Application of SlEIN4 gene in regulating tomato fruit traits, vector and application of vector

Abstract

The present invention relates to the application of SlEIN4 gene in regulating tomato fruit traits, vectors and the application of vectors, and belongs to the field of biotechnology. The present invention regulates the traits of tomato fruit by regulating the expression of SlEIN4 gene, and the traits are the hardness and fruit shape of tomato fruit. Experiments have confirmed that compared with the control strain, the hardness of tomato fruit in the SlEIN4 gene overexpression strain is reduced, the hardness of tomato fruit in the SlEIN4 gene editing strain is significantly increased, and the fruit shape is obviously pointed and elongated. The present invention is of great significance for accurately cultivating tomato varieties with different fruit hardness and fruit shape.

Description

Technical Field

[0001] The invention relates to application of SlEIN4 gene in regulating tomato fruit traits, vector and application of the vector, and belongs to the field of biotechnology. Background Art

[0002] Tomato (Solanum lycopersicum) is also known as tomato and foreign tomato. It is an annual or perennial herb of the genus Solanaceae. It is native to South America and is the most commonly cultivated and one of the most important vegetables in the world. my country's tomato planting area and output are among the highest in the world. Tomato occupies an important position in my country's vegetable production and consumption.

[0003] Tomato fruit hardness is an important factor affecting tomato fruit processing or storage. Improving tomato hardness is more conducive to storage and prolongs shelf life; reducing tomato hardness is more convenient for processing into tomato sauce, etc. The shape of tomato fruit is closely related to fruit size and appearance quality. Compared with round-shaped tomatoes, long-fruit tomatoes have inherent advantages in mechanized harvesting and subsequent transportation. At the same time, long-fruit tomatoes can meet the needs of different consumers. Therefore, accurately cultivating different varieties of tomatoes is not only conducive to tomato processing and storage, but also can fully meet the diversified needs of consumers.

[0004] SlEIN4 (Solyc04g064840.1.1) is an ethylene receptor gene in tomatoes and an important participant in the ethylene regulation pathway, which is directly related to the regulation of fruit ripening. However, existing studies have only focused on the application of the SlEIN4 gene in fruit ripening, and no studies have explained the relationship between the SlEIN4 gene and fruit firmness and shape. Summary of the invention

[0005] The first objective of the present invention is to provide an application of the SlEIN4 gene in regulating tomato fruit traits. By controlling the expression level of the tomato SlEIN4 gene, the hardness and shape of the tomato fruit are controlled, thereby meeting the needs of different consumers and improving the economic effect.

[0006] The second object of the present invention is to provide a recombinant expression vector.

[0007] The third object of the present invention is to provide a gene editing vector.

[0008] The fourth object of the present invention is to provide the use of the above-mentioned recombinant expression vector and gene editing vector in regulating tomato fruit traits.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is:

[0010] The application of SlEIN4 gene in regulating tomato fruit traits, the nucleotide sequence of the SlEIN4 gene is shown in SEQ ID NO: 1; the tomato fruit traits are the hardness and shape of the tomato fruit.

[0011] The present invention verifies for the first time that the SlEIN4 gene has the function of regulating tomato fruit firmness and fruit shape, and plays an important role in the precise breeding of tomato varieties.

[0012] Preferably, the SlEIN4 gene in the tomato genome is overexpressed by genetic transformation, and the hardness of the tomato fruit is reduced; the expression of the SlEIN4 gene in the tomato genome is inhibited, the hardness of the tomato fruit is increased, and the fruit shape becomes pointed and slender.

[0013] The experiment confirmed that compared with the control strain, the tomato fruit firmness of the SlEIN4 gene overexpression strain was reduced, while the tomato fruit firmness of the SlEIN4 gene edited strain was significantly increased, and the fruit shape became significantly pointed and slender, indicating that the SlEIN4 gene can regulate the firmness and shape of tomato fruit.

[0014] Further preferably, the overexpression of the SlEIN4 gene in the tomato genome is to construct a SlEIN4 overexpression vector to overexpress the SlEIN4 gene.

[0015] Further preferably, the method for constructing the overexpression vector is to connect the obtained SlEIN4 gene to the pHellsgate8 vector and sequence and identify it.

