Ser Leu Tyr Phe Asp Tyr Trp Gly Gin Gly 100 105 110 Thr Thr Leu Thr Val Ser Ser 115 <210> 121 <211> 117 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 121 Gln Ile Gin Leu Gin Gin Ser Gly Pro Gin Val Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30 Tyr Ile Asn Trp Val Lys Gin Arg Pro Gly Gin Gly Leu Gin Trp Ile 35 40 45 Gly Trp Ile Tyr Pro Gly Gly Gly His Thr Lys Tyr Asn Gin Lys Phe 50 55 60 Lys Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin 65 70 75 80 Met Gin Leu Ser Ser Leu Thr Ser Gin Asp Ser Gin Val Tyr Phe Cys 85 90 95 Ala Arg Tyr Ser Asn Tyr Tyr Phe Asp Phe Trp Gly His Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 <210> 122 <211> 117 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 122 Gln Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Tyr Ile Gln Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile Tyr Pro Gly Asp Gly Thr Thr Asn Tyr Asn Glu Asn Phe 50 55 60 Lys Gly Lys Thr Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Val Tyr 65 70 75 80 Met Leu Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Tyr Gly Leu Val Pro Phe Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Leu Thr Val Ser Ser 115 <210> 123 <211> 117 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 123 Gln Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Thr Gly Ala 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Asn Thr Phe Asn Ser Asn 20 25 30 Tyr Ile Gln Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40 45 Gly Trp Ile Tyr Pro Gly Asp Gly Ser Thr Asn Tyr Ser Glu Lys Phe 50 55 60 Lys Gly Lys Thr Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala Tyr 65 70 75 80 Met Leu Val Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 85 90 95 Ala Arg Tyr Gly Pro Val Pro Phe Asp Tyr Trp Gly Gln Gly Thr Thr 100 105 110 Leu Ser Val Ser Ser 115 <210> 124 <211> 324 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note=“Artificial Sequence description: Synthetic polynucleotide” <400> 124 gatatccaga tgacgcagag cccaagcagc ctgagcgcgt ccgtgggcga ccgcgtgacg 60 atcacctgta gcgcgtccca gagcatcagc agcgactatc tgcattggta tcagcagaaa 120 ccaggtaaag cccctaaact gctgatctac cggacctcca atctggcaag cggcgtgcct 180 agccgtttca gcggtagcgg ctccggtacc gacttcacct ttactatctc cagcctgcag 240 cctgaagaca tcgcgacgta ttattgtcag cagggtacta gcctgcctcg cgccttcggc 300 caggggacca aactggaaat caaa 324 <210> 125 <211> 108 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial Sequence description: Synthetic polypeptide” <400> 125 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Ser Ala Ser Gln Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 126 <211> 324 <212> DNA <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / Polynucleotides <400> 126 gatatccaga tgacgcagag cccaagcagc ctgagcgcgt ccgtgggcga ccgcgtgacg 60 atcacctgtc aggcgtccca gagcatcagc agcgactatc tgcattggta tcagcagaaa 120 ccaggtaaag cccctaaact gctgatctac cggacctcca atctggaaac cggcgtgcct 180 agccgtttca gcggtagcgg ctccggtacc gacttcacct ttactatctc cagcgtgcag 240 cctgaagaca tcgcgacgta ttattgtcag cagggtacta gcctgcctcg cgccttcggc 300 caggggacca aactggaaat caaa 324 <210> 127 <211> 108 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 127 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp lie Ala Thr Tyr Tyr Cys Gin Gin Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gin Gly Thr Lys Leu Glu lie Lys 100 105 <210> 128 <211> 324 <212> DNA <213> Artificial Sequence <220> <221> source <223> NOTE = "Artificial sequence description: synthetic polynucleotide" <400> 128 gatatccaga tgacgcagag cccaagcagc ctgagcgcgt ccgtgggcga ccgcgtgacg 60 atcacctgtc aggcgtccca gagcatcagc agcgactatc tgcattggta tcagcagaaa 120 ccaggtaaag cccctaaact gctgatctac cggacctcca atctggaaag cggcgtgcct 180 agccgtttca gcggtagcgg ctccggtacc gacttcacct ttactatctc cagcctgcag 240 cctgaagaca tcgcgacgta ttattgtcag cagggtacta gcctgcctcg cgccttcggc 300 caggggacca aactggaaat caaa 324 <210> 129 <211> 108 <212> PRT <213> Artificial Sequence <220> <221> source <223> NOTE = "Artificial sequence description: synthetic polynucleotide"Polypeptide <400> 129 Asp Ile Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Gin Ala Ser Gin Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gin Gin Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Glu Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gin 65 70 75 80 Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gin Gin Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gin Gly Thr Lys Leu Glu Ile Lys 100 105 <210> 130 <211> 354 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic Polynucleotide <400> 130 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtgtcatac atcagctccg ggggcggtag caagtactat 180 ccggacctgg tgaaagggcg ctttactatc tcccgggata atgcaaaaaa tagcctgtac 240 ctgcagatga gcagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagc 354 <210> 131 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 131 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr He Ser Ser Gly Gly Gly Ser Lys Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gin Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 132 <211> 354 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polyribonucleotide" <400> 132 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtggcatac atcagctccg ggggcggtag cagctactat 180 ccggacctgg tgaaagggcg ctttactatc tcccgggata atgcaaaaaa tagcctgtac 240 ctgcagatgc agagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagc 354 <210> 133 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 