Coupled crisper and toxin-antitoxin elements and their use in killing drug resistant bacteria

Abstract

The application belongs to the field of genetic engineering, and specifically discloses a new sterilization method for realizing precise and efficient sterilization of drug-resistant bacteria by combining CRISPR and a toxin-antitoxin element coupled therewith. The application innovatively uses the guardian RNA element CreTA of CRISPR to improve the stability of the CRISPR-Cas element in the process of sterilizing drug-resistant bacteria, realizes the double sterilization effect of CRISPR and TA, and thus effectively improves the efficiency of the CRISPR sterilization technology in practical application.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a gene element and method for killing drug-resistant bacteria, and more particularly relates to a coupled CRISPR and toxin-antitoxin element and its application in killing drug-resistant bacteria. BACKGROUND

[0002] The abuse of antibiotics leads to the frequent generation of drug-resistant bacteria, which has become one of the most serious threats to global life and health. With the development of new antibiotics entering the bottleneck period, humans urgently need to develop new bactericidal technologies, especially for killing drug-resistant bacteria, to control the spread of drug resistance. CRISPR-Cas is a specific immune system for bacteria to defend against phage infection. Cas protein, guided by crRNA (CRISPR RNA), recognizes and cuts phage DNA based on the sequence matching between the two, thereby achieving specific immunity. By modifying the base sequence of crRNA, one can reprogram the DNA cutting targeting of Cas protein, for example, to specifically cut bacterial genomic sequences, which can achieve the killing of bacteria, known as CRISPR bactericidal technology (Robert J Citorik et al., Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Nov;32(11):1141-5; David Bikard et al., Exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials. Nat Biotechnol. 2014 Nov;32(11):1146-50).

[0003] CRISPR bactericidal technology has high specificity, for example, by designing guide RNA (gRNA, an artificial analog of crRNA) to target the cutting of specific drug-resistant genes, it can achieve specific killing of drug-resistant bacteria, and has no killing effect on bacteria without the drug-resistant gene. The abuse of antibiotics often brings selective pressure to the bacterial community, which further promotes the generation and prevalence of drug-resistant bacteria; while using CRISPR bactericidal technology can specifically kill drug-resistant bacteria in the bacterial community, thereby promoting the "occupation" of non-drug-resistant bacteria to the ecological niche, effectively curbing the spread of drug-resistant bacteria, therefore, CRISPR bactericidal technology provides an important solution to the problem of drug resistance. However, due to the abuse of antibiotics and their residues in the soil, hospital and other environments, drug-resistant genes undoubtedly give bacteria an evolutionary advantage in selection, combined with the "fitness cost" brought by CRISPR killing itself, microorganisms tend to lose or destroy CRISPR-Cas elements, for example, using various active transposable elements to destroy cas genes, or using widely existing anti-CRISPR proteins to inactivate CRISPR-Cas complexes, these factors cause the instability of CRISPR-Cas elements, and greatly reduce the killing efficiency of CRISPR technology on drug-resistant bacteria, therefore, the stability of CRISPR-Cas elements is a key factor limiting the effect of CRISPR bactericidal technology (Ruben V Uribe et al., Bacterial resistance to CRISPR-Cas antimicrobials. Sci Rep. 2021 Aug 26; 11(1): 17267).

[0004] As mentioned above, the stability of CRISPR-Cas elements is an important factor limiting the efficiency of CRISPR bactericidal technology. In 2015, Israeli scientist Udi Qimron proposed a strategy of jointly using CRISPR-Cas elements and virulent phages (see Figure 7), i.e. inserting the target sequence of gRNA (a sequence of drug-resistant gene) into an artificial lytic phage, so that the gRNA targets the drug-resistant gene at the same time as targeting the phage DNA, so that when the CRISPR-Cas element is delivered to the bacterial community and the lytic phage is introduced again, the latter will infect and kill those bacterial individuals that retain the drug-resistant gene and destroy the CRISPR-Cas element, thereby providing an evolutionary driving force for improving the stability of the CRISPR-Cas element in the bacterial community (Ido Yosef et al., Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria. Proc Natl Acad Sci U S A. 2015 Jun 9; 112(23):7267-7272.). However, this technology has many limitations in practical application.

[0005] First of all, it is necessary to screen available lytic phages for the target drug-resistant strains to be eliminated, and since phages often have high host specificity, i.e. the infection ability of different strains in the same species is very different, which seriously limits the practical application of this technology in complex natural bacterial community.

[0006] Secondly, the lytic phage needs to be artificially modified (inserting part of the sequence of the drug-resistant gene as the target of gRNA) to enable it to be targeted by the gRNA targeting the drug-resistant gene, which requires the design of different combined phages for different drug-resistant genes, lacking universality (Ido Yosef et al., Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria. Proc Natl Acad Sci U S A. 2015 Jun 9; 112(23): 7267-7272.).

[0007] Thirdly, it is necessary to prepare the combined lytic phage at the same time as preparing the CRISPR-Cas element delivery vector (chronic phage or binding plasmid, etc.), which is complicated in operation process, and there is often competition between phages, and the chronic phage used to deliver the CRISPR-Cas element may affect the infection efficiency of the lytic phage.