[0016] Specifically, the overexpression vector is constructed by using pHellsgate8 as the final vector, constructing a pGate8-SlEIN4 vector having a CaMV35S recombinant overexpression promoter, and connecting the SlEIN4 gene sequence to the pHellsgate8 final vector using a homologous recombination reaction.

[0017] Preferably, the expression of the SlEIN4 gene in the tomato genome is inhibited by constructing a gene editing vector to knock out the SlEIN4 gene.

[0018] Further preferably, the method for constructing the gene editing vector is to connect the target site double-stranded DNA synthesized according to the SlEIN4 gene design to the CP098 vector and sequence it for identification.

[0019] Specifically, by performing gene editing on the tomato ethylene receptor gene SlEIN4, a base mutation occurred in the SlEIN4 gene sequence after editing, and an amino acid mutation was caused, thereby obtaining a tomato plant with a SlEIN4 directed mutation.

[0020] Preferably, the tomato variety is Micro Tom.

[0021] Micro Tom has short plants and a shorter life cycle, which has the advantages of saving research space and shortening research time.

[0022] A recombinant expression vector comprising a SlEIN4 gene; the nucleotide sequence of the SlEIN4 gene is shown in SEQ ID NO: 1.

[0023] The present invention proves that overexpression of the SlEIN4 gene in tomatoes can reduce the hardness of tomato fruits. Therefore, the SlEIN4 gene can be overexpressed by the constructed recombinant expression vector, thereby reducing the hardness of tomato fruits.

[0024] A gene editing vector, characterized in that: the gene editing vector contains a target site knockout sequence designed according to the SIEIN4 gene; the nucleotide sequence of the SIEIN4 gene is shown in SEQ ID NO:1.

[0025] The present invention proves that inhibiting the expression of the SlEIN4 gene in tomatoes can increase the hardness of tomatoes and change the shape of tomato fruits. Therefore, a transgenic mutant strain with a SlEIN4 gene deletion can be constructed through a gene editing vector to increase the hardness of tomato fruits and change the shape of the fruits.

[0026] Application of recombinant expression vectors and gene editing vectors in regulating tomato fruit traits.

[0027] The fruit hardness of tomato plants with overexpression of the SlEIN4 gene is reduced; the fruit hardness of tomato plants with SlEIN4 gene knockout is significantly improved, and the fruit shape becomes pointed and slender, which is of great significance for accurately controlling the hardness and shape of tomato fruits to meet the needs of different consumers. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the expression level of the SlEIN4 gene in each tissue of the wild-type tomato plant in Experimental Example 1 of the present invention;

[0029] Figure 2 This is the vector map of the SlEIN4 gene recombinant expression vector pGate8-SlEIN4 in Experimental Example 3 of the present invention;

[0030] Figure 3 This is the vector map of the SlEIN4 gene editing vector CP098-SlEIN4 in Experimental Example 4 of the present invention;

[0031] Figure 4is the expression level of the SlEIN4 gene in the fruits of the SlEIN4 gene overexpression and gene-edited strains in Experimental Example 5 of the present invention (WT represents non-transgenic wild-type tomatoes, OE-18 and OE-19 represent two SlEIN4 overexpression strains, CR-11 and CR-12 represent two SlEIN4 gene-edited strains; asterisks represent strains with significant differences from the control, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001);

[0032] Figure 5 This is a comparison of the ripening process of SlEIN4 gene overexpression and gene editing strains and wild-type tomato fruits in Experimental Example 6 of the present invention;

[0033] Figure 6 This is a diagram showing the fruit shape changes of the SlEIN4 gene-edited fruit in Experimental Example 6 of the present invention (A and B are wild-type tomato fruits, C and D are SlEIN4 gene-overexpressing fruits, and E and F are SlEIN4 gene-edited fruits);

[0034] Figure 7 This is a statistical graph of the fruit shape index of the fruit of the S1EIN4 gene overexpression strain and the fruit of the S1EIN4 gene editing strain in Experimental Example 6 of the present invention (the asterisk represents a significant difference between the strain and the control, *P<0.05);

[0035] Figure 8 This is a statistical chart of the fruit hardness of the fruits of the SlEIN4 gene overexpressing strain and the SlEIN4 gene editing strain at the red ripe stage in Experimental Example 6 of the present invention (asterisks represent significant differences between the strains and the control, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). DETAILED DESCRIPTION

[0036] The present invention is further described below in conjunction with specific implementation methods, but the protection scope of the present invention is not limited thereto; unless otherwise specified, various reagents, instruments, etc. used in the examples are commercially available products.