133 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gin Met Gin Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 134 <211> 354 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic polynucleotide" <400> 134 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtggcatac atcagctccg ggggcggtag cagctactat 180 ccggacgctg tgaaagggcg ctttactatc tcccgggata atgcaaaaca gagcctgtac 240 ctgcagatgc agagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagc 354 <210> 135 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic polypeptide" <400> 135 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ala Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ala Lys Gin Ser Leu Tyr 65 70 75 80 Leu Gin Met Gin Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 136 <211> 354 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic poly nucleotide" <400> 136 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtggcctac atcagctccg ggggcggtag cagctactat 180 ccggacctgg tgaaagggcg ctttactatc tcccgggata atgcaaaaca gagcctgtac 240 ctgcagatga acagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagc 354 <210> 137 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 137 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Gin Ser Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 138 <211> 354 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polynucleotide" <400> 138 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtggcctac atcagctccg ggggcggtag cagctactat 180 ccggacctgg tgaaagggcg ctttactatc tcccgggata atgcaaaaca gagcctgtac 240 ctgcagatgc agagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagc 354 <210> 139 <211> 118 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 139 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ala Lys Gin Ser Leu Tyr 65 70 75 80 Leu Gin Met Gin Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 140 <211> 645 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Artificial sequence description: synthetic polynucleotide" <400> 140 gatatccaga tgacgcagag cccaagcagc ctgagcgcgt ccgtgggcga ccgcgtgacg 60 atcacctgta gcgcgtccca gagcatcagc agcgactatc tgcattggta tcagcagaaa 120 ccaggtaaag cccctaaact gctgatctac cggacctcca atctggcaag cggcgtgcct 180 agccgtttca gcggtagcgg ctccggtacc gacttcacct ttactatctc cagcctgcag 240 cctgaagaca tcgcgacgta ttattgtcag cagggtacta gcctgcctcg cgccttcggc 300 caggggacca aactggaaat caaacgtact gtggctgcac catctgtctt catcttcccg 360 ccatctgatg agcaattgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 420 tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 480 caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 540 acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 600 ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgt 645 <210> 141 <211> 215 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 141 Asp Ile Gin Met Thr Gin Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Ser Ala Ser Gin Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gin Gin Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gin 65 70 75 80 Pro Gin Asp Ile Ala Thr Tyr Tyr Cys Gin Gin Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gin Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala 100 105 110 Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser 115 120 125 Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 130 135 140 Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser 145 150 155 160 Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu 165 170 175 Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val 180 185 190 Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys 195 200 205 Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 142 <211> 1332 <212> DNA <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" Polynucleotides <400> 142 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtgtcatac atcagctccg ggggcggtag caagtactat 180 ccggacctgg tgaaagggcg ctttactatc tcccgggata atgcaaaaaa tagcctgtac 240 ctgcagatga gcagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagcgcctcc 360 acaaagggcc cttccgtgtt ccccctggcc ccttgctccc ggtccacctc cgagtctacc 420 gccgctctgg gctgcctggt caaggactac ttccccgagc ccgtgaccgt gtcctggaac 480 tctggcgccc tgacctccgg cgtgcacacc ttccctgctg tgctgcagtc ctccggcctg 540 tactccctgt cctccgtcgt gaccgtgccc tcctctagcc tgggcaccaa gacctacacc 600 tgtaacgtgg accacaagcc ctccaacacc aaggtggaca agcgggtgga atctaagtac 660 ggccctccct gccccccctg ccctgcccct gaatttctgg gcggaccctc cgtgttcctg 720 ttccccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 780 gtggtggacg tgtcccagga agatcccgag gtccagttta attggtacgt ggacggcgtg 840 gaagtgcaca acgccaagac caagcccaga gaggaacagt tcaactccac ctaccgggtg 900 gtgtccgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaagagta caagtgcaag 960 gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 1020 ccccgcgagc cccaggtgta caccctgcct ccaagccagg aagagatgac caagaaccag 1080 gtgtccctga cctgtctggt caagggcttc tacccctccg atatcgccgt ggaatgggag 1140 tccaacggcc agcccgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 1200 tccttcttcc tgtactctcg gctgaccgtg gacaagtccc ggtggcagga aggcaacgtc 1260 ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 1320 ctgagcctgg gc 1332 <210> 143 <211> 444 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic Polypeptide" <400> 143 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr He Ser Ser Gly Gly Gly Ser Lys Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gin Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser lie