Preparation Method of Glutamate Oxidase and Its Related Applications
By expressing and purifying the mcherry-tagged glutamate oxidase in E. coli cells, the problems of difficulty and high cost of obtaining LGOX in the prior art are solved, and efficient enzyme preparation and industrial production of α-ketoglutaric acid are achieved.
Patent Information
- Application Number
- CN202211456080.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-21
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2042-11-21
AI Technical Summary
In the prior art, the acquisition of glutamate oxidase (LGOX) is difficult and costly, resulting in its limitation in research and application.
Highly active and high purity LGOX was prepared by designing a recombinant vector containing the mcherry tag gene and the glutamate oxidase L-GOX gene and expressing the enzyme in E. coli cells, and affinity purification was performed using the AKTA protein purification system and a Ni Sepharose 6Fast Flow affinity chromatography column.
The efficient expression and purification of glutamate oxidase is achieved, and a new method is provided to prepare α-ketoglutaric acid, providing new ideas for its industrial production.
Smart Images

Figure CN115960939B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering, and in particular, to a method for preparing glutamate oxidase and its related applications. Background Art
[0002] L-Glutamate oxidase (LGOX) is a flavoprotein enzyme with a flavin adenine dinucleotide (FAD) binding region, having good specificity. It can specifically catalyze the substrate L-glutamate to produce H2O2, ammonia, and α-ketoglutaric acid. Since H2O2 is generated during the catalytic reaction and the electrons during the reaction process can be captured by a hydrogen peroxide electrode, it is often used to prepare sensors for various applications such as clinical detection, fermentation production, and food safety detection.
[0003] Currently, the acquisition of LGOX mostly involves screening enzyme-producing strains and optimizing fermentation conditions to obtain high-yield strains of this enzyme. Then, through a series of analysis and separation methods, L-glutamate oxidase with higher purity and better quality is obtained. It can also be isolated from organisms such as snake venom, mouse kidneys, invertebrates, and microorganisms, but the amount of LGOX obtained is small, the price is expensive, and it is difficult to conduct in-depth research for application.
[0004] α-Ketoglutaric acid, also known as α-ketoglutaric acid, α-oxoglutaric acid, α-carbonyl glutaric acid, with the English name 2-Ketoglutaric acid, the molecular formula C5H7NO5, and the molecular weight of 161.1128. As an important intermediate in the dicarboxylic acid cycle and the tricarboxylic acid cycle, it plays a very important role in the synthesis of amino acids and peptides. At the same time, it also has extensive applications in the pharmaceutical industry, food, organic synthesis, and nutritional fortifiers, and has great development prospects.
[0005] Clinically, glutamate salts are commonly used to bind excess ammonia in the blood to relieve ammonia poisoning. In addition, after α-ketoglutaric acid reacts with 5-hydroxy-methylfurfural, it can form a drug for resisting oxidative stress to improve the body's antioxidant stress ability. Therefore, α-ketoglutaric acid is often used as a dietary nutritional supplement or as an additive in infusions to help patients heal wounds and provide energy. In 2020, scientists discovered through experiments that α-ketoglutaric acid also has an anti-aging effect. As the role of α-ketoglutaric acid as a health care function is gradually discovered, currently, the methods for preparing α-ketoglutaric acid are mainly chemical synthesis and enzymatic preparation. Enzymatic preparation is being explored more and more due to its advantages such as good reaction specificity and simple later purification process.
[0006] In view of this, the present invention is specifically proposed. Summary of the Invention
[0007] The purpose of the present invention is to provide a method for preparing glutamate oxidase and its application in the preparation of α-ketoglutaric acid.
[0008] The present invention is implemented as follows:
[0009] In a first aspect, an embodiment of the present invention provides a recombinant vector of glutamate oxidase, which is characterized in that it includes: an mcherry tag gene and a glutamate oxidase L-GOX gene; the nucleotide sequence of the mcherry tag gene is as shown in SEQ ID No.1; the nucleotide sequence of the glutamate oxidase L-GOX gene is as shown in SEQ ID No.2.