[0008] Therefore, the CRISPR elimination strategy combined with lytic phage has poor universality and is complicated in molecular design and operation. SUMMARY

[0009] The present inventors have found that many type I CRISPR-Cas systems are associated with a chaperone RNA element, CreTA, which is a pair of toxin (creT) and antitoxin (creA) genes. The latter produces a crRNA-like molecule (called CreA RNA) that can guide the CRISPR effector to bind at the promoter DNA of the creT toxin gene (without DNA cleavage), thereby inhibiting the transcription of the toxin gene. Thus, once the CRISPR effector is disrupted, the creT toxin gene is expressed and kills the bacteria, making the bacteria "addicted" to the CRISPR-Cas element and improving its stability in the bacterial community. The discovery of the CRISPR chaperone RNA is considered to define a completely new type of toxin-antitoxin (TA) and is named type VIII. Importantly, CreTA is often a pair of non-coding small RNAs with very short gene sequences (about 200-300 bp in total), which are very easy to synthesize and design.

[0010] On this basis, the present application proposes a new strategy of combining CRISPR with this new TA element to improve the stability of CRISPR-Cas elements in the bacterial community and achieve the dual effect of CRISPR sterilization and TA sterilization. The strategy is verified by an example of Acinetobacter baumannii, which is the most serious drug-resistant problem in clinical practice. Compared with the phage combination strategy, this strategy only needs to embed the small CreTA element in the delivered CRISPR-Cas element to significantly improve its stability, without the need for tedious processes such as screening and modifying phages for target bacterial strains. Moreover, the CreTA-mediated "addiction" circuit is independent of gRNA and its target gene, so it is suitable for CRISPR sterilization design against multiple drug-resistant genes. In summary, the method of combining CRISPR and toxin-antitoxin for precise and efficient sterilization of drug-resistant bacteria provided by the present application has higher operability and universality.

[0011] The pCRETA plasmid carries a cas3-csy operon encoding Cas protein, a mini-CRISPR structure with two spacers, and a toxin gene (creT). One spacer sequence of the mini-CRISPR is the ψS sequence of creA, which matches the promoter of creT, and the resulting crRNA directs the Csy complex to inhibit the expression of the creT toxin gene; the other spacer sequence targets an antibiotic-resistant gene (AR) on the genome of a clinically drug-resistant strain. After the plasmid is introduced into the drug-resistant bacteria by transformation, conjugation, or nanoparticles, etc., if the Csy complex functions normally, it will produce a CRISPR bactericidal effect with the assistance of Cas3, i.e., cutting the AR gene, resulting in the death of the bacteria or (after the DNA repair process) the loss of the AR gene; if the Csy complex is destroyed and inactivated by transposons or anti-CRISPR proteins, etc., the toxin gene will be expressed to produce a TA bactericidal effect.

[0012] The present application provides a coupling element composed of a toxin element and an anti-toxin element, wherein the two are directly connected together, or are not connected together but combined to form the element. The toxin element contains a promoter sequence (for example, the promoter can be a commonly used tac promoter or J23119 promoter sequence, preferably a PcreT promoter), an SD sequence, and a mini-ORF toxin sequence element, for expressing a toxin; the anti-toxin element contains a PcreA promoter sequence (for example, the promoter can be a commonly used tac promoter or J23119 promoter sequence, preferably a PcreA promoter) and a mini-CRISPR-like structure (for example, the first repeat sequence in d can not be conserved but has a conserved stem-loop structure, and the second repeat sequence and structure are very conserved), which can produce CreA RNA after transcription processing. Figure 2 d

[0013] The promoter sequence can be replaced, as long as the corresponding ψS sequence of creA is also replaced to have a promoter function.

[0014] Specifically, the toxin element and the anti-toxin element are directly connected, or are separately coupled to form the element at different positions of the same vector, or are separately coupled to form the element on different vectors. The toxin element can also be any toxin element as long as it can express a toxin, for example, it can be other protein toxins or RNA toxins, such as commonly used MazF, ccdB protein, preferably creT .

[0015] Preferably, the nucleotide sequence of the toxin element is as shown in SEQ ID NO: 1:

[0016] TACTTAGTAATGATAAGTCTTTTTATTTTACATAGAAATAGCTTGTGGAATAAAAGAAAAATCTGTATTTTACTTGTTATGGTTACTTTTAGTTTGAATTAAAGTAACTAGGTTTAATATTTAAATAAAGATTAACCATCGATCTGGCAGGATCACACATCACCCGATAGGGTAAGGGGGAAATAATGTTTAGCACGCATTTAATCAGAAGGGTCTGA

[0017] The sequence of the PcreT promoter is as follows:

[0018] TACTTAGTAATGATAAGTCTTTTTATTTTACATAGAAATAGCTTGTGGAATAAAAGAAAAATCTGTATTTTACTTGTTATGGTTACTTTTAGTTTGAATTAAAGTAACTAGGTTTAATATTTAAATAAAGATTAACCATCGATCTGGCAGGATCACACATCACCCGATAGGG

[0019] The sequence of the SD sequence and mini-ORF toxin sequence element is as follows:

[0020] TAAGGGGGAAATAATGTTTAGCACGCATTTAATCAGAAGGGTCTGA

[0021] The nucleotide sequence of the antitoxin element is shown as SEQ ID NO: 2:

[0022] ATACAGATTTTTCTTTTATTCCACAAGCTATTTCTATGTAAAATAAAAAGACTTATCATTACTAAGTAAGGCACTACCATAAAGGTAGCTTAGAAATAGTTCCTTTTATTCAATCTGTTCATGGCGGCATACGCCATTTAGAAA.