Glu Lys Thr lie Ser Lys 325 330 335 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 435 440 <210> 144 <211> 645 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polynucleotide" <400> 144 gacatccaga tgacccagag cccaagcagc ctgagcgcca gcgtgggcga ccgcgtgacc 60 atcacctgcc aggccagcca gagcatcagc agcgactacc tgcactggta ccagcagaag 120 ccaggcaagg ccccaaagct gctgatctac cgcaccagca acctggagac cggcgtgcca 180 agccgcttca gcggcagcgg cagcggcacc gacttcacct tcaccatcag cagcctgcag 240 ccagaggaca tcgccaccta ctactgccag cagggcacca gcctgccacg cgccttcggc 300 cagggcacca agctggagat caagcgtact gtggctgcac catctgtctt catcttcccg 360 ccatctgatg agcaattgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 420 tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 480 caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 540 acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 600 ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgt 645 <210> 145 <211> 215 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" / polypeptide <400> 145 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala 100 105 110 Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser 115 120 125 Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 130 135 140 Ala Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser 145 150 155 160 Gln Glu Ser Val Thr Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu 165 170 175 Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val 180 185 190 Tyr Ala Cys Glu Val Thr His Gin Gly Leu Ser Ser Pro Val Thr Lys 195 200 205 Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 146 <211> 1332 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polynucleotide" <400> 146 gaagtgcagc tggtggaaag cggcggaggc ctggtgcagc caggcggcag cctgagactg 60 agctgcgccg ccagcggctt caccttcagc gactactaca tgagctgggt gcgccaggcc 120 ccaggcaagg gcctggagtg ggtggcctac atcagcagcg gcggcggcag cagctactac 180 ccagacctgg tgaagggccg cttcaccatc agccgcgaca acgccaagaa cagcctgtac 240 ctgcagatgc agagcctgcg cgccgaggac accgccgtgt actactgcgc ccgcctgcca 300 cactacttcg ccatggacta ctggggccag ggcaccctgg tgaccgtgag cagcgcctcc 360 acaaagggcc cttccgtgtt ccccctggcc ccttgctccc ggtccacctc cgagtctacc 420 gccgctctgg gctgcctggt caaggactac ttccccgagc ccgtgaccgt gtcctggaac 480 tctggcgccc tgacctccgg cgtgcacacc ttccctgctg tgctgcagtc ctccggcctg 540 tactccctgt cctccgtcgt gaccgtgccc tcctctagcc tgggcaccaa gacctacacc 600 tgtaacgtgg accacaagcc ctccaacacc aaggtggaca agcgggtgga atctaagtac 660 ggccctccct gccccccctg ccctgcccct gaatttctgg gcggaccctc cgtgttcctg 720 ttccccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 780 gtggtggacg tgtcccagga agatcccgag gtccagttta attggtacgt ggacggcgtg 840 gaagtgcaca acgccaagac caagcccaga gaggaacagt tcaactccac ctaccgggtg 900 gtgtccgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaagagta caagtgcaag 960 gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 1020 ccccgcgagc cccaggtgta caccctgcct ccaagccagg aagagatgac caagaaccag 1080 gtgtccctga cctgtctggt caagggcttc tacccctccg atatcgccgt ggaatgggag 1140 tccaacggcc agcccgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 1200 tccttcttcc tgtactctcg gctgaccgtg gacaagtccc ggtggcagga aggcaacgtc 1260 ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 1320 ctgagcctgg gc 1332 <210> 147 <211> 444 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 147 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Gln Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 435 440 <210> 148 <211> 1332 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polynucleotide" <400> 148 gaggtgcagc tggtggagag cggcggcggc ctggtgcagc caggtggtag cctgcgcctg 60 agctgcgccg ccagcggctt caccttcagc gactactaca tgagctgggt gcgccaggct 120 ccaggcaagg gtctggaatg ggtggcctac atcagcagcg gcggcggcag cagctactac 180 ccagacgccg tgaagggccg cttcaccatc agccgcgaca acgccaagca gagcctgtac 240 ctgcagatgc agagcctgcg cgccgaggac accgccgtgt actactgcgc ccgcctgcca 300 cactacttcg ccatggacta ctggggccag ggcaccctgg tgaccgtgag cagcgcctcc 360 acaaagggcc cttccgtgtt ccccctggcc ccttgctccc ggtccacctc cgagtctacc 420 gccgctctgg gctgcctggt caaggactac ttccccgagc ccgtgaccgt gtcctggaac 480 tctggcgccc tgacctccgg cgtgcacacc ttccctgctg tgctgcagtc ctccggcctg 540 tactccctgt cctccgtcgt gaccgtgccc tcctctagcc tgggcaccaa gacctacacc 600 tgtaacgtgg accacaagcc ctccaacacc aaggtggaca agcgggtgga atctaagtac 660 ggccctccct gccccccctg ccctgcccct gaatttctgg gcggaccctc cgtgttcctg 720 ttccccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 780 gtggtggacg tgtcccagga agatcccgag gtccagttta attggtacgt ggacggcgtg 840 gaagtgcaca acgccaagac caagcccaga gaggaacagt tcaactccac ctaccgggtg 900 gtgtccgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaagagta caagtgcaag 960 gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 1020 ccccgcgagc cccaggtgta caccctgcct ccaagccagg aagagatgac caagaaccag 1080 gtgtccctga cctgtctggt caagggcttc tacccctccg atatcgccgt ggaatgggag 1140 tccaacggcc agcccgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 1200 tccttcttcc tgtactctcg gctgaccgtg gacaagtccc ggtggcagga aggcaacgtc 1260 ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 1320 ctgagcctgg gc 1332 <#210> 149 <#211> 444 <#212> PRT <#213> Synthetic Sequence <#220> <#221> source <#223> / note="Synthetic Sequence Description: Synthetic polypeptide" <#400> 149 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr ​ Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ala Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ala Lys Gin Ser Leu Tyr 65 70 75 80 Leu Gin Met