A genetically engineered bacterium for increasing GDP-L-fucose production

Abstract

The present invention relates to a genetically engineered bacterium for increasing GDP-L-fucose production, and belongs to the field of genetic engineering technology. The present invention uses Escherichia coli as a starting strain, knocks out the undecenyl glucose phosphate phosphotransferase encoding gene wcaJ, and inserts a terminator after the GDP-mannose pyrophosphorylase encoding gene manC to obtain a genetically engineered bacterium for increasing GDP-L-fucose production; the nucleotide sequences of the undecenyl glucose phosphate phosphotransferase encoding gene wcaJ and the GDP-mannose pyrophosphorylase encoding gene manC are shown in SEQ ID NO.1-2. Compared with other strains, the present invention blocks the expression of subsequent non-essential genes, greatly reduces the substances and energy consumed by the strain in other pathways, reduces the survival pressure of the strain, and allows the strain to focus a lot of energy on synthesizing the target product GDP-L-fucose, thereby increasing the yield of GDP-L-fucose.

Description

Technical Field

[0001] The invention relates to a genetic engineering bacterium for improving GDP-L-fucose production, belonging to the technical field of genetic engineering. Background Art

[0002] GDP-L-fucose is an activated form of nucleotides and a donor for the production of many important substances. It plays an important role in many biological functions, such as the synthesis of L-fucose and 2-FL. GDP-L-fucose is also an intermediate product for the synthesis of cell capsular heteropolysaccharide acid by some microorganisms (such as Escherichia coli) and is an important biological component. The amount of GDP-L-fucose synthesized by wild-type strains is very small and cannot meet the needs of industrial production. Therefore, it is crucial to increase the accumulation of intracellular GDP-L-fucose.

[0003] In the prior art, GDP-L-fucose is usually synthesized by a de novo synthesis pathway. Taking Escherichia coli as an example, the de novo synthesis pathway of GDP-L-fucose in Escherichia coli includes:

[0004] Glucose → glucose-6-phosphate → fructose-6-phosphate → mannose-6-phosphate → mannose-1-phosphate → GDP-mannose → GDP-4-keto-6-deoxymannose → GDP-L-fucose.

[0005] There are currently two ways to enhance gene expression: one is to insert the target gene sequence to increase the copy number of the target gene, but this method will reduce the enhancement effect of bacteria; the other is to add a strong promoter in front of the gene for synthesizing the catalytic reaction enzyme to enhance the expression of the gene. Common promoters for enhanced expression include T7 promoter, J23119 promoter, etc. However, due to the strong expression of the strong promoter, the non-essential genes after the target gene are often enhanced, causing bacteria to consume a lot of energy on non-essential genes, which brings a burden to bacterial growth and affects the normal growth of bacteria. In turn, in subsequent fermentation, the bacteria may express lower target products and reduce yields. This is a problem that cannot be ignored for genetic modification aimed at increasing GDP-L-fucose. Summary of the invention

[0006] The purpose of the present invention is to solve the above-mentioned deficiencies in the prior art and provide a genetically engineered bacterium for increasing the production of GDP-L-fucose.

[0007] Technical Solution

[0008] The manB gene is a gene that exists in Escherichia coli. The manB gene mainly synthesizes mannanase, which can synthesize mannose-6-phosphate into mannose-1-phosphate. The manC gene is responsible for synthesizing GDP-mannose pyrophosphorylase, which combines mannose-1-phosphate with GTP to synthesize GDP-mannose. These two synthesis processes are one of the key steps in synthesizing GDP-L-fucose. In order to improve the expression of the manB gene and the manC gene, the inventor provides a strong promoter for increasing the expression of the manB gene and the manC gene at the front end of the manB gene, increasing the expression of the subsequent manB and manC genes, thereby improving the synthesis of subsequent products. Considering that the expression of subsequent genes at the manB and manC gene sites is not required when synthesizing GDP-L-fucose, a terminator is inserted after the manB and manC genes to end the expression of subsequent genes and reduce the decomposition and consumption of GDP-L-fucose caused by the expression of subsequent genes in Escherichia coli. On the other hand, since the undecenyl glucose phosphate phosphotransferase synthesized by the wcaJ gene converts GDP-L-fucose into colanic acid, this will greatly reduce the amount of L-fucose synthesized with GDP-L-fucose as the material, which is not conducive to the synthesis of L-fucose by Escherichia coli. Therefore, the inventors considered knocking out the wcaJ gene, or reducing the expression of the wcaJ gene, to reduce other consumption pathways of GDP-L-fucose. The specific scheme is as follows:

