Molecular markers tightly linked to the major QTL for lutein content in wheat grains and their application

Abstract

The present invention relates to a molecular marker closely linked to a major effect QTL of wheat grain lutein content and its application, belonging to the field of molecular detection technology and crop genetic breeding. The present invention uses a DH population and wheat micro-core germplasm to perform genotyping and lutein content determination. Experiments have shown that the lutein content of the grains of wheat lines or varieties carrying the GG genotype is higher than that of the wheat lines or varieties carrying the AA genotype, indicating that the GG genotype has the function of increasing the lutein content of wheat grains, can be used to improve the lutein content of wheat grains, and is of great significance for breeding new high-lutein wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of molecular detection technology and crop genetic breeding, and relates to a KASP-Luc.6A.2 molecular marker tightly linked to a major effect QTL of wheat grain lutein content and an application thereof. Background Art

[0002] Lutein is a natural substance widely found in plants. It is brightly colored, non-toxic, safe, and can be used as a natural food additive (Landrum 2009). Lutein is also the main pigment in the macular area of ​​the human retina and is known as the "gold of the eyes". Since it cannot be synthesized in the human body, it must be ingested from the outside. Deficiency can lead to blindness. In addition, lutein also has antioxidant activity and is used to prevent age-related macular degeneration, cataracts, cardiovascular sclerosis, coronary heart disease, etc. (Fraser and Bramley 2004; Giordano et al. 2018; Oliver and Palou 2000).

[0003] Wheat is the second largest staple food crop in my country. Wheat grains are rich in natural pigments "carotenoids", of which lutein accounts for 80-90% (Digesù et al. 2009). With the development of my country's economy and the improvement of people's living standards, people's demand for daily food has gradually changed from "eating enough" and "eating well" to "eating nutritious and healthy". The appearance and nutritional quality of flour and pasta products have attracted much attention and have become an important goal of wheat quality improvement (Ashokkumar et al. 2020; Colasuonno et al. 2019; Mares DJ and Campbell A 2001; Ramachandran et al. 2010; Zhang Yuyu et al. 2013). Therefore, breeding wheat with high lutein content is an important research direction and breeding goal for improving crop nutrition and health quality. However, the current research on lutein is mainly focused on tetraploid durum wheat, and the research on ordinary hexaploid wheat is relatively small. Locating the major QTL for lutein content in common wheat grains, discovering its important regulatory genes, developing breeding molecular markers, and constructing a molecular breeding-assisted selection system are of great significance for accelerating the breeding process of high-lutein wheat varieties and improving quality breeding efficiency.

[0004] KASP (Kompetitive Allele-Specific PCR), or competitive allele-specific PCR, is a popular method for detecting SNPs in a flexible, economical and accurate manner. This method has been widely used in molecular marker-assisted breeding selection of wheat and rice crops.

[0005] At present, some studies have located some QTLs related to the lutein content in common wheat grains, but there are no reports of tightly linked molecular markers related to the lutein content in wheat grains and that can be used for molecular breeding. Therefore, discovering the QTL or gene for the lutein content in common wheat grains and constructing an economical and efficient KASP molecular marker detection system are of great guiding significance for selecting wheat with appropriate lutein content in grains and improving the lutein content in wheat using molecular biology techniques. Summary of the invention

[0006] In view of the above problems, the object of the present invention is to provide a molecular marker tightly linked to the major QTL of lutein content in wheat grains and its application. The major locus QLuc.6A.2 is located on chromosome 6A of wheat, and the physical distance on the Chinese Spring reference genome IWGSC RefSeq v2.1 is 35.73-74.42Mb. The major QTL can significantly increase the lutein content in wheat, which is of great significance for breeding new high-lutein wheat varieties.

[0007] To achieve the above purpose, the specific scheme adopted by the present invention is as follows:

[0008] In the first aspect, a molecular marker closely linked to a major QTL for lutein content in wheat grains is provided, wherein the major QTL locus QLuc.6A.2 is located on chromosome 6A of wheat, and the physical distance on the Chinese Spring reference genome IWGSC RefSeq v2.1 is 35.73–74.42 Mb;

[0009] The flanking sequence of the molecular marker closely linked to QLuc.6A.2 is shown in SEQ ID NO: 01, wherein M is A or G; the molecular marker is amplified using primers with sequences shown in SEQ ID NOs: 02-04.

[0010] In a second aspect, a KASP primer set for amplifying the above-mentioned molecular marker is provided, comprising three primer sequences, namely, a forward primer KASP-Luc.6A.2-FAM, a forward primer KASP-Luc.6A.2-HEX and a reverse primer KASP-Luc.6A.2-R; wherein, the sequence of the forward primer KASP-Luc.6A.2-FAM is shown in SEQ ID NO: 02, the sequence of the forward primer KASP-Luc.6A.2-HEX is shown in SEQ ID NO: 03, and the sequence of the reverse primer KASP-Luc.6A.2-R is shown in SEQ ID NO: 04.