Gin Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 435 440 <210> 150 <211> 645 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic polynucleotide" <400> 150 gacatccaga tgacccagag cccaagcagc ctgagcgcca gcgtgggcga ccgcgtgacc 60 atcacctgcc aggccagcca gagcatcagc agcgactacc tgcactggta ccagcagaag 120 ccaggcaagg ccccaaagct gctgatctac cgcaccagca acctggagag cggcgtgcca 180 agccgcttca gcggcagcgg cagcggcacc gacttcacct tcaccatcag cagcctgcag 240 ccagaggaca tcgccaccta ctactgccag cagggcacca gcctgccacg cgccttcggc 300 cagggcacca agctggagat caagcgtact gtggctgcac catctgtctt catcttcccg 360 ccatctgatg agcaattgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 420 tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 480 caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 540 acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 600 ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgt 645 <210> 151 <211> 215 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note="Artificial Sequence Description: Synthetic polypeptide" <400> 151 A sp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Ser Ile Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Arg Thr Ser Asn Leu Glu Ser Gly Val Pro Ser Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln 65 70 75 80 Pro Glu Asp Ile Ala Thr Tyr Tyr Cys Gln Gln Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys Arg Thr Val Ala 100 105 110 Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser 115 120 125 Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 130 135 140 Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser 145 150 155 160 Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu 165 170 175 Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val 180 185 190 Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys 195 200 205 Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 152 <211> 1332 <212> DNA <213> Artificial sequence <220> <221> source <223> / note="Artificial sequence description: synthetic polynucleotide" <400> 152 gaagtgcagc tggtggaaag cggtggtggc ctggtgcagc caggcggctc cctgcgcctg 60 agctgcgccg caagcggttt cacctttagc gactactata tgtcctgggt gcgtcaggcg 120 ccaggtaaag gtctggaatg ggtggcctac atcagctccg ggggcggtag cagctactat 180 ccggacctgg tgaaagggcg ctttactatc tcccgggata atgcaaaaca gagcctgtac 240 ctgcagatga acagcctgcg ggcggaagat accgccgtgt attactgtgc gcgtctgccg 300 cattatttcg ccatggatta ctggggccag gggaccctgg tgaccgtgag cagcgcctcc 360 acaaagggcc cttccgtgtt ccccctggcc ccttgctccc ggtccacctc cgagtctacc 420 gccgctctgg gctgcctggt caaggactac ttccccgagc ccgtgaccgt gtcctggaac 480 tctggcgccc tgacctccgg cgtgcacacc ttccctgctg tgctgcagtc ctccggcctg 540 tactccctgt cctccgtcgt gaccgtgccc tcctctagcc tgggcaccaa gacctacacc 600 tgtaacgtgg accacaagcc ctccaacacc aaggtggaca agcgggtgga atctaagtac 660 ggccctccct gccccccctg ccctgcccct gaatttctgg gcggaccctc cgtgttcctg 720 ttccccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 780 gtggtggacg tgtcccagga agatcccgag gtccagttta attggtacgt ggacggcgtg 840 gaagtgcaca acgccaagac caagcccaga gaggaacagt tcaactccac ctaccgggtg 900 gtgtccgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaagagta caagtgcaag 960 gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 1020 ccccgcgagc cccaggtgta caccctgcct ccaagccagg aagagatgac caagaaccag 1080 gtgtccctga cctgtctggt caagggcttc tacccctccg atatcgccgt ggaatgggag 1140 tccaacggcc agcccgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 1200 tccttcttcc tgtactctcg gctgaccgtg gacaagtccc ggtggcagga aggcaacgtc 1260 ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 1320 ctgagcctgg gc 1332 <210> 153 <211> 444 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 153 Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Gin Ser Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 435 440 <210> 154 <211> 1332 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic poly-nucleotide" <400> 154 gaggtgcagc tggtggagag cggcggcggc ctggtgcagc caggtggtag cctgcgcctg 60 agctgcgccg ccagcggctt caccttcagc gactactaca tgagctgggt gcgccaggct 120 ccaggcaagg gtctggaatg ggtggcctac atcagcagcg gcggcggcag cagctactac 180 ccagacctgg tgaagggccg cttcaccatc agccgcgaca acgccaagca gagcctgtac 240 ctgcagatgc agagcctgcg cgccgaggac accgccgtgt actactgcgc ccgcctgcca 300 cactacttcg ccatggacta ctggggccag ggcaccctgg tgaccgtgag cagcgcctcc 360 acaaagggcc cttccgtgtt ccccctggcc ccttgctccc ggtccacctc cgagtctacc 420 gccgctctgg gctgcctggt caaggactac ttccccgagc ccgtgaccgt gtcctggaac 480 tctggcgccc tgacctccgg cgtgcacacc ttccctgctg tgctgcagtc ctccggcctg 540 tactccctgt cctccgtcgt gaccgtgccc tcctctagcc tgggcaccaa gacctacacc 600 tgtaacgtgg accacaagcc ctccaacacc aaggtggaca agcgggtgga atctaagtac 660 ggccctccct gccccccctg ccctgcccct gaatttctgg gcggaccctc cgtgttcctg 720 ttccccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 780 gtggtggacg tgtcccagga agatcccgag gtccagttta attggtacgt ggacggcgtg 840 gaagtgcaca acgccaagac caagcccaga gaggaacagt tcaactccac ctaccgggtg 900 gtgtccgtgc tgaccgtgct gcaccaggac tggctgaacg gcaaagagta caagtgcaag 960 gtgtccaaca agggcctgcc ctccagcatc gaaaagacca tctccaaggc caagggccag 1020 ccccgcgagc cccaggtgta caccctgcct ccaagccagg aagagatgac caagaaccag 1080 gtgtccctga cctgtctggt caagggcttc tacccctccg atatcgccgt ggaatgggag 1140 tccaacggcc agcccgagaa caactacaag accacccccc ctgtgctgga ctccgacggc 1200 tccttcttcc tgtactctcg gctgaccgtg gacaagtccc ggtggcagga aggcaacgtc 1260 ttctcctgct ccgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtcc 1320 ctgagcctgg gc 1332 <210> 155 <211> 444 <212> PRT <213> Artificial Sequence <220> s<221> source <223> / note="Artificial sequence description: synthetic polypeptide" <400> 155 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Tyr lie Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Leu Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Gin Ser Leu Tyr 65 70 75 80 Leu Gin Met Gin Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 435 440 <210> 156 <211> 645 <212> DNA <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: synthetic polynucleotide" <400> 156 gagatcgtgc tgacacagag ccctaccaca atggccgcct ctccaggcga gaagatcacc 60 atcacatgta gcgccagcag cagcatcagc agcgactacc tgcactggta tcagcagaag 120 cctggcttca gccccgagct gctgatctac agaacaagca atctggccag cggcgtgcca 180 gccagatttt ctggttctgg cagcggcacc agctacagcc tgacaatcgg atccatggaa 240 gccgaggacg tggccaccta ttactgtcag cagggcacaa gcctgcctag agcctttggc 300 ggaggcacca agctggaaat caagcgtact gtggctgcac catctgtctt catcttcccg 360 ccatctgatg agcaattgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 420 tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 480 caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 540 acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 600 ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgt 645 <210> 157 <211> 215 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic Polypeptide" <400> 157 Glu lie Val Leu Thr Gin Ser Pro Thr Thr Met Ala Ala Ser Pro Gly 1 5 10 15 Glu Lys lie Thr lie Thr Cys Ser Ala Ser Ser Ser lie Ser Ser Asp 20 25 30 Tyr Leu His Trp Tyr Gin Gin Lys Pro Gly Phe Ser Pro Glu Leu Leu 35 40 45 lie Tyr Arg Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr lie Gly Ser Met Glu 65 70 75 80 Ala Glu Asp Val Ala Thr Tyr Tyr Cys Gin Gin Gly Thr Ser Leu Pro 85 90 95 Arg Ala Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arg Thr Val Ala 100 105 110 Ala Pro Ser Val Phe lie Phe Pro Pro Ser Asp Glu Gin Leu Lys Ser 115 120 125 Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 130 135 140 Ala Lys Val Gin Trp Lys Val Asp Asn Ala Leu Gin Ser Gly Asn Ser 145 150 155 160 Gln Glu Ser Val Thr Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu 165 170 175 Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val 180 185 190 Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys 195 200 205 Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 158 <211> 1341 <212> DNA <213> Artificial sequence <220> <221> source <223> / note="Artificial sequence description: synthetic polynucleotide" <400> 158 gaagtgcagc tggtggaatc tggcggagga cttgttcaac ctggcggcag cctgaaactg 60 tcttgtgccg ccagcggctt caccttcagc gactactaca tgagctgggt ccgacagacc 120 cctgagaaga gactggaatg ggtcgcctac atcagctctg gcggcggaag cagctactac 180 cctgatagcg tgaagggcag attcaccatc agccgggaca acaccaagaa caccctgtac 240 ctgcagatgt ccagcctgaa gtctgaggac accgccgtgt actactgtgc cagactgcct 300 cactacttcg ccatggatta ttggggccag ggcaccagcg tgaccgtttc ttctgcctcc 360 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 GCGGCCGCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGT CGGAAC 60 aagaaccagg taagtttgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 1140 gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac 1200 tccgacggct ccttcttcct ctatagcaag ctcaccgtgg acaagagcag gtggcagcag 1260 gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 1320 agcctctccc tgtctccggg t 1341 <210> 159 <211> 447 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic Polypeptide" <400> 159 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45 Ala Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Thr Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Ser Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Gin Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Gin Thr Tyr lie Cys Asn Val Asn His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys Thr 210 215 220 His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 225 230 235 240 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 245 250 255 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 260 265 270 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 275 280 285 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 290 295 300 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 305 310 315 320 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 325 330 335 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 340 345 350 Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 355 360 365 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 370 375 380 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 385 390 395 400 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 405 410 415 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 420 425 430 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 435 440 445 <210> 160 <211> 1341 <212> DNA <213> Synthetic sequence <220> <221> source <223> / Note="Synthetic polynucleotide" <400> 160 gaagtgcagc tggtggaatc tggcggagga cttgttcaac ctggcggcag cctgaaactg 60 tcttgtgccg ccagcggctt caccttcagc gactactaca tgagctgggt ccgacagacc 120 cctgagaaga gactggaatg ggtcgcctac atcagctctg gcggcggaag cagctactac 180 cctgatagcg tgaagggcag attcaccatc agccgggaca acaccaagaa caccctgtac 240 ctgcagatgt ccagcctgaa gtctgaggac accgccgtgt actactgtgc cagactgcct 300 cactacttcg ccatggattg ttggggccag ggcacatctg tgaccgttag ttctgcctcc 360 accaagggcc catcggtctt cccgctagca ccctcctcca agagcacctc tgggggcaca 420 gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 480 tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 540 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 600 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agcgcgttga gcccaaatct 660 tgtgacaaaa ctcacacatg cccaccgtgc ccagcacctg aagccgctgg gggaccgtca 720 gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 780 acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 840 gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 900 taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 960 aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 1020 aaagggcagc cccgagaacc acaggtgtac accctgcccc catcccgcga ggagatgacc 1080 aagaaccagg taagtttgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 1140 gagtgggaga gcaatgggca gccggagaac aactacaaga ccacgcctcc cgtgctggac 1200 tccgacggct ccttcttcct ctatagcaag ctcaccgtgg acaagagcag gtggcagcag 1260 gggaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacgcagaag 1320 agcctctccc tgtctccggg t 1341 <210> 161 <211> 447 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial Sequence Description: Synthetic Polypeptide" <400> 161 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45 Ala Tyr Ile Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Cys Trp Gly Gln Gly Thr 100 105 110 Ser Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys Thr 210 215 220 His Thr Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro Ser 225 230 235 240 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 245 250 255 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 260 265 270 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 275 280 285 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 290 295 300 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 305 310 315 320 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 325 330 335 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 340 345 350 Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 355 360 365 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 370 375 380 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 385 390 395 400 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 405 410 415 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 420 425 430 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 435 440 445 <210> 162 <211> 1332 <212> DNA <213> Artificial sequence <220> <221> source <223> / Note="Artificial sequence description: synthesis" Polynucleotides <400> 162 gaagtgcagc tggtggaatc tggcggagga cttgttcaac ctggcggcag cctgaaactg 60 tcttgtgccg ccagcggctt caccttcagc gactactaca tgagctgggt ccgacagacc 120 cctgagaaga gactggaatg ggtcgcctac atcagctctg gcggcggaag cagctactac 180 cctgatagcg tgaagggcag attcaccatc agccgggaca acaccaagaa caccctgtac 240 ctgcagatgt ccagcctgaa gtctgaggac accgccgtgt actactgtgc cagactgcct 300 cactacttcg ccatggatta ttggggccag ggcaccagcg tgaccgtttc ttctgcctcc 360 acaaagggcc cttccgtgtt ccccctggcc cttgctccc ggtccacctc cgagtctacc 420 gccgctctgg gctgcctggt caaggactac ttccccgagc ccgtgaccgt gtcctggaac 480 tctggcgccc tgacctccgg cgtgcacacc ttccctgctg tgctgcagtc ctccggcctg 540 tactccctgt cctccgtcgt gaccgtgccc tctctagcc tgggcaccaa gacctacacc 600 tgtaacgtgg accacaagcc ctccaacacc aaggtggaca agcgggtgga atctaagtac 660 ggccctccct gccccccctg ccctgcccct gaatttctgg gcggaccctc cgtgttcctg 720 ttccccccaa agcccaagga caccctgatg atctcccgga cccccgaagt gacctgcgtg 780 gtggtggacg tgtcccagga agatcccgag gtccagttta attggtacgt ggacggcgtg 840 GAAGTGCACA ACACCAAGAC CAAACCTAGA GGAACAGTTG AACTCCACCT ACCGGGTG 900 GTGTCCGTGC TGACCCTGCT GCACCAAGAC TGGCTGAACG GCAAAGAGTA CAAGTGCAAG 960 GTGTCCAACA AGGGCCTGCC CTCCAGCATC GAAAAGACCA TCTCCAAGGC CAAGGGCCAG 1020 CCCCGCGAGC CCCAGGTGTA CACCCTGCCT CCAAGCCAGG AAGAGATGAC CAAGAACCAG 1080 GTGTCCCTGA CCTGTCTGGT CAAGGGCTTC TACCCCTCCG ATATCGCCGT GGAATGGGAG 1140 TCCAACGGCC AGCCCGAGAA CAACTACAAG ACCACCCCCC CTGTGCTGGA CTCCGACGGC 1200 TCCTTCTTCC TGTCCTCTCG GCTGACCCTG GACAAGTCCC GGTGGCAGGA AGGCAACGTC 1260 TTCTCCTGCT CCCTGATGCA CGAGGCCCTG CACAACCACC ACCTCAGAAG TCCCTGTCC 1320 CTGAGCCTGG GC 1332 <210> 163 <211> 444 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial Sequence Description: Synthetic Polypeptide” <400> 163 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45 Ala Tyr He Ser Ser Gly Gly Gly Ser Ser Tyr Tyr Pro Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Thr Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Leu Pro His Tyr Phe Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 Ser Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gin 165 170 175 ​​​​​​​​​​​​​​​​​​​Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser 340 345 350 Gln Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp He Ala Val Glu Trp Glu Ser Asn Gly Gin 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin 405 410 415 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 435 440 <210> 164 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note= "Artificial sequence description: Synthetic peptide" <400> 164 Ser Ala Ser Gin Ser He Ser Ser Asp Tyr Leu His 1 5 10 <210> 165 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial Sequence description: Synthetic peptide” <400> 165 Gln Ala Ser Gln Ser lie Ser Ser Asp Tyr Leu His 1 5 10 <210> 166 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial Sequence description: Synthetic peptide” <400> 166 Arg Thr Ser Asn Leu Glu Thr 1 5 <210> 167 <211> 7 <212> PRT <213> Artificial Sequence <220> <221> source <223> / note=“Artificial Sequence description: Synthetic peptide” <400> 167 Arg Thr Ser Asn Leu Glu Ser 1 5