[0009] A genetically engineered bacterium for increasing GDP-L-fucose production: using Escherichia coli as a starting strain, knocking out a gene wcaJ encoding undecenyl glucose phosphate phosphotransferase, and inserting a terminator at the same time, to obtain a genetically engineered bacterium for increasing GDP-L-fucose production; the nucleotide sequence of the gene wcaJ encoding undecenyl glucose phosphate phosphotransferase is shown in SEQ ID NO.1.

[0010] Furthermore, the knockout of the undecenyl glucose phosphotransferase encoding gene wcaJ is achieved by adopting the CRISPR-Cas9 gene editing method.

[0011] Furthermore, the terminator is a λ-TL3 terminator, and the nucleotide sequence is shown in SEQ ID NO.3.

[0012] Furthermore, the starting strain is selected from BL21, JM109, JM109(DE3), BL21(DE3), K12 or MG1655.

[0013] The application of the above-mentioned genetically engineered bacteria for increasing GDP-L-fucose production in the fermentation production of GDP-L-fucose.

[0014] The method for constructing the above-mentioned genetically engineered bacteria for improving GDP-L-fucose production is as follows: first, a plasmid for knocking out wcaJ is constructed, and then a terminator is inserted into the expressed manC gene, and the target plasmid is constructed after the site is determined, and then the successfully constructed plasmid is sequenced to ensure that there are no base problems on the plasmid. After the plasmid is completely constructed, the plasmid is electroporated into the strain to be constructed, and finally identified.

[0015] Beneficial effects of the present invention:

[0016] Compared with other constructed strains, the engineered strain of the present invention blocks the expression of subsequent non-essential genes, greatly reduces the strain's consumption of too much material and energy in other pathways, reduces the strain's survival pressure, and allows the strain to focus a lot of energy on synthesizing the target product GDP-L-fucose, thereby increasing the yield of GDP-L-fucose. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the plasmid map of the target plasmid 318-JC2KR.PTD (BLD) constructed in Example 1. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0019] It should be noted that in the following embodiments, the experimental techniques and methods used, unless otherwise specified, are conventional technical methods in the field; the materials, reagents, etc. used, unless otherwise specified, can be obtained through regular commercial channels.

[0020] 1) In the following examples, the strain used was E. coli BL21 (DE3), the plasmid replication strain used was E. coli DH5α purchased from Vidi Biotechnology, and the pTarget plasmid and pCasM plasmid used were purchased from Biowind Company. However, they are not limited thereto.

[0021] 2) In the following examples, the primers and sequences used are shown in Table 1:

[0022] Table 1

[0023]

[0024] In Table 1, all primer synthesis and sequencing work were completed by Suzhou Genewise Co., Ltd.

[0025] 3) In the following examples, the culture medium and formulation involved are as follows:

[0026] LB solid medium: 10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride, 15 g / L agar powder.

[0027] LB liquid medium: 10 g / L peptone, 5 g / L yeast extract powder, 10 g / L sodium chloride.

[0028] Fermentation medium: anhydrous glucose 20g / L, KH2PO4 13.5g / L, (NH4)2HPO4 4.0g / L, monohydrated citric acid 1.7g / L, MgSO4·7H2O 1.4g / L, thiamine 4.5mg / L and trace elements 1% (v / v), pH adjusted to 6.8 with sodium hydroxide; wherein glucose is sterilized separately and then added, and the trace element solution: FeSO4·7H2O 10g / L, ZnSO4·7H2O 2.2g / L, CuSO·5H2O 1.0g / L, MnSO4·H2O 0.38g / L, Na2B4O7·10H2O 0.02g / L, (NH4)6Mo7O 24 0.1g / L and CaCl2 2.0g / L, dissolved in 5M hydrochloric acid.