[0037] Some of the biological materials, experimental reagents, experimental equipment, etc. involved in the following embodiments and test examples are briefly introduced as follows:

[0038] Biomaterials:

[0039] Micro Tom tomatoes, grown at the College of Horticulture, Henan Agricultural University.

[0040] Example 1 of Application of S1EIN4 Gene in Regulating Tomato Fruit Traits

[0041] In this example, the SlEIN4 gene is stably overexpressed in tomatoes, thereby reducing the firmness of tomato fruits; and the SlEIN4 gene is knocked out in tomatoes to inhibit the expression of the SlEIN4 gene, thereby increasing the firmness of tomato fruits and making the fruit shape pointed and elongated.

[0042] Example 1 of recombinant expression vector

[0043] The recombinant expression vector in this example contains the S1EIN4 gene; the nucleotide sequence of the S1EIN4 gene is shown in SEQ ID NO: 1.

[0044] Example 1 of gene editing vector

[0045] The gene editing vector in this embodiment comprises a target site knockout sequence designed according to the SlEIN4 gene; the nucleotide sequence of the SlEIN4 gene is shown in SEQ ID NO: 1.

[0046] Example 1 of application of recombinant expression vector

[0047] In this example, an overexpression vector containing the SlEIN4 gene was transferred into tomato plants, and the SlEIN4 gene was stably overexpressed in tomatoes, thereby constructing a tomato strain with overexpression of the SlEIN4 gene. The firmness of tomato fruits in this tomato strain was reduced.

[0048] Example 1 of application of gene editing vector

[0049] In this embodiment, the gene editing vector is a CRISPR / Cas9 vector. After the vector is transformed into a tomato plant, a tomato strain with SlEIN4 gene knockout is constructed. The tomato fruit of this tomato strain has increased hardness, and the fruit shape becomes pointed and slender.

[0050] Experimental Example 1 Detection of the expression level of tomato SlEIN4 gene

[0051] Different tissues and organs of tomato (Micro Tom) were collected, and the expression pattern of SlEIN4 gene was analyzed by fluorescence quantitative PCR. The relevant experimental process is shown below.

[0052] Primer Premier 5.0 was used to design specific primers for QRT-PCR. The primer sequences are as follows:

[0053] Q-S1EIN4-F: 5'-AAGCATGTTTCTTTACCATACCACC-3' (sequence as shown in SEQ ID NO: 3);

[0054] Q-S1EIN4-R: 5′-CATCAACCTTTCTATTATCGCCAGT-3′ (the sequence is shown in SEQ ID NO: 4).

[0055] RNA was extracted from various tissues of wild-type tomatoes, and then reverse transcribed and analyzed by QRT-PCR. The tomato internal reference gene Q-actin was used as a control, and the amplification primers of the internal reference gene Q-actin were Q-actin-F and Q-actin-R.

[0056] Q-actin-F: 5'-GTCCTCTTCCAGCCATCCAT-3' (sequence as shown in SEQ ID NO: 5);

[0057] Q-actin-R: 5'-ACCACTGAGCACAATGTTACCG-3' (the sequence is shown in SEQ ID NO: 6).

[0058] QRT-PCR amplification reaction system: AceQ Universal SYBR qPCR Master Mix 5ul, cDNA 4.2ul, upstream and downstream primers 0.4ul each, a total of 10ul. QRT-PCR reaction procedures refer to instrument specifications.

[0059] Reference 2 －ΔΔCT The quantitative data analysis was performed by Figure 1 As shown, SlEIN4 is highly expressed in the fruit, indicating that the SlEIN4 gene may play a role in the growth and development of tomato fruit. Since its expression level is highest in the green ripe stage, it indicates that SlEIN4 may be involved in the regulation of fruit ripening.