[0011] In a third aspect, a kit containing the above-mentioned KASP primer set is provided.

[0012] In a fourth aspect, the invention provides the use of the above molecular marker, KASP primer set or kit in any of the following:

[0013] (a) Identify or assist in identifying the lutein content of wheat grains;

[0014] (b) Molecular marker-assisted breeding.

[0015] A fifth aspect provides a method for identifying the genotype of lutein content in wheat grains, comprising the following steps:

[0016] Step 1, extracting DNA of wheat to be tested;

[0017] Step 2: using the DNA extracted in step 1 as a template, and performing PCR amplification using primers shown in SEQ ID NOs: 02 to 04;

[0018] Step 3: Read the fluorescence data of the amplified product obtained in step 2, and perform genotyping according to the fluorescence color.

[0019] Beneficial effects: The present invention provides a major QTL locus for lutein content in wheat grains, the major QTL locus QLuc.6A.2 is located on chromosome 6A of wheat, the physical distance on the Chinese Spring reference genome IWGSC RefSeq v2.1 is 35.73–74.42 Mb, and can explain 6.57%-10.86% of the phenotypic variation. The present invention also provides a KASP primer KASP-Luc.6A.2 of a molecular marker IAAV7556 that is closely linked to the major QTL QLuc.6A.2 for lutein content in wheat grains, which can be used to assist in the selection of wheat with high lutein content, and is of great significance for breeding wheat varieties with high lutein content. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the chromosome location map of the major QTL QLuc.6A.2 for lutein content in wheat grains;

[0021] Figure 2 The genotyping (A) and lutein content comparison (B) of some individuals of KASP-Luc.6A.2 in the Jinchun 7 / Lin 1219DH population;

[0022] Figure 3 Figure 2 shows the genotyping of KASP-Luc.6A.2 in natural populations (A) and the comparison of lutein content (B). DETAILED DESCRIPTION

[0023] The present invention provides a major QTL site for lutein content in wheat grains. The major site QLuc.6A.2 is located on chromosome 6A of wheat, and the physical distance on the Chinese spring reference genome IWGSC RefSeq v2.1 is 35.73-74.42 Mb. The major QTL can significantly increase the lutein content in wheat, which is of great significance for breeding new high-lutein wheat varieties.

[0024] The present invention provides a KASP primer KASP-Luc.6A.2 of a molecular marker IAAV7556 closely linked to a major QTL site QLuc.6A.2 of lutein content in wheat grains, wherein the nucleotide sequence of the forward primer 1 (forward primer KASP-Luc.6A.2-FAM) of the primer is shown in SEQ ID NO: 02, the nucleotide sequence of the forward primer 2 (forward primer KASP-Luc.6A.2-HEX) thereof is shown in SEQ ID NO: 03, and the nucleotide sequence of the reverse primer (reverse primer KASP-Luc.6A.2-R) thereof is shown in SEQ ID NO: 04. The 5' ends of the forward primer 1 and the forward primer 2 are connected with different fluorescent label sequences, wherein the 5' end of the forward primer 1 is connected with a FAM fluorescent label sequence; and the 5' end of the forward primer 2 is connected with a HEX fluorescent label sequence.

[0025] The invention provides a kit for identifying a major QTL QLuc.6A.2 of lutein content in wheat grains. The primer in the kit is the KASP-Luc.6A.2.

[0026] The present invention provides a method for identifying a major QTL QLuc.6A.2 of lutein content in wheat grains and improving the lutein content in wheat.

[0027] The invention discloses a major QTL QLuc.6A.2 for lutein content in wheat grains. The major QTL can significantly increase the lutein content in wheat and has high value for breeding high-lutein wheat.

[0028] The invention discloses a KASP primer KASP-Luc.6A.2 of a molecular marker IAAV7556 tightly linked to a major QTL QLuc.6A.2 of lutein content in wheat grains. The molecular marker can be used to assist in the selection of wheat with high lutein content, which is of great significance for breeding wheat varieties with high lutein content.

[0029] The present invention is further described in detail below in conjunction with specific embodiments. The given examples are only for illustrating the present invention, but not for limiting the scope of the present invention.

[0030] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0031] Example 1. Location of the major QTL QLuc.6A.2 for lutein content in wheat grains.

[0032] 1. Construction of the doubled-haploid (DH) population of Jinchun 7 / Lin 1219.

[0033] The F1 generation was obtained by hybridizing Lin 1219, which has a high lutein content, as the female parent and Jinchun 7 as the male parent. The F1 generation was subjected to anther culture and chromosome doubling method to obtain a DH population containing 152 strains.