[0029] Example 1

[0030] A method for constructing a genetically engineered bacterium for increasing GDP-L-fucose production comprises the following steps:

[0031] (1) The wcaJ gene sequence was searched according to the E. coli BL21 (DE3) information published in the NCBI database (the wcaJ gene sequence is shown in SEQ ID No: 1). According to the sequence information of the wcaJ gene, the replaced N20 sequence (N20-1 is CAATGCATCGTTAATCTCTA, N20-2 is CGCTGGTCTTTGGTGAGAAG) was determined and primers were designed. The pTargetF plasmid was used as a template and PCR amplification was performed using primers pTS-CP-F / R and JC2BF-N20U1 / N20L1. After obtaining the linear plasmid, it was connected with Gibson Assembly Master Mix connection liquid purchased from Sangon Biotechnology, and then transformed into DH5a competent cells, and coated with LB solid plates containing 50 μg / mL spectinomycin and cultured in a 37°C incubator overnight. The next day, a single clone was selected and sequenced. The plasmid that successfully replaced the N20 sequence was the positive clone. The positive clone was selected and cultured and the plasmid was extracted to obtain the N20-318 plasmid;

[0032] (2) Using N20-318 plasmid as template and N20-CPF / R as primers, linearized N20-318 vector fragment was obtained by PCR amplification;

[0033] (3) Using the genome of E. coli BL21 as a template and JC2BF-HLU3 / 318-HL-CPR, 318-TerL-F / R, and 318-HR-CPF / JC2BF-HRL6 as primers, PCR amplification was performed to obtain the wcaJ upstream homology arm fragment (nucleotide sequence as shown in SEQ ID NO.4), the wcaJ downstream homology arm fragment (nucleotide sequence as shown in SEQ ID NO.5), and the λ-TL3 terminator;

[0034] (4) The linear fragments (linearized N20-318 vector fragment, wcaJ upstream homology arm fragment, wcaJ downstream homology arm fragment and λ-TL3 terminator) were connected by Gibson Assembly Master Mix and transformed into DH5a competent cells, and then coated with LB solid plates containing 50 μg / mL spectinomycin and cultured in a 37°C incubator overnight. The next day, single clones were selected for identification and sequencing. After successful sequencing, the target plasmid 318-JC2KR.PTD (BLD) was extracted. The plasmid map of the target plasmid is shown in Figure 1 ;

[0035] (5) When the OD value of the E. coli background strain reaches 0.8, add 50 μg / mL kanamycin and 10 mmol arabinose to induce for 4 hours to prepare an electroporation competent state, transfer the target plasmid in step (4) into the electroporation competent state, and coat the electroporated strain on an LB solid plate containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin, culture at 30°C overnight, and select single clones for PCR identification the next day to select the correct positive single clones;

[0036] (6) The positive monoclonal clone was inoculated into kanamycin LB liquid medium (kanamycin concentration was 50 μg / mL), induced with IPTG at a final concentration of 1 mmol / L, and then streaked to identify the elimination of the pTargetF plasmid. The monoclonal clone that had eliminated the pTargetF plasmid was selected and inoculated into antibiotic-free LB liquid medium and cultured overnight at 42°C. The clone was then streaked onto an antibiotic-free plate to identify the elimination of the pCas plasmid. After successful identification, the genetically engineered bacteria with increased GDP-L-fucose production were obtained, made into a glycerol strain and named strain B, and stored in a -80°C refrigerator.

[0037] In the above construction method, the reaction system of PCR amplification involved is:

[0038]

[0039] The PCR reaction program was as follows: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 30 s, annealing at 50°C for 15 s, extension at 72°C for 30 s, 25 cycles, extension at 72°C for 5 min, and storage at 4°C.