[0023] The sequence of the PcreA promoter is as follows:

[0024] ATACAGATTTTTCTTTTATTCCACAAGCTATTTCTATGTAAAATAAAAAGACTTATCATTACTAAGTA

[0025] The sequence of the mini-CRISPR-like structure is as follows:

[0026] AGGCACTACCATAAAGGTAGCTTAGAAATAGTTCCTTTTATTCAATCTGTTCATGGCGGCATACGCCATTTAGAAA.

[0027] The application also provides a coupled CRISPR-Cas and toxin-antitoxin combined element, which comprises a mini-CRISPR structure element targeting drug resistance genes and a coupled toxin-antitoxin element from the Acinetobacter baumannii AYE strain. cas3 The gene and four csy The gene elements, the mini-CRISPR structure element containing the spacer targeting drug resistance genes, and the coupled toxin-antitoxin element are composed of cas The gene element, the mini-CRISPR structure element containing the spacer targeting drug resistance genes, and the coupled toxin-antitoxin element are composed of

[0028] Specifically, the mini-CRISPR structure element containing the spacer targeting drug resistance genes can express crRNA targeting drug resistance genes alone as shown in SEQ ID NO: 6, or form a bifunctional mini-CRISPR structure containing double spacers by fusion with an antitoxin element.

[0029] Preferably, the bifunctional mini-CRISPR structure containing double spacers is connected with the spacer targeting drug resistance genes and the repeat sequence after the antitoxin element to form a double spacer mini-CRISPR structure as shown in SEQ ID NO: 4, the front spacer is the ψS sequence of creA to produce CreA RNA, and the rear spacer is the spacer targeting drug resistance genes to produce crRNA targeting drug resistance genes. The ψS sequence is a 20bp sequence after CC in the corresponding promoter sequence, or a reverse complementary sequence of 20bp before GG.

[0030] Preferably, the repeat sequence is GTTCATGGCGGCATACGCCATTTAGAAA.

[0031] The ψS sequence is TAGTTCCTTTTATTCAATCT.

[0032] The spacer targeting drug resistance genes requires a 32-34bp sequence after CC in the drug resistance genes, preferably the drug resistance genes are drug resistance genes of carbapenems, and specifically are multiple drug resistance clinical Acinetobacter baumannii strains oxa23 such as drug resistance genes mcr-1, NDM-1, OXA51, etc.

[0033] More preferably, the nucleotide sequence of the genetic element is as set forth in SEQ ID NO: 3, and the nucleotide sequence of the mini-CRISPR structural element containing the spacer targeting the drug resistance gene is as set forth in SEQ ID NO: 6. cas More preferably, the nucleotide sequence of the genetic element is as set forth in SEQ ID NO: 3, and the nucleotide sequence of the mini-CRISPR structural element containing the spacer targeting the drug resistance gene is as set forth in SEQ ID NO: 6.

[0034] The present application further provides a derivative plasmid containing the coupled CRISPR and toxin-antitoxin combination element.

[0035] Preferably, the shuttle plasmid is of E. coli or Acinetobacter, preferably pMo130TFR as the starting plasmid, and more preferably, the complete nucleotide sequence is as set forth in SEQ ID NO: 5.

[0036] The present application also provides a recombinant bacterium, preferably of E. coli or Acinetobacter, containing the coupled CRISPR and toxin-antitoxin combination element, or the derivative plasmid.

[0037] The present application also provides a recombinant bacteriophage, preferably lysogenic or virulent, containing the coupled CRISPR and toxin-antitoxin element integrated into the genome, more preferably, an Acinetobacter bacteriophage.

[0038] The present application further provides the use of the derivative plasmid, or the recombinant bacteriophage, in the killing of drug resistance genes, preferably delivering the CRISPR-Cas element into multi-drug resistant bacteria, more specifically, by conjugative transfer, phage infection, nanoparticle embedding, for sequence-specific killing.

[0039] Preferably, the killing is performed by natural conjugative transfer into drug resistant bacteria by applying the recombinant bacterium containing the derivative plasmid to the target environment; or by natural phage infection into drug resistant bacteria by applying the recombinant bacteriophage to the target environment; or by nanoparticle embedding into drug resistant bacteria by preparing nanoparticles and applying them to the target environment.

[0040] The application provides a new bactericidal method for precise and efficient killing of drug-resistant bacteria by combining CRISPR and its coupled toxin-antitoxin (TA) element, i.e., CRISPR guardian RNA CreTA. The method can produce double bactericidal effects of CRISPR and TA by introducing the CreTA element (which has cell toxicity inhibited by the CRISPR-Cas system) into the CRISPR-Cas element used for bacterial killing: when the CRISPR-Cas element normally functions, its cutting effect on the target DNA sequence on the bacterial genome can cause the death of bacteria, producing a CRISPR bactericidal effect; and when the CRISPR-Cas element is destroyed by an active transposable element or anti-CRISPR protein, the expression of the toxin gene (creT) of CreTA is released, producing a TA bactericidal effect. This combined technology greatly improves the stability and bactericidal efficiency of the CRISPR-Cas bactericidal element. Since the gene sequence of the CreTA element is very simple (about 200-300 bp), it is easy to synthesize and integrate design, and the gene circuit of its coupled CRISPR-Cas element is independent of the target gene of CRISPR killing and factors such as virulent bacteriophages, therefore, compared with the most advanced CRISPR bactericidal technology combined with virulent bacteriophages in the world (Ido Yosef et al., Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria. Proc Natl Acad Sci U S A. 2015 Jun 9; 112(23): 7267-7272.), it has higher universality and operability.