[0010] In a second aspect, an embodiment of the present invention provides a host cell, which includes the recombinant vector of glutamate oxidase described in the foregoing embodiment; the host cell includes Escherichia coli cells.
[0011] In a third aspect, an embodiment of the present invention provides the application of the recombinant vector of glutamate oxidase described in the foregoing embodiment in the preparation of a reagent or kit for promoting the expression of glutamate oxidase.
[0012] In a fourth aspect, an embodiment of the present invention provides a preparation method of glutamate oxidase, which includes: culturing the host cell described in the foregoing embodiment, and the preparation method further includes: purifying the culture product of the host cell; the purification step includes: using an AKTA protein purification system and a Ni Sepharose 6Fast Flow affinity chromatography column to perform affinity purification on the target protein.
[0013] In a fifth aspect, an embodiment of the present invention provides the application of the host cell described in the foregoing embodiment in the preparation of α-ketoglutaric acid. The preparation steps include: reacting the culture of the host cell with an L-glutamic acid substrate to obtain α-ketoglutaric acid; the reaction temperature is -4 to 20 °C; the reaction time is 1 to 24 h; the culture method of the culture of the host cell includes: culturing the host cell on a cell culture medium; the culture medium contains an inducer; the inducer includes IPTG; the working concentration of the inducer is 0.1 to 10 mM; the culture conditions are: 5 to 25 °C, 10 to 20 h.
[0014] The present invention has the following beneficial effects:
[0015] The inventors of the present application found that the mcherry tag can promote the correct folding of glutamate oxidase LGOX in host cells such as Escherichia coli. Through enzyme activity detection methods, it was found that the LGOX expressed by fusing the tag has enzyme activity, indicating that the fusion tag has a positive promoting effect on the correct folding of LGOX. On the one hand, the method provided by the present invention enables the recombinant protein to be successfully displayed on the surface of Escherichia coli; on the other hand, when LGOX has the mcherry tag, it can directly catalyze the substrate L-glutamic acid to prepare α-ketoglutaric acid, providing a new idea for the industrial production of α-ketoglutaric acid. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.
[0017] Figure 1 It is the construction map of the pET28a-mcherry-LGOX vector in the embodiments of the present invention;
[0018] Figure 2 It is the PCR verification of the recombinant plasmid of pET28a-mcherry-LGOX in the embodiments of the present invention; where M is the DNA marker, and 1-8 are the colony PCR maps of 8 suspected recombinants;
[0019] Figure 3 It is the transformation of the pET28a-mcherry-LGOX recombinant plasmid into Escherichia coli competent cells;
[0020] Figure 4 It is the induction expression of pET28a-mcherry-LGOX; where, M: DNA marker, 1: whole cells of pET28a-LGOX; 2: supernatant of lysed pET28a-LGOX; 3: precipitate of lysed pET28a-LGOX; 4: whole cells of pET28a-mecherry-LGOX; 5: supernatant of lysed pET28a-mecherry-LGOX; 6: precipitate of lysed pET28a-mecherry-LGOX;
[0021] Figure 5 It is the surface display of pET28a-mecherry-LGOX under a fluorescence microscope (without light source, 16*100 oil);
[0022] Figure 6Purification of pET28a - mecherry - LGOX; where, M: Protein marker; 1: Wash membrane supernatant of pET28a - mecherry - LGOX; 2: Flow - through of pET28a - mecherry - LGOX; 3: Elution with 50 mmol imidazole; 4: Elution with 100 mmol imidazole; 5: Elution with 200 mmol imidazole;
[0023] Figure 7 SDS verification of the surface display of pET28a - mcherry - LGOX on the membrane; where, M: Protein marker; 1: Wash membrane supernatant, whole bacteria, precipitate, lysed bacteria supernatant of pET28a - mecherry - LGOX; 2: Whole bacteria of pET28a - mecherry - LGOX; 3: Lysed bacteria precipitate of pET28a - mecherry - LGOX; 4: Lysed bacteria supernatant (not concentrated) of pET28a - mecherry - LGOX;
[0024] Figure 8 Enzyme activity assay of mecherry - LGOX; where, 1: Blank control; 2: Whole bacteria of pET28a - mecherry - LGOX; 3: Wash membrane supernatant of pET28a - mecherry - LGOX; 4: Lysed bacteria precipitate of pET28a - mecherry - LGOX;
[0025] Figure 9 Liquid - phase detection of α - ketoglutaric acid standard product
[0026] Figure 10 Detection diagram of the reaction solution after enzyme catalysis
[0027] Figure 11 Temperature tolerance detection of mcherry to LGOX
[0028] Figure 12 pH tolerance detection of mcherry to LGOX Detailed implementation manners
[0029] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be described clearly and completely below. Those not specified in the embodiments are carried out according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase.