[0040] The strain B constructed in Example 1 was used to ferment and prepare GDP-L-fucose, and compared with the strain A (E. coli BL21 (DE3)) before editing, and the method was as follows:

[0041] Two groups of identical fermentation equipment were used for strain fermentation, marked as group A (E. coli BL21 (DE3)) and group B (strain B), strain A and strain B were inoculated into 70 mL of fermentation medium at a ratio of 1:100, respectively, and cultured at 37°C for 8 hours. The OD value of the bacterial solution was measured using a spectrophotometer. When the OD value was about 0.5, it was inoculated into a 1.5 L fermentation tank containing the fermentation medium that had been added and sterilized together. Within 8 hours after inoculation, the strain was not fed, and feeding began after 8 hours. The two strains needed to use the same fermentation operation to ensure that they had the same physiological state. During this process, 37°C was maintained. Fermentation: When the OD value of the fermentation reaches 60, the temperature is adjusted to 30°C. Then, when the OD value reaches 80 (maintaining 30°C for at least 1 hour), 80g of lactose (lactose addition amount is 200mL, 0.4g / mL) is added, and the final concentration is 20g / L. The inducer IPTG (isopropyl-β-D-thiogalactoside) is 8mL (0.1M), and the final concentration is 0.2mM. When the fermentation reaches 60 hours, the fermentation liquid in the fermenter is about 4L. The GDP-L-fucose content of group A and group B is detected by high performance liquid chromatography.

[0042] Detection method:

[0043] 1) Sample treatment: Centrifuge (12000r / min, 5min) and take the supernatant for HPLC determination.

[0044] 2) HPLC detection: The supernatant was analyzed by a high performance liquid chromatography (HPLC) system (Agilent Technologies) and an Inertsil ODS-SP column, with an ultraviolet wavelength of 254 nm and a flow rate of 0.6 mL / min. The gradient elution process was as follows: first elution with 100% (v / v) mobile phase A for 10 min; then elution with mobile phase B at a gradient change of 0%-50% (v / v) for 10 min; mobile phase B was then eluted with a gradient of 50%-0% (v / v) for 5 min; and finally elution with 100% (v / v) mobile phase A for 25 min; wherein mobile phase A was 20 mmol / L triethylamine acetate buffer; mobile phase B was a mixture of acetonitrile and 20 mmol / L triethylamine acetate buffer in a volume ratio of 3:22.

[0045] Test results:

[0046] The GDP-L-fucose content of group A was 0.9 mg / L, while that of group B was 11.4 mg / L. This shows that after knocking out the wcaJ gene and inserting a terminator that prevents strong expression, the GDP-L-fucose content increased significantly.

[0047] Sequence Listing

[0048] SEQ ID NO.1

[0049] wxya

[0050]

[0051] cat

[0052] SEQ ID NO.2

[0053] man

[0054]

[0055] SEQ ID NO.3

[0056] λ-TL3 terminator

[0057] cgcatcctcacgataatatccgggtaggcgcaatcactttcgtctactccgttacaaagcgaggctgggtatttcccggcctttctgttatccgaaatccactgaaagcacagcggctggctgaggagataaataataaacgaggggctgtatgcacaaagcatcttctgttgagttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcaggtttgtgccaataccagtagSEQ ID NO.4

[0058] wcaJ upstream homologous arm fragment

[0059] Caccgttgatgtggtgactaccgcaggtggcaccccggtaatgtcgaaaaccggacacgcctttattaaagaacgtatgcgcaaggaagacgccatctacggtggcgaaatgagcgcccaccattacttccgtgatttcgcttactgcgacagcggcatgatcccgtggctgctggtcgccgaactggtgtgcctgaaagagaaaacgctgggcgaactggtacgcgaccggatggcggcgtttccggcaagcggtgagatcaacagcaaactggcgcaacccgttgaggcgattaaccgcgtcgaacagcattttagccgcgaggcgctggcggtggatcgcactgatggcatcagcatgacctttgccgactggcgctttaacctgcgcacctccaataccgaaccggtggtgcgcctgaatgtggaatcgcgcggtgatgtgccgctgatggaagcgcgaacgcgaactctgctgacgttgctgaacgagtaatgtcggatcttcccttaccccactgcgggtaaggggctaataacaggaacaacg