[0041] Therefore, the application innovatively uses the guardian RNA element (CreTA) of CRISPR to improve the stability of the CRISPR-Cas element in the process of killing drug-resistant bacteria, realizes the double bactericidal effect of CRISPR and TA, and thus effectively improves the efficiency of the CRISPR bactericidal technology in practical application. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 Principle of double bactericidal effect of combined CRISPR and CreTA.

[0043] Figure 2 Bioinformatics analysis of the creTA element in different bacilli.

[0044] Figure 3The creTA element of Acinetobacter WCHA45 was replaced by repeat to adapt to the CRISPR-Cas system of Acinetobacter baumannii AYE.

[0045] Figure 4 Induced expression of CreT toxin in Acinetobacter baumannii model strain AYE (a) and clinical strains (b).

[0046] Figure 5 Improving the bactericidal efficiency of CRISPR elements on Acinetobacter baumannii model strain by creTA.

[0047] Figure 6 Improving the bactericidal efficiency of CRISPR elements on Acinetobacter baumannii model strain by creTA.

[0048] Figure 7 Udi Qimron, an Israeli scientist, proposed a strategy of combining CRISPR-Cas elements and virulent phages. DETAILED DESCRIPTION

[0049] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with the drawings and examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application.

[0050] Example 1 Prediction of creTA element in Acinetobacter

[0051] All existing genome sequences of Acinetobacter were downloaded from NCBI database, and the I-F type cas operon with intergenic region was screened out. It was found by analyzing that there was a relatively conservative sequence in the cas operon of three strains of Acinetobacter WCHA45, LoGeW2-3 and ANC3789 (between cas3 and csy1 genes), which contained two CRISPR repeat-like sequences, ψR1 and ψR2. Figure 2 a and Figure 2 b in the middle). The ψR2 sequence is very conservative, with a palindrome sequence "CTGCCNNNNNGGCAG" almost identical to the CRISPR repeat, indicating that they have a conservative secondary stem-loop structure at the RNA level. Figure 2 c). Although the ψR1 sequence has large differences, the last 8 bases (equivalent to the 5'-handle of crRNA) are very conservative and basically identical to the CRISPR repeat (5'-CTTAGAAA-3'), and each carries a pair of palindrome sequences, which can form the same stem-loop structure as ψR2 and CRISPR repeat at the RNA level. Figure 2The sequence information above indicates that ψR1, ψR2 and the sequence between them, ψS, is a highly degenerated mini-CRISPR structure, which is consistent with the sequence characteristics of creA gene. Further analysis indicates that the respective ψS sequence of the three strains has a corresponding target sequence on the upstream of the creA gene, i.e. there is a sequence of about 20 bp similar to ψS beside the PAM (the PAM of I-F type CRISPR system is 5'-CC-3') (underlined in the middle b). Figure 2 The sequence information above is consistent with the characteristics of creTA toxin-antitoxin element. Therefore, we guess that the sequence upstream of the creA gene (between creA and csy1) may contain an unknown creT toxin gene, and creA can guide the Csy complex to inhibit the transcription of creT gene based on the base matching of ψS and the target.

[0052] Example Two Function Test and Optimization of creTA Element of Acinetobacter baumannii WCHA45

[0053] To verify the above guess, four DNA fragments were synthesized based on the creTA sequence of WCHA45 (a) and were respectively connected to the pMo130TFR vector after being cut by restriction enzymes. Figure 3 The middle a) contains the original DNA sequence of WCHA45 creTA (i.e. the intergenic sequence between cas3 and csy1), and the corresponding recombinant plasmid is named as p45TA.

[0054] The middle a) contains the original DNA sequence of WCHA45 creTA (i.e. the intergenic sequence between cas3 and csy1), and the corresponding recombinant plasmid is named as p45TA.

[0055] According to the recent unpublished research results, replacing the repeat sequence can improve the adaptability of heterologous CreTA and CRISPR-Cas. Therefore, in order to improve the functional matching of WCHA45-derived creTA and Csy complex in AYE strain, we also constructed fragment 3 and fragment 4:

[0056] The middle a) contains the original DNA sequence of WCHA45 creTA (i.e. the intergenic sequence between cas3 and csy1), and the corresponding recombinant plasmid is named as p45TA.

[0057] The middle a) contains the original DNA sequence of WCHA45 creTA (i.e. the intergenic sequence between cas3 and csy1), and the corresponding recombinant plasmid is named as p45TA.

[0058] The middle a) contains the original DNA sequence of WCHA45 creTA (i.e. the intergenic sequence between cas3 and csy1), and the corresponding recombinant plasmid is named as p45TA.

[0059] The pMo130TFR empty vector and the vector carrying the above-mentioned fragment were respectively electroporated into the Bauman AYE strain, and their cytotoxicity was evaluated by transformation efficiency Figure 3 Mid b).