[0030] First, the embodiments of the present invention provide a recombinant vector, which includes: mcherry tag gene and glutamate oxidase L - GOX gene.
[0031] After a series of creative efforts, the inventor found that the mcherry tag can promote the correct folding of LGOX in host cells such as Escherichia coli, and fusing the mcherry tag can anchor the LGOX protein on the cell surface.
[0032] The enzymatic properties of the obtained recombinant glutamate oxidase were detected, and it was found that the optimal pH of the enzyme was 6.5, the optimal reaction temperature was 20 °C, and Cu 2+ , Fe 2+ had an obvious inhibitory effect on the enzymatic reaction of this enzyme, and Mg 2+ had a certain promoting effect on the enzymatic reaction of this enzyme. It had good stability at low temperatures. After being placed at 4 °C - 10 °C for 250 min, more than 60% of the enzyme activity remained. The fusion tag had a guiding effect on the correct folding of this enzyme.
[0033] After the enzyme with the fusion tag catalyzed the substrate L-glutamic acid for 24 h, the liquid phase detection results showed that the whole cells of LGOX after fusion with the tag could achieve the conversion of the substrate L-glutamic acid to α-ketoglutaric acid.
[0034] In some embodiments, the nucleotide sequence of the mcherry tag gene is as shown in SEQ ID No.1. The common mcherry sequence contains a GC content as high as 58%. Considering the charge ratio and GC content ratio of the protein to be fusion-expressed in the present invention, the GC content of the mcherry sequence was adjusted (46%); at the same time, 6 amino acids at the N-terminus of mcherry were removed, so that the charge of the LGOX gene after fusing mcherry was close to neutral or acidic during protein translation, expression and folding, which was more suitable for the correct folding and successful expression of pET28a-mcherry-LGOX in Escherichia coli.
[0035] SEQ ID No.1: atgctgtttaccggcgttgttccgattctggtggaactggatggtgatgtgaatggtcataaatttagtgtgcgtggcgaaggcgaaggtgatgccaccaatggcaaactgaccctgaaatttatttgtaccaccggcaaactgccggttccgtggccgaccctggttaccaccctgacctatggcgtgcagtgttttagccgttatccggatcatatgaaacagcatgatttttttaagagcgccatgccggaaggctatgtgcaggaacgcaccattagttttaaagatgatggcacctataagacccgtgcagaagttaaatttgaaggtgataccctggtgaatcgtattgaactgaaaggtattgatttcaaagaggatggtaatattctgggtcataaactggaatataactttaatagccacaacgtgtatatcaccgcagataaacagaaaaatggtattaaagccgaattcgaaatccgccataatgttgaagatggcagtgtgcagctggccgatcattatcagcagaataccccgattggcgatggcccggtgctgctgccggatgatcattatctgagcaccgaaagtgtgctgagcaaagatccgaatgaagatcgcgatcatatggttctgctggaatttgtgaccgcagcaggtattgatctgggcatggatgaactgtataaa。
[0036]
[0037] In some embodiments, a purification tag is introduced at the N-terminus of the L-GOX gene of glutamate oxidase for subsequent purification.