[0060] SEQ ID NO.5

[0061] Upstream homologous arm fragment of wcaJ

[0062] Gctgcaattgctgtgtgtggtggggctgctgcgctcagtggggaacccgattggctcgctgctgatggcgaaagcgcgggtcgatatcagctttaaattcaacgtattcaaaacctttatgtttattccggcgattgttattggtgggcagatggcgggcgcaatcggcgttacgcttggtttcctgctggtgcagattatcaacaccattctgagctatttcgtgatgattaaaccggtgctcggttccagttatcgtcagtacatcctgagtttgtggctgccgttttatctctcgctgccgacactggtggtcagttatgcgctgggcctattgctgaaagggcaactggcgctggggatgctgctggcggtgcaaatagccgcgggcgtgctggcgtttgtggtgatgattgtgctgtcgcgccatccgctggtggtggaagtgaagcgtcagttttgtcgcagcgaaaaaatgaaaatgcttttacgggcggggtgaatggctatccccgtaaggtcgtgcgcattttccccctcaccctaaccctctccccagggggcgaggggactgatcg

[0063] agcacagctttgaatatgtcac

[0064] SEQ ID NO.6

[0065] pTS-CP-F

[0066] gttttagagctagaaatagc

[0067] SEQ ID NO.7

[0068] pTS-CP-R

[0069] gctagcattatacctaggac

[0070] SEQ ID NO.8

[0071] JC2BF-N20U1

[0072] cctaggtataatgctagccaatgcatcgttaatctctagttttagagctagaaatagc

[0073] SEQ ID NO.9

[0074] JC2BF-N20L1

[0075] ctatttctagctctaaaccttctcaccaaagaccagcggctagcattatacctaggac

[0076] SEQ ID NO.10

[0077] N20-CPF

[0078] tctagaactagtctgcaggg

[0079] SEQ ID NO.11

[0080] N20-CPR

[0081] gaattcaatagatctaagct

[0082] SEQ ID NO.12

[0083] JC2BF-HLU3

[0084] gcttagatcttattgaattccaccgttgatgtggtgacta

[0085] SEQ ID NO.13

[0086] 318-HL-CPR

[0087] cgttgttcctgttatagcc

[0088] SEQ ID NO.14

[0089] 318-TerL-F

[0090] tataacaggaacaacgcgcatcctcacgaataatc

[0091] SEQ ID NO.15

[0092] 318-TerL-R

[0093] cacacagcaattgcagcctactggtattggcacaaac

[0094] SEQ ID NO.16

[0095] 318-HR-CPF

[0096] gctgcaattgctgtgtgtgg

[0097] SEQ ID NO.17

[0098] JC2BF-HRL6

[0099] cctgcagactagttctagagtgacatattcaaagctgtg

Claims

1. A genetically engineered bacterium for increasing GDP-L-fucose production, characterized in that: Using Escherichia coli as a starting strain, the gene wcaJ encoding undecenyl glucose phosphate phosphotransferase is knocked out and a terminator is inserted at the same time to obtain a genetically engineered bacterium with increased GDP-L-fucose production; the nucleotide sequence of the gene wcaJ encoding undecenyl glucose phosphate phosphotransferase is shown in SEQ ID NO.

1.

2. The genetically engineered bacteria for increasing GDP-L-fucose production according to claim 1, characterized in that: The knockout of the undecenyl glucose phosphotransferase encoding gene wcaJ is achieved by adopting the CRISPR-Cas9 gene editing method.

3. The genetically engineered bacteria for increasing GDP-L-fucose production according to claim 1, characterized in that: The terminator is the λ-TL3 terminator, and the nucleotide sequence is shown in SEQ ID NO.

3.

4. The genetically engineered bacteria for increasing GDP-L-fucose production according to claim 1, characterized in that: The starting strain is selected from BL21, JM109, JM109 (DE3), BL21 (DE3), K12 or MG1655.

5. Use of the genetically engineered bacteria for increasing GDP-L-fucose production according to claim 1, 2, 3 or 4 in the fermentation production of GDP-L-fucose.

Images