[0034] 2. Construction of genetic map.

[0035] The genomes of the parents Jinchun 7, Lin 1219 and their constructed DH population containing 152 lines were scanned using a 90K SNP chip to construct a genetic linkage map, which included 3470 SNP markers, covering 21 chromosomes of wheat with a total length of 2456.98 cM.

[0036] 3. Field trial planting.

[0037] The parents Jinmai No. 7 and Lin1219 and their DH populations were planted in Linfen water land (LFW18) in Shanxi Province in 2017-2018, Linfen dry land (LFR18) in Shanxi Province in 2017-2018, and Xinxiang, Henan Province (XXW19) in 2018-2019. A completely randomized block design was used with three biological replicates, a row length of 2 meters, a row spacing of 25 cm, and 40 seeds per row. Field management measures were based on local production practices.

[0038] 4. Determination of lutein content in wheat grains.

[0039] The lutein content of wheat grains was determined by high performance liquid chromatography (Irakli et al 2011). For details, see: Irakli MN, Samanidou VF, Papadoyannis IN (2011) Development and validation of an HPLC method for the simultaneous determination of tocopherols, tocotrienols and carotenoids in cereals after solid-phase extraction. J SepSci 34: 1375–1382. (https: / / doi.org / 10.1002 / jssc.201100077)

[0040] 5. QTL positioning of lutein content in wheat grains.

[0041] Combining the phenotypic data of Jinmai 7, Lin 1219 and their derived DH populations under LFW18, LFR18, XXW19 environments and BLUP, QTL IciMapping 4.2 software was used for QTL mapping. Finally, a major QTL QLuc.6A.2 controlling lutein content was located on wheat chromosome 6A and could be detected under LFW18, XXW19 and BLUP. The confidence interval on the genetic map was 65.6-67.9 cM ( Figure 1 ), the physical distance corresponding to Chinese Spring (IWGSC RefSeq v2.1) was 35.73-74.42 Mb, and the phenotypic variation that could be explained was 6.57%-10.86%. The superior allele of this QTL originated from the parent Lin 1219.

[0042] Example 2: Obtaining the tightly linked marker KASP-Luc.6A.2 for the major QTL QLuc.6A.2 for lutein content in wheat grains.

[0043] According to Example 1 Figure 1 The genetic map of the major QTL QLuc.6A.2 for lutein content in wheat grains showed that the marker most closely linked to QLuc.6A.2 was IAAV7556.

[0044] The flanking sequence of IAAV7556 was searched by wheat 90K SNP chip, specifically TCGGCGGGGCTGTGGCTTTAGCCTGTACTCTCGACCAAGGGCTCCTGACAAAGGCTCTCATCTTTGGCGTTGCACGGAAGTTTGTGGGGCAGAGGAATAC[A / G]TTGTAGGATCTGACATCTTCCTCAGGATCCTCTGAGCCAATTTGCGTGGAGAATGGAGATGATCTGGCTAACTGTAGCACATGCCGTTGATGGCAGAT, as shown in SEQ ID NO: 01. According to the design rules of KASP primers, IAAV7556 was converted into a KASP-Luc.6A.2 marker, and a pair of KASP primers was designed, including 3 primer sequences (sequences such as SEQ ID NOs: 02 to 04), as shown in SEQ ID NO: 02 to 04, as shown in SEQ ID NO: 01.

[0045] Forward primer KASP-Luc.6A.2-FAM: GAAGGTGACCAAGTTCATGCTAGTTTGTGGGGCAGAGGAATACA

[0046] Forward primer KASP-Luc.6A.2-HEX: GAAGGTCGGAGTCAACGGATTGTTTGTGGGGCAGAGGAATACG

[0047] Reverse primer KASP-Luc.6A.2-R: AGGATCCTGAGGAAGATGTCAGATC;

[0048] Among them, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent label sequence carried by the 5' end of forward primer 1, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent label sequence carried by the 5' end of forward primer 2.

[0049] Example 3: Application of KASP-Luc.6A.2 marker in Jinmai No. 7 / Lin 1219DH population.

[0050] The DNA of the parents Jinmai 7, Lin 1219 and their DH population were extracted by CTAB method, and the genotyping of the parents and DH population was performed using KASP-Luc.6A.2 marker.

[0051] 1.Prepare KASP primer working solution.

[0052] The forward primer and reverse primer were diluted into 100 μM stock solution respectively, and then 12 μL forward primer KASP-Luc.6A.2-FAM, 12 μL forward primer KASP-Luc.6A.2-HEX, 30 μL reverse primer KASP-Luc.6A.2-R and 46 μL ddH2O were mixed to form KASP-Luc.6A.2Assay Mix working solution.

[0053] 2. PCR reaction system, procedure and genotyping.