[0038] In some embodiments, the purification tag includes a 6×HIS tag.
[0039] In some embodiments, the recombinant vector is obtained by inserting the mcherry tag gene and the L-GOX gene of glutamate oxidase into an expression vector.
[0040] In some embodiments, the expression vector is pET28a.
[0041] On the other hand, an embodiment of the present invention also provides a host cell, which includes the recombinant vector described in any of the foregoing embodiments.
[0042] In some embodiments, the host cell includes Escherichia coli cells.
[0043] On the other hand, an embodiment of the present invention also provides an mcherry tag, the nucleotide sequence of which is as shown in SEQ ID No.1.
[0044] On the other hand, an embodiment of the present invention also provides the use of the mcherry tag or the recombinant vector described in any of the foregoing embodiments or the host cell described in any of the foregoing embodiments in promoting the expression of glutamate oxidase or immobilizing it on the cell surface or preparing a reagent or kit for promoting the expression of glutamate oxidase or immobilizing it on the cell surface.
[0045] In some embodiments, the nucleotide sequence of the mcherry tag is as shown in SEQ ID No.1.
[0046] On the other hand, an embodiment of the present invention also provides a method for preparing glutamate oxidase, which includes: culturing the host cell described in any of the foregoing embodiments.
[0047] In some embodiments, the preparation method further includes: purifying the culture product of the host cell.
[0048] In some embodiments, the purification includes: using an AKTA protein purification system and a Ni Sepharose 6 Fast Flow affinity chromatography column to perform affinity purification on the target protein.
[0049] On the other hand, an embodiment of the present invention also provides glutamate oxidase prepared by the method for preparing glutamate oxidase described in any of the foregoing embodiments.
[0050] In addition, the embodiments of the present invention also provide the use of the recombinant vector described in any of the foregoing embodiments, or the host cell described in any of the foregoing embodiments, or the mcherry tag, or the glutamate oxidase described in any of the foregoing embodiments in the preparation of α-ketoglutaric acid.
[0051] In some embodiments, the preparation includes: reacting the culture of the host cell or the glutamate oxidase with an L-glutamic acid substrate to obtain α-ketoglutaric acid.
[0052] In the case where the fusion tag is not removed, both the enzyme and the bacterial cells can catalyze the substrate L-glutamic acid to prepare α-ketoglutaric acid.
[0053] When preparing the substrate, with the consumption of the substrate by the excessive L-glutamic acid, the product can autolyze to maintain the substrate concentration as the product is produced, enriching the production of the catalytic product, and the pH does not need to be adjusted during the reaction process.
[0054] In some embodiments, the temperature of the reaction is -4 to 20 °C. Specifically, the temperature can be any one of -4 °C, -2 °C, 0 °C, 2 °C, 4 °C, 6 °C, 8 °C, 10 °C, 12 °C, 14 °C, 16 °C, 18 °C, and 20 °C or the range between any two of them.
[0055] The optimal reaction temperature is 20 °C - 4 °C. After hydrolysis is completed, the reaction solution can be centrifuged to remove residues, and after desalting treatment, the supernatant is taken for filtration, ultrafiltration, and then vacuum spray drying to obtain the finished product of α-ketoglutaric acid, and the purity of the degradation product reaches 80%.
[0056] In some embodiments, the reaction time is 1 to 24 h. Specifically, the time can be any one of 1 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, 14 h, 16 h, 18 h, 20 h, 22 h, and 24 h or the range between any two of them.
[0057] In some embodiments, the culture method of the culture of the host cell includes: culturing the host cell on a cell culture medium. Optionally, the culture medium can be a conventional culture medium for culturing expression cells, such as LB medium.
[0058] In some embodiments, the culture medium contains an inducer.
[0059] In some embodiments, the inducer includes IPTG.
[0060] In some embodiments, the working concentration of the inducer is 0.1 to 10 mM.