[0060] a) In three repeated experiments of electroporation of the pMo130TFR empty vector into the AYE strain, the transformation efficiencies were 113840, 60714, and 81696 CFU / μg, respectively;

[0061] b) In three repeated experiments of transformation of the p45T into the AYE strain, the transformation efficiencies were 0, 0, and 0 CFU / μg, respectively, which was 5 orders of magnitude lower than the empty vector, indicating that the predicted WCHA45 creT gene indeed produced cytotoxicity;

[0062] c) In three repeated experiments of transformation of the p45TA into the AYE strain, the transformation efficiencies were 0, 0, and 0 CFU / μg, respectively, indicating that the unmodified WCHA45 creA gene could not inhibit the toxicity of the corresponding creT gene in the AYE strain;

[0063] d) In three repeated experiments of transformation of the p45TAR1 into the AYE strain, the transformation efficiencies were 491, 424, and 366 CFU / μg, respectively, which was 2-3 orders of magnitude lower than the empty vector, but 2-3 orders of magnitude higher than p45T and p45TA, indicating that after the ψR1 was replaced with the CRISPR repeat sequence of the Acinetobacter baumannii AYE strain, the WCHA45 creA gene could partially inhibit the toxicity of the corresponding creT gene;

[0064] e) In three repeated experiments of transformation of the p45TAR2 into the AYE strain, the transformation efficiencies were 44642, 81696, and 57589 CFU / μg, respectively, which was basically equivalent to the transformation efficiency of the empty vector; indicating that after the ψR2 was replaced with the CRISPR repeat sequence of the Acinetobacter baumannii AYE strain, the WCHA45 creA gene could completely inhibit the toxicity of the corresponding creT gene.

[0065] According to the creTA research of the present inventor in Halobacterium salinarum (Ming Li et al., Toxin-antitoxin RNA pairs safeguard CRISPR-Cas systems. Science. 2021 Apr 30; 372(6541): eabe5601.), it is speculated that WCHA45 creA guides the CRISPR effector (i.e. Csy complex) to inhibit its toxicity by inhibiting the transcription of creT gene. To verify this guess, p45T and p45TAR2 were used to electrotransform AYE csy complex deletion mutant (deletion of csy1-4 four genes, named Δcsy) respectively.

[0066] In three repeated experiments of electrotransforming Δcsy strain with pMo130TFR empty vector, the transformation efficiency was 81748, 53532, 109294 CFU / μg respectively;

[0067] In three repeated experiments of electrotransforming Δcsy strain with p45T, the transformation efficiency was 0, 0, 0 CFU / μg respectively, which was 5 orders of magnitude lower than that of the empty vector;

[0068] In three repeated experiments of electrotransforming Δcsy strain with p45TAR2, the transformation efficiency was 0, 0, 0, which was 5 orders of magnitude lower than that of the empty vector, indicating that the inhibition of WCHA45 creA on its corresponding toxin gene needs the participation of AYE Csy complex.

[0069] In summary, by replacing ψR2 with the CRISPR repeat sequence of AYE strain of Acinetobacter baumannii, WCHA45 creA genes can completely inhibit the toxicity of the corresponding creT genes in AYE strain, and this process needs the joint participation of AYE strain Csy complex. This means that the modified WCHA45 creTA can interact with the CRISPR-Cas system of AYE strain, the latter regulates the cell toxicity of the former, and the former makes the bacterial cell "addicted" to the CRISPR-Cas system, and once the CRISPR-Cas system is destroyed, the expression of toxin gene creT will be released, killing the bacterial cell.

[0070] Example Three CreT toxin has a general bactericidal effect on Acinetobacter baumannii

[0071] Based on the analysis of creTA sequences in Acinetobacter baumannii WCHA45, LoGeW2-3 and ANC3789 three strains (Ming Li et al., Toxin-antitoxin RNA pairs safeguard CRISPR-Cas systems. Science. 2021 Apr 30; 372(6541): eabe5601.), it is found that the toxin gene creT of the three strains is highly conserved, and the sequence of the toxin gene creT of WCHA45 is as follows: Figure 2In the middle b), it was found that the possible toxin gene creT has a conserved open reading frame (ORF). This ORF is very short, only 11 codons (including start and stop codons), and has a purine-rich SD (Shine-Dalgarno) sequence upstream of it Figure 2 It is thus speculated that this mini-ORF and SD sequence are the core elements of its creT toxin.

[0072] To verify this speculation, the inventors constructed two derivative plasmids pLac and pLacT based on pMo130TFR Figure 4 a). pLac carries the lacI gene controlled by the lacI Q promoter, while pLacT, in addition to the above elements, also carries the core elements of the creT toxin (including the SD sequence and the mini-ORF) controlled by the tac promoter, with a lac operator sequence designed between the two to enable the tac promoter to be inhibited by the LacI protein.

[0073] After transforming the two plasmids into the AYE strain of Acinetobacter baumannii, the transformants were inoculated into fresh liquid LB medium (potassium sulfite was added to provide selective pressure for the plasmid), and cultured until the stationary phase, then IPTG was added to induce the expression of the toxin CreT. At 0, 0.5, 1, 2, 4, and 6 hours after the start of induction, the bacterial solution was collected in turn, and 0.5 μL of each was taken for gradient dilution and then plated on LB plates containing IPTG and LB plates not containing IPTG (containing potassium sulfite).

[0074] On the LB plates containing IPTG, the AYE strain carrying the pLac plasmid grew normally, while the AYE strain carrying the pLacT plasmid could not grow Figure 4 In the middle a), it is shown that under the induction conditions, the core elements of creT controlled by the tac promoter indeed produce cytotoxicity.

[0075] On the LB plates not containing IPTG, the AYE strain carrying the pLac plasmid grew normally, while compared with it, the AYE strain carrying the pLacT plasmid had a decreasing number of colony-forming units (CFU) with the sampling time after IPTG induction Figure 4 In the middle a), after 6 hours of IPTG induction, the CFU decreased by about 5 orders of magnitude, indicating that the AYE strain carrying the pLacT in the liquid medium died in large numbers, indicating that CreT from WCHA45 is a bacteriocidal toxin.