[0054] The 10 μL reaction system for a 96-well plate is as follows: 5 μL KASP Master mix, 1.5 μL DNA (about 60 ng), 0.14 μL KASP-Luc.6A.2Assay Mix working solution, and 3.5 μL ddH2O.

[0055] The PCR reaction procedure is as follows:

[0056] Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles, decreasing by 0.6°C each cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 26 cycles; 37°C for 1 min, 37°C for 1 s (scanning fluorescence values ​​for genotype reading).

[0057] Roche LC480 version II was used for PCR reaction and data analysis. Figure 2 This is a partial test result of KASP-Luc.6A.2 marker in Jinmai 7 / Lin 1219DH population and a comparison of lutein content. Figure 2 The genotyping results of A showed that the genotype of the samples aggregated on the X-axis showing blue was the allele type AA connected to the FAM fluorescent label sequence, which was consistent with the parent Jinmai No. 7; the genotype of the samples aggregated on the Y-axis showing green was the allele type GG connected to the HEX fluorescent label sequence, which was consistent with the parent Lin 1219.

[0058] The tightly linked marker KASP-Luc.6A.2 of the QTL QLuc.6A.2 related to the lutein content in wheat grains was used for detection, and the lutein content of different genotype lines ( Figure 2 B) shows that the lutein content of the grains of the strain with genotype GG (average value 1.56ug / g) is significantly higher than that of the strain with genotype AA (average value 1.44ug / g). The above results show that the QTL QLuc.6A.2 related to the lutein content of wheat grains of the present invention has the effect of significantly increasing the lutein content of grains, and the molecular marker KASP-Luc.6A.2 of the present invention can be used to identify QLuc.6A.2.

[0059] Example 4: Application of KASP marker KASP-Luc.6A.2 to detect wheat mini-core germplasm resources.

[0060] 65 wheat mini-core germplasm resources were randomly selected and planted in Xinxiang, Henan (XXW18) in 2017-2018, Linfen, Shanxi (LFW19) in 2018-2019, and Linfen, Shanxi (LFR19) in 2018-2019. After the grains were harvested, the lutein content of the wheat grains was determined according to Implementation Case 1, and the KASP marker KASP-Luc.6A.2 was used for detection according to Implementation Case 3. The results are as follows Figure 3 , 25 materials were genotyped as AA, with an average lutein content of 2.03ug / g; 36 materials were genotyped as GG, with an average lutein content of 2.96ug / g; 4 materials were genotyped as AG, with an average lutein content of 2.56ug / g. The above results show that the lutein content of wheat varieties carrying the AA genotype is significantly lower than that of wheat varieties carrying the GG genotype, and wheat varieties carrying the GG genotype contain higher lutein content.

[0061] In summary, the lutein content of wheat varieties with KASP-Luc.6A.2 genotype AA was significantly lower than that of wheat varieties with KASP-Luc.6A.2 genotype GG.

[0062] It should be noted that the above-described embodiments should be understood as illustrative rather than limiting the scope of protection of the present invention, and the scope of protection of the present invention shall be subject to the claims. For those skilled in the art, some non-essential improvements and adjustments made to the present invention still fall within the scope of protection of the present invention without departing from the essence and scope of the present invention.

Claims

1. Use of a KASP primer set for detecting a molecular marker tightly linked to a major QTL for lutein content in wheat grains or a kit comprising the KASP primer set in any of the following: (a) Identify or assist in identifying the lutein content of wheat grains; (b) Molecular marker-assisted breeding of wheat grain lutein content; The major QTL locus QLuc.6A.2 is located on chromosome 6A of wheat, and its physical distance on the Chinese Spring reference genome IWGSCRefSeq v2.1 is 35.73–74.42 Mb; the flanking sequence of the molecular marker closely linked to QLuc.6A.2 is shown in SEQ ID NO: 01, wherein M is A or G; the KASP primer set includes three primer sequences, namely, forward primer KASP-Luc.6A.2-FAM, forward primer KASP-Luc.6A.2-HEX and reverse primer KASP-Luc.6A.2-R; wherein, The sequence of the forward primer KASP-Luc.6A.2-FAM is shown in SEQ ID NO: 02, the sequence of the forward primer KASP-Luc.6A.2-HEX is shown in SEQ ID NO: 03, and the sequence of the reverse primer KASP-Luc.6A.2-R is shown in SEQ ID NO:

04.

2. A method for identifying the genotype of wheat grain lutein content trait, characterized in that: The following steps are involved: Step 1, extracting DNA of wheat to be tested; Step 2: using the DNA extracted in step 1 as a template, and performing PCR amplification using primers shown in SEQ ID NOs: 02 to 04; Step 3: Read the fluorescence data of the amplified product obtained in step 2, and perform genotyping according to the fluorescence color.

Images