[0061] The culture conditions of the host cell are such that the host cell can express glutamate oxidase. In some embodiments, the culture conditions are: 5-25°C, 10-20 h. The temperature can specifically be any one of 5°C, 6°C, 8°C, 10°C, 12°C, 14°C, 16°C, 18°C, 20°C, 22°C, 24°C, 25°C or the range between any two of them; the time can specifically be any one of 10 h, 12 h, 14 h, 16 h, 18 h, 20 h or the range between any two of them.
[0062] Sources of biological materials used in the examples:
[0063] 1. Escherichia coli BL21(DE3) was purchased from Novagen.
[0064] 2. The primers used were commissioned to be synthesized by Wuhan Kingcare Bioengineering Co., Ltd., and the LGOX gene and mcherry sequence were commissioned to be synthesized by Wuhan Kingcare Bioengineering Co., Ltd.
[0065] 3. The vector pET28a used was purchased from Novagen.
[0066] Example 1 Vector construction
[0067] Through blast search, the amino acid sequence of glutamate oxidase (LGOX) (GenBank: WP_037994259.1) from Thermoactinomyces sp. Thermoactinomyces () was obtained. According to the codon preference of Escherichia coli, the base sequence of LGOX (SEQ ID NO.2) was designed and synthesized.
[0068] Primers were designed and synthesized based on the base sequence of LGOX and the mcherry gene sequence (SEQ ID No.1) information, and the mcherry-LGOX sequence with a purification tag and restriction enzyme sites was amplified by Overlap PCR technology.
[0069] Using the primer OVERLAPPING strategy, the fusion tag (mcherry tag) and LGOX were concatenated. The head and tail primers were used as primers (5-10 mM), several extended fragments with homologous regions were added as templates, and a small amount (1 mM-2 mM) of intermediate primers were added, followed by annealing and extension again; this was repeated. Finally, the DNA with the correct size on the agarose gel was determined as the suspected correct DNA; the DNA with the correct size was recovered from the gel and inserted into the pET28a vector; the gene synthesis correctness was detected by sequencing. The primers required for vector construction are as follows in the table:
[0070] Table 1 Primer sequences required for the examples
[0071]
[0072] According to the method of fragment splicing, the mcherry tag and the two fragments of LGOX were connected by PCR in a bridging manner. The PCR products were detected by agarose gel electrophoresis, and the fragments with the correct size were recovered. The pET-28a vector was linearized with the restriction endonuclease BfuI. The mixture of the fragments and the vector was treated with T5 exonuclease on ice. After 5 - 10 s, the mixture was routinely transformed into Escherichia coli DH5α competent cells. After culturing at 37°C for 18 hours, monoclonal colonies on the screening plate were picked, plasmids were extracted, and the primers at both ends of the spliced fragments were used as primers, and the plasmid was used as a template for PCR to verify the recombinant, and sequencing was performed to confirm the correctness of the recombinant plasmid, obtaining the vector: pET28a-mcherry-LGOX. Schematic diagram of vector construction (such as Figure 1 ), the spliced product was transformed into Escherichia coli GOLD competent cells, single colonies were selected, and cultured at 37°C until OD 600 ≈0.6, the cells were collected, plasmids were extracted, the plasmid size was detected, and the primers F (mcherry-LGOX) and R (mcherry-LGOX) were used for PCR to verify the recombinant. The results are shown in (such as Figure 2 ). Recombinants with the correct size were selected for sequencing verification.
[0073] The correctness of the base linker of the plasmid pET28a-mcherry-LGOX was verified by comparing the sequencing results, and it was stored at -20°C for later use.
[0074] Example 2 Induced expression of LGOX with mcherry
[0075] Take 2 μl of the pET28a-mcherry-LGOX gene and gently mix it with 50 μl of BL21 competent cells. After ice-bathing for 30 min, place it in a 42°C water bath for heat shock for 45 s. After ice-bathing for another three minutes, add 150 μl of NZY medium. Place it in a 37°C shaker and culture for 50 min, then evenly coat it on an LB plate containing kanamycin antibiotic with a spreading rod and culture it overnight in a 37°C incubator. The transformed plate is shown in (such as Figure 3 ). After the pET28a-mcherry-LGOX was transformed into BL21 competent cells, due to the expression of the mcherry protein, it showed red, suggesting the possibility that the protein was localized on the cell surface.