[0076] Subsequently, the pLacT plasmid was transformed into 23 strains of multi-drug resistant clinical Acinetobacter baumannii Figure 4In the middle b), it was found that the transformants of them all could grow on LB plates without IPTG (potassium sulfite was added to provide selective pressure for plasmid), but could not grow on LB plates with IPTG (potassium sulfite was added at the same time to provide selective pressure for plasmid), indicating that the CreT toxin of WCHA45 could produce cytotoxicity in clinical Acinetobacter baumannii strains.

[0077] Example Four creTA Element Enhances the CRISPR Elimination Efficiency of Multidrug-resistant Bacteria

[0078] Next, the effect of the creTA element on the CRISPR elimination efficiency of multidrug-resistant Acinetobacter baumannii model strain AYE was tested. First, the modified WCHA45 creTA element (ψR2 was replaced by the CRISPR repeat sequence of the AYE strain) was inserted between cas3 and csy1 of the AYE strain, and the constructed strain was called AYE-TA (AYE-pWCHA45-creTA). Figure 5 In the middle a), a mini-CRISPR DNA sequence (as shown in SEQ ID NO: 6) containing two CRISPR repeats (marked in bold) and one spacer (marked with a wavy underline) targeting the drug-resistant gene aac3 (rabbit) of AYE (AYE-pMo130TFR) and AYE-TA (AYE-TA-pMo130TFR) were tested. acc3 Figure 5 b).

[0079] The transformation efficiency of pMo130TFR empty plasmid into wild-type AYE strain on LB plates containing only potassium sulfite was 323200, 362000, and 175200 CFU / μg for three times, respectively, and the transformation efficiency of AYE-TA strain was 284800, 217200, and 297600 CFU / μg for three times, respectively, and there was no significant difference in the log value (P value was 0.89).

[0080] The transformation efficiency of pACC3 into wild-type AYE strain on LB plates containing only potassium sulfite was 85600, 74400, and 54400 CFU / μg for three times, respectively, and the transformation efficiency of AYE-TA strain was 10400, 19600, and 26400 CFU / μg for three times, respectively, and there was a significant difference in the log value (P value was 0.01), indicating that the AYE-TA strain had higher elimination efficiency.

[0081] ​The efficiency of pMo130TFR empty plasmid transforming wild type AYE strain was 264800, 180800, 172400 CFU / μg, and the efficiency of pMo130TFR empty plasmid transforming AYE-TA strain was 272800, 228000, 300800 CFU / μg, respectively, on LB plates containing both potassium sulfite and gentamicin, and there was no significant difference in the log values (P value was 0.15).

[0082] The efficiency of pACC3 transforming wild type AYE strain was 608, 416, 288 CFU / μg, and the efficiency of pACC3 transforming AYE-TA strain was 76, 60, 64 CFU / μg, respectively, on LB plates containing both potassium sulfite and gentamicin, and there was a very significant difference in the log values (P value was 0.001), which indicated that the presence of CreTA significantly reduced the probability of producing gentamicin-resistant clones in the CRISPR killing process.

[0083] The efficiency of pMo130TFR empty plasmid transforming wild type AYE strain was 289600, 272400, 179200 CFU / μg, and the efficiency of pMo130TFR empty plasmid transforming AYE-TA strain was 216000, 244400, 286800 CFU / μg, respectively, on LB plates containing both potassium sulfite and kanamycin, and there was no significant difference in the log values (P value was 0.9).

[0084] The efficiency of pACC3 transforming wild type AYE strain was 1268, 1236, 1072 CFU / μg, and the efficiency of pACC3 transforming AYE-TA strain was 256, 416, 468 CFU / μg, respectively, on LB plates containing both potassium sulfite and kanamycin, and there was a very significant difference in the log values (P value was 0.004), which indicated that the presence of CreTA significantly reduced the probability of producing kanamycin-resistant clones in the CRISPR killing process.

[0085] The killing efficiency of pACC3 on wild type AYE strain was 75.08% (i.e. 1-(85600+74400+54400) / (323200+362000+175200)) Figure 5 c);

[0086] The killing efficiency of pACC3 on AYE-TA strain was 92.95% (i.e. 1-(10400+19600+26400) / (284800+217200+297600));

[0087] Therefore, the presence of CreTA greatly improved the killing efficiency of CRISPR carried by pACC3 plasmid on AYE strain.

[0088] Among the surviving wild-type AYE, the proportion of clones that still retain gentamicin resistance is 0.61% (i.e., (608+410+288) / (85600+74400+54400)).

[0089] Among the surviving AYE-TA cells, the proportion of clones that still retained gentamicin resistance was 0.35% (i.e., (76+60+64) / (10400+19600+26400)).

[0090] Therefore, the combination of CRISPR and CreTA significantly reduces the likelihood of the generation of resistant clones.

[0091] Example 5: Using CreTA elements in combination to enhance the sterilization efficiency of CRISPR against clinical strains.

[0092] Because CreT generally has bactericidal toxicity in Acinetobacter baumannii ( Figure 4 We further tested the efficacy of combining CRISPR and CreTA in eliminating multidrug-resistant clinical strains.