[0060] Experimental Example 2 Obtaining the full-length sequence of the tomato SlEIN4 gene

[0061] The cloning and acquisition process of the SlEIN4 gene is shown below.

[0062] Primer Premier 5.0 was used to design primers for whole gene amplification. Specific primers SlEIN4-F and SlEIN4-R were designed. The primer sequences are as follows:

[0063] SlEIN4-F: 5'-ATGGCGGCAGTAGGTATTGT-3' (sequence shown in SEQ ID NO: 7);

[0064] S1EIN4-R: 5′-CTATGTTCTCTTCTCATCACCCATC-3′ (the sequence is shown in SEQ ID NO: 8).

[0065] The wild-type tomato Micro Tom (MT) leaf cDNA planted in the greenhouse of the College of Horticulture of Henan Agricultural University was used as a template (the cDNA was extracted using conventional techniques, for example, the cDNA extraction method disclosed in Chinese invention patent CN104561025A can be referred to), and the SlEIN4 fragment was amplified using the above primers using PrimerSTAR high-fidelity enzyme PCR.

[0066] The PCR amplification reaction system and the PCR reaction program are shown in Tables 1 and 2, respectively. The obtained PCR product was identified by 1% agarose gel electrophoresis, and then the amplified band was recovered by FastPure Gel DNA Extraction Mini Kit. The obtained nucleotide sequence of the SlEIN4 gene is shown in SEQ ID No: 1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2.

[0067] Table 1 PCR amplification reaction system

[0068] Reaction components Usage 2xPhanta Flash Master Mix(Dye Plus) 25μL cDNA 2μL SlEIN4-F 2μL SlEIN4-R 2μL <![CDATA[ddH2O]]> Up to 50μL

[0069] Table 2 PCR reaction procedure

[0070]

[0071] Experimental Example 3 Construction of recombinant expression vector

[0072] In order to further understand the role of the SlEIN4 gene in regulating tomato traits, a recombinant expression vector was constructed to overexpress the SlEIN4 gene in tomato plants. The construction process is briefly described below.

[0073] First, the pGate8-SlEIN4 vector with CaMV35S recombinant overexpression promoter was constructed and homologous recombination reaction (using homologous recombination kit ( II One Step Cloning Kit (Vazyme) (the method is as described in the actual and instruction manual) to connect the SlEIN4 gene fragment to the pHellsgate8 final vector.

[0074] After the reaction, the product of the homologous recombination reaction was heat-shocked at 42°C and transferred into the competent E. coli DH5α. After screening with spectinomycin, the pHellsgate8 recombinant plasmid with the target fragment was screened by colony PCR (the pHellsgate8 recombinant plasmid is the target fragment with a size of about 1000 bp) and sequenced for identification. The sequencing results were analyzed using DNAMAN software. The correct transformant was named pGate8-SlEIN4, and the vector map is shown in Figure 2 shown.

[0075] Experimental Example 4: Construction of gene editing vector

[0076] In order to further understand the role of the SlEIN4 gene in regulating tomato traits, a CRISPR / Cas9 expression vector for knocking out the SlEIN4 gene was constructed. The construction process is briefly described below.

[0077] The target of the SlEIN4 gene was designed based on the sequence of the tomato SlEIN4 gene and the recognition characteristics of the CRISPR / Cas9 system. The sgRNA target sequence is as follows:

[0078] Target 1: TCGTGAAGGCAAGCCATGCA (sequence as shown in SEQ ID NO: 9);

[0079] Target 2: TAAGGGCGTTGGCTTTTCCA (sequence as shown in SEQ ID NO: 10).

[0080] Note: Two targets are used simultaneously, and the mutation site is near the second target site.

[0081] Primers were synthesized according to the designed target and amplified using CP043 plasmid as template. The amplification primer sequences were as follows:

[0082] CS-Fw:

[0083] AATCTAACAGTGTAGTTTGTCGTGAAGGCAAGCCATGCAGTTTTAGAGCTAGAAATAGC (the sequence is shown in SEQ ID NO: 11);

[0084] CS-Rv:

[0085] CTATTTCTAGCTCTAAAACTGGAAAAGCCAACGCCCTTACAAACTACACTGTTAGA TTC (the sequence is shown in SEQ ID NO: 12).