[0076] After 16 - 18 h, the transformants were inoculated and cultured in a 37°C shaker until OD 600 ≈0.6, induced at 18°C for 16 - 18 h with an IPTG concentration of 1 mM, the cells were collected, washed, and lysed by sonication. The lysed precipitate, supernatant, and proteins eluted with different concentrations of imidazole were detected by SDS-PAGE. The specific operation process is as follows:
[0077] 1. Add an appropriate amount of lysis buffer to the washed cells and vortex thoroughly to form a homogeneous liquid mixture;
[0078] 2. Add 1% PMSF by volume ratio to the resuspension, and then choose to homogenize the cells by high-pressure homogenization or ultrasonic disruption;
[0079] 3. After cell lysis is completed, add 1‰ PMSF, mix well, and centrifuge at low temperature and high speed (4°C, above 12,000 rpm) to separate impurities such as liquid and cell debris;
[0080] 4. After centrifugation, filter the supernatant into a pre-treated purification sleeve containing nickel beads, and place it on a silent mixer to rotate and bind at 4°C;
[0081] 5. After the protein binds to Ni-NTA for about 1 h, wash it 2-3 times with lysis buffer, and then elute the protein successively with imidazole buffer at a concentration gradient of 10-300 mM, and detect the elution with G250;
[0082] 6. The eluted fractions are temporarily stored at 4°C. At the same time, take 40 μL of each eluate respectively, add 10 μL of 5× Loading Buffer, heat it at 100°C for 10 min with a metal bath, and centrifuge for detection;
[0083] 7. According to the detection results, select the eluted fraction with a relatively single target band for concentration and buffer exchange. Finally, measure the protein concentration, aliquot it into small portions, quick-freeze it with liquid nitrogen, and store it at -80°C for later use.
[0084] The results of SDS-PAGE detection (such as Figure 4 ). It can be seen from the detection results that there are corresponding bands in the supernatant of the Escherichia coli inducer containing plasmid pET28a-mcherry-LGOX, indicating the successful expression of recombinant protein pET28a-mcherry-LGOX.
[0085] Wash the Escherichia coli cells after induction for 18 h with the pET28a-mcherry-LGOX plasmid transformed into Escherichia coli BL21 three times with PBS buffer, and observe under a fluorescence microscope. The results (such as Figure 5 ). It can be seen from the fluorescence pictures that the bacteria emit red light, indicating the possibility of protein surface display on the bacteria.
[0086] 8. Using the AKTA protein purification system and Ni Sepharose 6 Fast Flow affinity chromatography column, the target protein was purified by affinity chromatography. The loading buffer was 20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 8.0; the elution buffer was 20 mM Tris-HCl, 0.5 M NaCl, 200 mM imidazole, pH 8.0.
[0087] The protein elution peak samples were collected and the protein samples were ultrafiltered at 4°C. The buffer was 10 mM Tris-HCl, 100 mM KCl, 1 mM DTT, 0.2 mM EDTA, pH 8.0; the protein samples were stored in a -80°C refrigerator.
[0088] The purification result of the mcherry-LGOX protein is shown in Figure 6 , and it can be seen from the figure that LGOX fused with mcherry can be purified by hanging on the NI column.