[0093] First, the cas3 gene and four csy genes of the AYE strain (these five genes are the cas genes necessary for CRISPR disinfection) were integrated into the pMo130TFR plasmid. Figure 6 (a) Then, a mini-CRISPR structure with two spacers was constructed (sequence shown in SEQ ID NO: 4). The first spacer is the ψS sequence of creA (straight underlined sequence), which can generate CreA RNA; the second spacer (wavy underlined) targets common clinical Baumann's strains that are multidrug resistant. oxa23 The gene confers resistance in *Acinetobacter baumannii* to carbapenems (such as meropenem and imipenem). Based on this, we constructed two plasmids, pOXA23 and pOXA23TA. pOXA23 does not carry the creT gene, therefore it does not provide "addictive protection" against the AYE CRISPR-Cas system, nor does it initiate the TA eradication effect when CRISPR-Cas is destroyed; pOXA23TA carries the creT gene and can initiate the TA eradication effect when CRISPR-Cas is destroyed (see reference). Figure 1 (A CreT toxin element was inserted into pOXA23). Subsequently, the two plasmids were electroporated into a multidrug-resistant Acinetobacter baumannii clinical strain AB14 to test their bactericidal efficiency.

[0094] a) On LB plates containing only potassium sulfite:

[0095] The transformation efficiency of pMo130TFR empty plasmid to clinical strain AB14 was 3120000, 4800000, 3640000 CFU / μg, respectively.

[0096] The transformation efficiency of pOXA23 to clinical strain AB14 was 28400, 32800, 31200 CFU / μg, respectively, which was significantly different from the empty plasmid (P value was 3.47E-06), indicating that the CRISPR-Cas system of AYE strain had a significant bactericidal effect on the clinical B. pickettii strain, with a bactericidal efficiency of 99.2% (i.e. 1- (28400+32800+31200) / (3120000+4800000+3640000));

[0097] The transformation efficiency of pOXA23-TA to clinical strain AB14 was 500, 650, 500 CFU / μg, respectively, which was significantly different from pOXA23 (P value was 1.08E-05), indicating that CreTA significantly improved the CRISPR bactericidal efficiency, which was about 99.94% (i.e. 1- (500+650+500) / (3120000+4800000+3640000)).

[0098] b) on LB plates containing both potassium sulfite and meropenem:

[0099] The transformation efficiency of pMo130TFR empty plasmid to clinical strain AB14 was 2720000, 3560000, 2840000 CFU / μg, respectively, which was not significantly different from the transformation efficiency on LB plates containing only potassium sulfite (P value was 0.21).

[0100] The transformation efficiency of pOXA23 to clinical strain AB14 was 332, 296, 344 CFU / μg, respectively, while the transformation efficiency of pOXA23-TA to clinical strain AB14 was 8, 20, 8 CFU / μg, respectively, which was significantly different (P value was 3.89E-04), indicating that the combination of CreTA significantly reduced the probability of the emergence of meropenem-resistant clones during the CRISPR bactericidal process.

[0101] c) on LB plates containing both potassium sulfite and imipenem:

[0102] The transformation efficiency of pMo130TFR empty plasmid to clinical strain AB14 was 2836000, 3320000, 3560000 CFU / μg, respectively, which was not significantly different from the transformation efficiency on LB plates containing only potassium sulfite (P value was 0.32).

[0103] The transformation efficiency of pOXA23 was 388, 372, 296 CFU / μg, while the transformation efficiency of pOXA23-TA was 4, 0, 8 CFU / μg, respectively. There was a significant difference between them (P value was 1.59E-03), which indicated that the combination of CreTA significantly reduced the probability of imipenem-resistant clones during the CRISPR killing process.

Claims

1. A coupled element consisting of a toxin element and an antitoxin element, wherein the toxin element and the antitoxin element are directly connected, or coupled to form the element respectively at different positions of the same vector, or respectively on different vectors; wherein the toxin element contains a promoter sequence, an SD sequence and a mini-ORF toxin sequence element for expressing a toxin; the antitoxin element contains a promoter sequence and a mini-CRISPR-like structure which can be processed to produce a Cre RNA; the promoter of the toxin element is a PcreT promoter, the promoter of the antitoxin element is a PcreA promoter, and the toxin element and the antitoxin element are derived from Acinetobacter; the first repeat sequence of the mini-CRISPR-like structure is not conserved but has a conserved stem-loop structure, and the second repeat sequence and structure are very conservative; the sequence of the PcreT promoter is as follows: TACTTAGTAATGATAAGTCTTTTTATTTTACATAGAAATAGCTTGTGGAATAAAAGAAAAATCTGTATTTTACTTGTTATGGTTACTTTTAGTTTGAATTAAAGTAACTAGGTTTAATATTTAAATAAAGATTAACCATCGATCTGGCAGGATCACACATCACCCGATAGGG; the sequence of the PcreA promoter is as follows: ATACAGATTTTTCTTTTATTCCACAAGCTATTTCTATGTAAAATAAAAAGACTTATCATTACTAAGTA; the sequence of the SD sequence and the mini-ORF toxin sequence element is as follows: TAAGGGGGAAATAATGTTTAGCACGCATTTAATCAGAAGGGTCTGA; the sequence of the mini-CRISPR-like structure is as follows: AGGCACTACCATAAAGGTAGCTTAGAAATAGTTCCTTTTATTCAATCTGTTCATGGCGGCATACGCCATTTAGAAA; the nucleotide sequence of the toxin element is shown in SEQ ID NO:1: TACTTAGTAATGATAAGTCTTTTTATTTTACATAGAAATAGCTTGTGGAATAAAAGAAAAATCTGTATTTTACTTGTTATGGTTACTTTTAGTTTGAATTAAAGTAACTAGGTTTAATATTTAAATAAAGATTAACCATCGATCTGGCAGGATCACACATCACCCGATAGGGTAAGGGGGAAATAATGTTTAGCACGCATTTAATCAGAAGGGTCTGA; The nucleotide sequence of the antitoxin element is shown as SEQ ID NO: 2: ATACAGATTTTTCTTTTATTCCACAAGCTATTTCTATGTAAAATAAAAAGACTTATCATTACTAAGTAAGGCACTACCATAAAGGTAGCTTAGAAATAGTTCCTTTTATTCAATCTGTTCATGGCGGCATACGCCATTTAGAAA.