[0086] The amplified fragment was connected to the CP098 vector, and the ligation product was transformed into E. coli competent cells. After picking positive clones, expanding the culture, and extracting the plasmid, the vector construction was confirmed to be successful by sequencing and named CP098-SlEIN4. The vector map is shown in Figure 3 shown.

[0087] Experimental Example 5 Construction and detection of tomato transgenic lines

[0088] The recombinant expression vector constructed in Experimental Example 3 and the gene editing vector constructed in Experimental Example 4 were transformed into Agrobacterium, and then transformed into tomato plants, to construct tomato plants with overexpression of the SlEIN4 gene and tomato plants with knockout of the SlEIN4 gene. After positive verification, the seeds of the T1 generation (plants grown by seed culture after the transformed plants grew up and set seeds) were sown and cultured. After testing, tomato plants with overexpression and knockout of the SlEIN4 gene were selected for subsequent trait research. The specific experimental process is shown below.

[0089] The recombinant expression vector pGate8-SlEIN4 or the gene editing vector CP098-SlEIN4 was combined and transferred to Agrobacterium GV3101, and tomato cotyledons were infected. Tissue culture seedlings were obtained through callus induction, resistance induction differentiation and rooting culture.

[0090] Positive transgenic tomato plants were verified by PCR and QRT-PCR, and the T1 generation seeds of positive transgenic tomato plants were sown on a kanamycin (50 mg / L) medium for germination. The seeds that met the conditions of 3:1 separation ratio of lateral roots to non-lateral roots on the kanamycin (50 mg / L) medium and gene expression level increased by more than two times were considered overexpressed. Two overexpression strains OE-18 and OE-19 with higher gene transcription levels were selected as research objects. The expression of SIEIN4 gene in SIEIN4 gene expression strains OE-18 and OE-19 is shown in Figure 2. Figure 4 shown.

[0091] Gene sequencing was used to verify the SlEIN4 gene-edited plants, and the plants with changed amino acid sequences, i.e., gene-edited plants, were selected as research objects. The expression of the SlEIN4 gene in the SIEIN4 gene-edited strains CR-11 and CR-12 was as follows: Figure 4 shown.

[0092] Experimental Example 6 Study on the characteristics of transgenic tomato lines

[0093] The overexpression tomato plants and knockout tomato plants obtained in Experimental Example 5 were cultured for subsequent fruit trait research. The specific experimental process is as follows.

[0094] 1. Study on fruit ripening and fruit shape of transgenic lines

[0095] The fruits of the SlEIN4 gene overexpression line and the gene-edited line reached the green ripe stage (MG) 35 days after the flowering period was marked compared with the wild-type tomato, and reached the color breaking stage (B) when the fruit tip turned red. Through phenotypic observation and statistics, the average number of days from flowering period marking to fruit color breaking of the wild-type tomato was about 37 days, the average number of days from flowering period marking to fruit color breaking of the SlEIN4 gene overexpression line (OE-18) was about 39 days, and the average number of days from flowering period marking to fruit color breaking of the SlEIN4 gene-edited line (CR-11) was about 31 days. The results showed that SlEIN4 gene overexpression delayed the ripening of tomato fruits, and SlEIN4 editing promoted the ripening of tomato fruits. Figure 5 shown.

[0096] The fruit shape of the SlEIN4 gene-edited strain changes from young fruit to young fruit. Compared with the wild-type fruit, the fruit tip is obvious and slender, such as Figure 5 , Figure 6 The vertical diameter (length from the fruit base to the fruit top) and the horizontal diameter (the diameter of the thickest part of the fruit) of the fruit in the red-ripe period were measured with a digital vernier caliper, and the fruit shape index (fruit shape index = fruit vertical diameter / fruit horizontal diameter) was calculated. Figure 7 The results showed that the SlEIN4 gene affects the shape of tomato fruit. Compared with the control group, the tomato fruit became significantly longer after the SlEIN4 gene was knocked out.