[0089] Example 3 Whole-cell catalytic reaction
[0090] In this example, through western blotting of the washed membrane supernatant, whole bacteria, precipitate, and lysed bacteria supernatant, it was further verified that the protein of LGOX fused with mcherry was mainly anchored on the cell membrane surface. The specific implementation method was as follows: The pET28a-mcherry-LGOX vector was transformed into Escherichia coli BL21 competent cells, the transformants were inoculated, and cultured at 37°C until OD 600 ≈0.6, induced with 1 mM IPTG concentration at 18°C for 16 - 18 h, the bacteria were collected, washed 3 times with PBS buffer, and then the membrane protein was eluted with a buffer of 50 mM Tris-HCl (pH = 8.0), 50 mM NaCl, 5 mM EDTA at 4°C for 24 h. The washed membrane supernatant was taken, and using the HA tag in LGOX-HA-SED1, mouse anti-HA primary antibody was selected, and then HRP-labeled secondary antibody was used to detect LGOX-HA-SED1. From Figure 7 , it can be seen that the protein band can be detected in the sample containing the washed membrane supernatant, indicating that the LGOX protein fused with the mcherry tag is displayed on the cell membrane of Escherichia coli and can achieve whole-cell catalytic reaction.
[0091] Example 4 Enzyme activity assay
[0092] The protein anchored on the surface of Escherichia coli cells was eluted by the method described in Example 2, the protein elution samples were collected and the protein samples were ultrafiltered at 4°C. The ultrafiltered protein samples were taken and mixed with 60 g / L L-glutamic acid, 2 mM Mg 2+, Catalase at 250 U / mL was incubated for 18 h under the optimal reaction conditions of the enzyme.
[0093] According to the principle that α-ketoglutaric acid produced by L-glutamate catalyzing the substrate L-glutamate can react with chemical reagents N,N-dimethylaniline and 4-aminoantipyrine to produce a purple compound under the action of horseradish peroxidase and has light absorption at 550 nm, the reaction system in the following table was formulated for enzyme activity determination.
[0094] Table 2: Reaction system for measuring enzyme activity
[0095]
[0096] Take 300 μL of the above reaction mixture, add 100 μL of enzyme solution, under the optimal reaction conditions, react precisely for 20 minutes, cool to room temperature, and measure the absorbance at 550 nm. L-glutamate oxidase is defined as the amount of enzyme required to release 1 μmol of hydrogen peroxide per minute under the optimal reaction conditions of the enzyme, which is 1 U. The reaction results are as Figure 8 .
[0097] Example 5 Determination of substrate catalytic efficiency
[0098] The pET28a-mcherry-LGOX vector was transformed into Escherichia coli BL21 competent cells. The transformants were inoculated and cultured at 37 °C until OD 600 ≈0.6, induced with 1 mM IPTG concentration at 18 °C for 16 - 18 h, the cells were collected, washed 3 times with PBS buffer. Take 5 g of cells, 120 g / L of L-glutamate, and catalase at 250 U / mL, incubate for 18 h under the optimal reaction conditions of the enzyme, and the substrate can be completely converted to produce 95 g / L of α-ketoglutaric acid, with a conversion rate reaching 79%.
[0099] Example 6 Liquid phase detection of conversion products and their conversion efficiency
[0100] The method for detecting the substrate conversion efficiency of cells is liquid phase detection.
[0101] The liquid phase detection conditions were configured as follows: Ultimate LP-C18, 5 μm, 7.8 × 250 mm, ultraviolet detector. Mobile phase: Phosphate buffer (pH 2) containing 1% acetonitrile was used as the mobile phase, with a flow rate of 1 mL / min. At a column temperature of 35 °C, after 5 min, α-ketoglutaric acid has an absorption peak at 210 nm (as Figure 9 ), and the reaction sample also has an absorption peak of α-ketoglutaric acid at 210 nm (as Figure 10 ).
[0102] For the LGOX with a fusion tag obtained in the foregoing embodiments, when catalyzing the substrate, from the results detected in the liquid phase, the whole cells of LGOX after fusion with the tag can achieve the conversion of the substrate L-glutamic acid to α-ketoglutaric acid.
[0103] Example 7
[0104] The enzymatic properties of the LGOX with a fusion tag and the LGOX without a fusion tag were investigated.