Claims

1. An anti-PD-1 antibody or antigen-binding fragment thereof, comprising: a heavy chain variable region comprising a H-CDR1 as set forth in SEQ ID NO: 73; a H-CDR2 as set forth in SEQ ID NO: 78; and a H-CDR3 as set forth in SEQ ID NO: 77, and a light chain variable region comprising a L-CDR1 as set forth in SEQ ID NO: 165; a L-CDR2 as set forth in SEQ ID NO: 166; and a L-CDR3 as set forth in SEQ ID NO: 32, or a heavy chain variable region comprising a H-CDR1 as set forth in SEQ ID NO: 73; a H-CDR2 as set forth in SEQ ID NO: 76; and a H-CDR3 as set forth in SEQ ID NO: 77, and a light chain variable region comprising a L-CDR1 as set forth in SEQ ID NO: 164; a L-CDR2 as set forth in SEQ ID NO: 31; and a L-CDR3 as set forth in SEQ ID NO: 32, or a heavy chain variable region comprising a H-CDR1 as set forth in SEQ ID NO: 73; a H-CDR2 as set forth in SEQ ID NO: 79; and a H-CDR3 as set forth in SEQ ID NO: 77, and a light chain variable region comprising a L-CDR1 as set forth in SEQ ID NO: 165; a L-CDR2 as set forth in SEQ ID NO: 166; and a L-CDR3 as set forth in SEQ ID NO: 32, or a heavy chain variable region comprising a H-CDR1 as set forth in SEQ ID NO: 73; a H-CDR2 as set forth in SEQ ID NO: 79; and a H-CDR3 as set forth in SEQ ID NO: 77, and a light chain variable region comprising a L-CDR1 as set forth in SEQ ID NO: 165; a L-CDR2 as set forth in SEQ ID NO: 167; and a L-CDR3 as set forth in SEQ ID NO:

32.

2. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1, wherein the antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof.

3. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody or antigen-binding fragment thereof is selected from the group consisting of a Fab, a F(ab')2, a Fv, and a scFv.

4. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region and a light chain variable region that are at least 90% identical to the amino acid sequences of SEQ ID NO: 135 and SEQ ID NO: 127, respectively; a heavy chain variable region and a light chain variable region that are at least 90% identical to the amino acid sequences of SEQ ID NO: 131 and SEQ ID NO: 125, respectively; a heavy chain variable region and a light chain variable region that are at least 90% identical to the amino acid sequences of SEQ ID NO: 133 and SEQ ID NO: 127, respectively; a heavy chain variable region and a light chain variable region that are at least 90% identical to the amino acid sequences of SEQ ID NO: 137 and SEQ ID NO: 129, respectively; or a heavy chain variable region and a light chain variable region that are at least 90% identical to the amino acid sequences of SEQ ID NO: 139 and SEQ ID NO: 129, respectively.

5. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 135 and SEQ ID NO: 127, respectively; a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 131 and SEQ ID NO: 125, respectively; a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 133 and SEQ ID NO: 127, respectively; a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 137 and SEQ ID NO: 129, respectively; or a heavy chain variable region and a light chain variable region comprising the amino acid sequences of SEQ ID NO: 139 and SEQ ID NO: 129, respectively.

6. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody comprises a heavy chain constant region selected from the group consisting of an IgG4, IgGl, IgG2, IgG3, IgM, IgA, and IgE constant region.

7. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 6, wherein the heavy chain constant region is a heavy chain constant region of IgG4 with a Ser228Pro mutation.

8. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 6, wherein the heavy chain constant region is a heavy chain constant region of IgGl with Leu234Ala and Leu235Ala mutations.

9. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody or antigen-binding fragment thereof comprises a light chain constant region selected from the group consisting of kappa and lambda.

10. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody comprises: a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 149 and SEQ ID NO: 145, respectively; a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 143 and SEQ ID NO: 141, respectively; a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 147 and SEQ ID NO: 145, respectively; a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 153 and SEQ ID NO: 151, respectively; or a heavy chain and a light chain comprising the amino acid sequences of SEQ ID NO: 155 and SEQ ID NO: 151, respectively.

11. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody consists of a heavy chain and a light chain consisting of the amino acid sequences of SEQ ID NO: 149 and SEQ ID NO: 145, respectively.

12. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody consists of a heavy chain and a light chain consisting of the amino acid sequences of SEQ ID NO: 143 and SEQ ID NO: 141, respectively.

13. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody consists of a heavy chain and a light chain consisting of the amino acid sequences of SEQ ID NO: 147 and SEQ ID NO: 145, respectively.

14. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody consists of a heavy chain and a light chain consisting of the amino acid sequences of SEQ ID NO: 153 and SEQ ID NO: 151, respectively.

15. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody consists of a heavy chain and a light chain consisting of the amino acid sequences of SEQ ID NO: 155 and SEQ ID NO: 151, respectively.

16. The anti-PD-1 antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody or antigen-binding fragment thereof is a monoclonal antibody.

17. A pharmaceutical composition comprising the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1-16, and a pharmaceutically acceptable excipient.

18. An isolated polynucleotide encoding the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1-16.

19. An isolated polynucleotide encoding the heavy chain variable region and the light chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5.

20. An isolated polynucleotide encoding a heavy chain and a light chain of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15.

21. An expression vector comprising the polynucleotide of any one of claims 18-20.

22. A host cell comprising the expression vector of claim 21.

23. The host cell of claim 22, wherein the cell is a mammalian cell.

24. An isolated polynucleotide encoding a heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5 and an isolated polynucleotide encoding a light chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5, wherein the polynucleotide encoding the heavy chain variable region and the polynucleotide encoding the light chain variable region are useful for the manufacture of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5.

25. An isolated polynucleotide encoding a heavy chain of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15 and an isolated polynucleotide encoding a light chain of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15, wherein the polynucleotide encoding the heavy chain and the polynucleotide encoding the light chain are useful for the manufacture of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15.

26. An expression vector comprising a polynucleotide encoding a heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5 and an expression vector comprising a polynucleotide encoding a light chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5, wherein the expression vector comprising the polynucleotide encoding the heavy chain variable region and the expression vector comprising the polynucleotide encoding the light chain variable region are useful for the manufacture of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5.

27. An expression vector comprising a polynucleotide encoding a heavy chain of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15 and an expression vector comprising a polynucleotide encoding a light chain of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15, wherein the expression vector comprising the polynucleotide encoding the heavy chain and the expression vector comprising the polynucleotide encoding the light chain are useful for the manufacture of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 6-15.

28. A host cell comprising: an expression vector comprising a polynucleotide encoding a heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5, and an expression vector comprising a polynucleotide encoding a light chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof of any one of claims 1, 2, 4, and 5. an expression vector comprising a polynucleotide encoding the heavy chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 6-15, wherein the host cell is useful for manufacturing the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 6-15.

29. A host cell comprising: an expression vector comprising a polynucleotide encoding the heavy chain of the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 6-15, and an expression vector comprising a polynucleotide encoding the light chain of the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 6-15, wherein the host cell is useful for manufacturing the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 6-15.

30. The host cell of claim 28 or 29, wherein the cell is a mammalian cell.

31. A method of manufacturing an antibody, comprising the steps of: culturing a host cell under conditions permitting the antibody to form, the host cell comprising: an expression vector comprising a polynucleotide encoding a heavy chain variable region and an expression vector comprising a polynucleotide encoding a light chain variable region; and recovering the antibody, wherein the heavy chain variable region and the light chain variable region are, respectively, the heavy chain variable region and the light chain variable region of the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 1, 2, 4, and 5.

32. The method of claim 31, wherein: the host cell comprises: an expression vector comprising a polynucleotide encoding a heavy chain and an expression vector comprising a polynucleotide encoding a light chain, wherein the heavy chain and the light chain are, respectively, the heavy chain and the light chain of the anti-PD-1 antibody or antigen-binding fragment thereof according to any one of claims 6-15.

33. The method of claim 31 or 32, further comprising the step of purifying the antibody.

34. The method of claim 31 or 32, further comprising the step of formulating the antibody into a pharmaceutical composition.

35. A multispecific antibody comprising a first anti-PD-1 agonist antigen-binding site and a second antigen-binding site, wherein the first anti-PD-1 agonist antigen-binding site comprises a heavy chain variable region and a light chain variable region according to any one of claims 1, 2, 4, and 5.

36. The multispecific antibody of claim 35, wherein the second antigen-binding site is an anti-CD48 binding site.

37. The multispecific antibody of claim 35 or 36, wherein the antibody is a bispecific antibody.

Images