2. A coupled CRISPR-Cas and toxin-antitoxin combined element, comprising a cas gene element consisting of a cas3 gene and four csy genes from Acinetobacter baumannii AYE strain, a mini-CRISPR structure element containing a spacer targeting a drug resistance gene, and the coupled element as claimed in claim 1. wherein, The spacer targeting a drug resistance gene is a sequence of 32-34 bp in length after CC in the corresponding drug resistance gene, or the reverse complement sequence of 32-34 bp before GG.

3. The coupled CRISPR-Cas and toxin-anti-toxin combinatorial element of claim 2, wherein, The mini-CRISPR structure element containing a spacer targeting a drug resistance gene is a crRNA independently expressing a drug resistance gene, or a bifunctional mini-CRISPR structure containing a double spacer fused with an antitoxin element; the bifunctional mini-CRISPR structure containing a double spacer is a spacer targeting a drug resistance gene and a repeat sequence connected after an antitoxin element, the former spacer is a ψS sequence of creA to produce a CreA RNA, and the latter spacer is the spacer targeting a drug resistance gene to produce a crRNA targeting a drug resistance gene.

4. The coupled CRISPR-Cas and toxin-anti-toxin combinatorial element of claim 3, wherein, The nucleotide sequence of the crRNA independently expressing a drug resistance gene is shown as SEQ ID NO: 6; the nucleotide sequence of the bifunctional mini-CRISPR structure containing a double spacer is shown as SEQ ID NO: 4; The ψS sequence is a sequence of 20 bp after CC in the corresponding promoter sequence, or the reverse complement sequence of 20 bp before GG.

5. The coupled CRISPR-Cas and toxin-antitoxin combined element of claim 4, wherein The repeat sequence is GTTCATGGCGGCATACGCCATTTAGAAA; and the ψS sequence is TAGTTCCTTTTATTCAATCT. The drug resistance gene is a drug resistance gene of carbapenems.

6. The conjugated CRISPR-Cas and toxin-anti-toxin combination element of claim 5, wherein, The drug resistance gene is at least one selected from oxa23 gene, mcr-1, NDM-1, OXA5 derived from a multiple drug resistant clinical Acinetobacter strain.

7. The conjugated CRISPR-Cas and toxin-anti-toxin combinatorial element of claim 2, wherein, The nucleotide sequence of the cas gene element is shown as SEQ ID NO: 3, and the nucleotide sequence of the mini-CRISPR structure element containing a spacer targeting a drug resistance gene is shown as SEQ ID NO:

6.

8. A derivative plasmid containing the conjugated CRISPR-Cas and toxin-anti-toxin combination element according to any one of claims 2 to 7.

9. The derivative plasmid according to claim 8, characterized in that, The derivative plasmid is a shuttle plasmid of E. coli or Acinetobacter.

10. The derivative plasmid according to claim 9, characterized in that, The pMo130TFR is used as the starting plasmid, and the nucleotide sequence is shown in SEQ ID NO:

5.

11. Recombinant bacteria containing the coupled CRISPR and toxin-antitoxin element of any one of claims 2 to 7, or the derivative plasmid of any one of claims 8-10, characterized in that, The recombinant bacteria are E. coli or Acinetobacter.

12. A recombinant bacteriophage comprising a genome having integrated therein a coupled CRISPR and toxin-antitoxin element as claimed in any one of claims 2 to 7, characterised in that, The recombinant bacteriophage is a lysogenic or virulent bacteriophage.

13. The recombinant bacteriophage of claim 12, wherein, The recombinant bacteriophage is an Acinetobacter bacteriophage.

14. Use of the derivative plasmid according to any one of claims 8 to 10, or the recombinant bacteriophage according to any one of claims 12 to 13 in the killing of drug-resistant genes, which is a use other than for disease diagnosis and treatment.

15. Use according to claim 14, characterized in that, The use is to deliver the CRISPR-Cas element into multi-drug resistant bacteria by conjugative transfer, bacteriophage infection, or nanoparticle embedding, and to perform sequence-specific killing.

16. The use of claim 15, wherein, The killing is performed by introducing the derivative plasmid-containing recombinant bacteria into drug-resistant bacteria in the target environment by natural conjugative transfer, or by introducing the recombinant bacteriophage into drug-resistant bacteria in the target environment by natural infection of the bacteriophage, or by preparing nanoparticles and introducing the nanoparticles into drug-resistant bacteria in the target environment. The killing is performed by introducing the derivative plasmid-containing recombinant bacteria into drug-resistant bacteria in the target environment by natural conjugative transfer, or by introducing the recombinant bacteriophage into drug-resistant bacteria in the target environment by natural infection of the bacteriophage, or by preparing nanoparticles and introducing the nanoparticles into drug-resistant bacteria in the target environment.

Images