[0097] 2. Study on the hardness of transgenic tomato fruit

[0098] The wild type and transgenic materials were planted in the same greenhouse of the College of Horticulture of Henan Agricultural University. The flowering period was marked when the tomato plants grew four inflorescences. The flowers on each inflorescence were thinned to only four fruits. 35 days after flowering, the fruits stopped expanding and were all green, which was the mature green (MG) stage. 3 days after the green stage, the tops of the fruits turned red, which was the color breaking stage (Breaker, B). 3 days after the color breaking stage, it was the yellow ripe stage (Yellow, Y). 7 days after the yellow stage, it was the red ripe (R).

[0099] The fruits of the wild type and transgenic materials were picked at the same position and without obvious mechanical damage. Each fruit was measured at four points on the equator of the fruit using the instrument TA.XTplus (Godalming, UK). About 25 biological replicates were measured each time. A 5mm diameter metal probe was used at each measuring point. The measuring depth was 5mm and the measuring speed was 10mm / s (with the skin pierced as the standard). The maximum force that the fruit can withstand was used as an indicator to measure the hardness of the tomato fruit, and the unit is Newton (N).

[0100] The results are as follows Figure 8As shown in the figure, the tomato fruit firmness of the SlEIN4 gene overexpression lines OE-18 and OE-19 decreased, while the tomato fruit firmness of the SlEIN4 gene edited lines CR-11 and CR-12 increased significantly. This proves that the SlEIN4 gene can regulate the tomato fruit firmness, and reducing the expression of the SlEIN4 gene can significantly increase the tomato fruit firmness.

[0101] In summary, the present invention proves that the hardness and shape of tomato fruits can be regulated by regulating the expression of the ethylene receptor gene SlEIN4. Experiments have confirmed that compared with the control strain, the hardness of tomato fruits in the SlEIN4 gene overexpression strain is reduced, the hardness of tomato fruits in the SlEIN4 gene edited strain is significantly increased, and the fruit shape becomes significantly pointed and slender.

[0102] Finally, it is noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of SlEIN4 gene in regulating tomato fruit traits, characterized by: The nucleotide sequence of the SlEIN4 gene is shown in SEQ ID NO: 1; the tomato fruit trait is the hardness and shape of the tomato fruit.

2. The use of the S1EIN4 gene according to claim 1 in regulating tomato fruit traits, characterized in that: By overexpressing the SlEIN4 gene in the tomato genome through genetic transformation, the firmness of the tomato fruit was reduced; by inhibiting the expression of the SlEIN4 gene in the tomato genome, the firmness of the tomato fruit was increased, and the fruit shape became pointed and slender.

3. The use of the S1EIN4 gene according to claim 2 in regulating tomato fruit traits, characterized in that: The overexpression of the SlEIN4 gene in the tomato genome is to construct a SlEIN4 recombinant expression vector to overexpress the SlEIN4 gene.

4. The use of the S1EIN4 gene according to claim 3 in regulating tomato fruit traits, characterized in that: The method for constructing the recombinant expression vector is to connect the obtained SlEIN4 gene to the pHellsgate8 vector and sequence and identify it.

5. The use of the S1EIN4 gene according to claim 2 in regulating tomato fruit traits, characterized in that: The method for inhibiting the expression of the SlEIN4 gene in the tomato genome is to construct a gene editing vector to knock out the SlEIN4 gene.

6. The use of the S1EIN4 gene in regulating tomato fruit traits according to claim 5, characterized in that: The gene editing vector is constructed by connecting the target site double-stranded DNA designed and synthesized according to the SlEIN4 gene to the CP098 vector and sequencing and identifying it.

7. The use of the S1EIN4 gene in regulating tomato fruit traits according to claim 1, characterized in that: The tomato variety is Micro Tom.

8. Application of a recombinant expression vector and a gene editing vector in regulating tomato fruit traits, characterized in that: The tomato fruit traits are the hardness and shape of the tomato fruit; the recombinant expression vector contains the SlEIN4 gene; the nucleotide sequence of the SlEIN4 gene is shown in SEQ ID NO: 1; and the gene editing vector contains a target site knockout sequence designed according to the SlEIN4 gene.

Images