[0105] Take 2 μl of pET28a-mcherry-LGOX and pET28a-LGOX genes respectively, gently mix them with 50 μl of BL21 competent cells, after ice-bathing for 30 min, put them into a 42 °C water bath for heat shock for 45 s, and then add 150 μl of NZY medium after ice-bathing for another three minutes. After culturing in a 37 °C shaker for 50 min, evenly coat them on an LB plate containing kanamycin antibiotic with a spreading rod, and culture them overnight in a 37 °C incubator, and transform the plate (such as Figure 3 ). After 16 - 18 h, inoculate the transformants and culture them in a 37 °C shaker until OD 600 ≈0.6, induce them at 18 °C for 16 - 18 h with an IPTG concentration of 1 mM, collect the bacteria, wash the bacteria and lyse them by ultrasonic wave, and detect the eluted proteins of the lysed precipitate, supernatant and different concentrations of imidazole by SDS-PAGE. The specific steps are the same as in Example 1.
[0106] After reacting the two purified proteins with an 11 mg / mL L-glutamic acid substrate at different temperatures (10 °C, 20 °C, 30 °C, 40 °C, 50 °C, 60 °C, 70 °C and 80 °C) for half an hour, according to the L-glutamic acid oxidase determination method, add the determination reagent and measure the absorbance at 550 nm, and draw the temperature influence curve as Figure 11 .
[0107] Use phosphate buffer to prepare buffers with different pH values (pH 4 - 9), dilute L-glutamic acid oxidase with buffers with different pH values respectively, prepare an 11 mg / mL L-glutamic acid substrate, and react for half an hour at 30 °C. According to the enzyme activity determination method, add the chromogenic reagent and measure the absorbance at 550 nm to determine the optimal pH of L-glutamic acid oxidase, and draw the pH enzyme activity influence curve of L-glutamic acid oxidase, as Figure 12 .
[0108] From the results in the figure, it can be seen that the optimal temperature of pET28a-LGOX is 30 °C, the optimal pH is 6.5, the optimal temperature of pET28a-mcherry-LGOX is 50 °C, and the optimal pH is 7.0. After fusing with the mcherry tag, both the temperature and pH tolerance of LGOX have changed.
[0109] In actual production, it is found that after fusing the tag, the catalytic environment tolerance of LGOX is enhanced. During the catalytic reaction of the substrate glutamate, the change of the substrate product is likely to cause a change in pH in the catalytic environment, thereby reducing the catalytic efficiency. The fused tag mcherry can well improve this situation and increase the catalytic usage frequency and efficiency of LGOX.
[0110] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A recombinant vector of glutamate oxidase, characterized in that, It includes: mc herry tag gene and glutamate oxidase L-GOX gene; The nucleotide sequence of the mcherry tag gene is shown as SEQ ID No.1; the nucleotide sequence of the glutamate oxidase L-GOX gene is shown as SEQ ID No.
2.
2. A host cell, characterized in that, It includes the recombinant vector of glutamate oxidase described in claim 1; the host cell includes Escherichia coli cells.
3. The application of the recombinant vector of glutamate oxidase described in claim 1 in the preparation of reagents or kits for promoting the expression of glutamate oxidase.
4. A method for preparing glutamate oxidase, characterized in that, It includes: Culturing the host cell described in claim 2, and the preparation method further includes: purifying the culture product of the host cell; the purification step includes: using an AKTA protein purification system and a Ni Sepharose 6 Fast Flow affinity chromatography column to perform affinity purification on the target protein.
5. Use of the host cell according to claim 2 in the preparation of α-ketoglutaric acid, wherein the steps of the preparation include: Reacting the culture of the host cell with an L-glutamate substrate to obtain α-ketoglutaric acid; The temperature of the reaction is -4~20°C; The time of the reaction is 1~24 h; the culture method of the culture of the host cell includes: culturing the host cell on a cell culture medium; The culture medium contains an inducer; the inducer includes IPTG; the working concentration of the inducer is 0.1~10 mM; the culture conditions are: 5~25°C, 10~20 h.