Millet temperature-sensitive leaf color siwsl1 gene and application thereof

Abstract

The application discloses a millet temperature-sensitive leaf color SiWSL1 gene and application thereof. The application provides a protein, which is as follows (A1) or (A2) or (A3): (A1) a protein consisting of an amino acid sequence shown in sequence 2 in the sequence listing; (A2) a fusion protein obtained by connecting a tag to the N terminal and / or C terminal of the protein shown in sequence 2; (A3) a protein with the same function obtained by substituting, deleting and / or adding one or more amino acid residues to the amino acid sequence shown in sequence 2. The application takes millet variety Changnong No. 35 as a material, takes a temperature-sensitive leaf color mutant wsl1 as a main research material, carries out identification, agronomic trait and genetic mode analysis on the mutant, obtains the SiWSL1 gene, and carries out mutation on the gene to obtain a transgenic plant with a white striped leaf color phenotype.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a millet temperature-sensitive leaf color SiWSL1 gene and application thereof. BACKGROUND

[0002] Leaves are the main organs for photosynthesis of crops, and the leaf color is closely related to photosynthesis and yield. Improving the photosynthetic efficiency of crops can greatly improve the yield of crops. Transforming C3 crops such as rice and wheat into C4 crops through genetic engineering can effectively improve the utilization and conversion efficiency of CO2, thereby effectively ensuring future food security. At present, based on the classification of malate decarboxylase enzymes in bundle sheath cells, the known independent C4 photosynthesis of Poaceae is generally divided into NADP-ME, NAD-ME and PCK three types, and crops in the Panicoidae subfamily cover all three types of C4 photosynthesis. Millet and green dog tail grass belong to NADP-ME and are located at the transition position of different C4 photosynthesis types, and the formation mechanism of their C4 high photosynthetic efficiency has a relatively universal representation. Although corn and sorghum, which belong to the Panicoidae subfamily, are also NADP-ME C4 crops, they are difficult to genetically transform due to their large size, and are difficult to use for large-scale C4-related basic research. Millet and green dog tail grass are small in size and easy to genetically manipulate, and have a unique advantage in the field of C4 pathway formation mechanism research. From the existing research results, C4-related genes in millet are also widely present in C3 plants, and it is speculated that changes in protein structure, enzyme activity variation and more transcriptional regulation mechanisms may play a role in the C4 pathway formation mechanism of millet.

[0003] Leaf color mutant is also called chlorophyll mutant, which directly or indirectly affects the synthesis and degradation of chlorophyll, and changes the content of chlorophyll. Chlorophyll mutation is controlled by two different genetic systems of nuclear genes and plastid genes, most of which are controlled by single recessive nuclear genes, and a few of which are controlled by two pairs of nuclear genes. At present, in Arabidopsis, related genes in the chlorophyll synthesis process have been identified, and leaf color mutants have been obtained in rice, corn, barley, wheat and other crops. Among them, more than 160 leaf color mutants have been identified in rice, which are classified into eight types of albino, yellowing, temperature-sensitive color change, bright green, evergreen, striped, green and purple according to the phenotype, and more than 30 regulatory genes have been cloned using these mutants, which are mainly concentrated in the genes encoding enzymes in the chlorophyll synthesis and degradation pathways.

[0004] With the continuous improvement of the research platform in the related field, the C4 high light efficiency mechanism research taking millet and green bristle grass as the research model will usher in a period of rapid development. Because millet has the characteristics of C4 high light efficiency, its close wild species green bristle grass has been used as a high light efficiency research model plant by the international C4 rice research project (funded by the Gates Foundation) and the Cold Spring Harbor Laboratory, and relevant work has achieved stage results in C4 structure physiology and metabolic regulation pathways. Therefore, it is imminent to carry out screening, identification and genetic mechanism research on the leaf color mutant related to the C4 photosynthesis pathway of millet. SUMMARY

[0005] The purpose of the present application is to provide a millet temperature-sensitive leaf color SiWSL1 gene and its application.

[0006] In the first aspect, the present application first protects a protein, which is as follows (A1) or (A2) or (A3) or (A4):

[0007] (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing;

[0008] (A2) a protein consisting of the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing;

[0009] (A3) a fusion protein obtained by connecting a tag to the N terminus and / or C terminus of the protein shown in SEQ ID NO: 2 or SEQ ID NO: 4;

[0010] (A4) a protein having the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4.

[0011] The protein is derived from millet and is named SiWSL1 protein.

[0012] The above-mentioned protein can be artificially synthesized, or the encoding gene thereof can be first synthesized and then expressed biologically.

[0013] In the above-mentioned protein, the protein tag refers to a polypeptide or protein fused and expressed with the target protein by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0014] In the second aspect, the present application protects a nucleic acid molecule encoding the above-mentioned protein (named SiWSL1 gene).

[0015] The nucleic acid molecule is a DNA molecule as described in any one of (B1) to (B6):

[0016] (B1) a DNA molecule encoding the region as shown in SEQ ID NO: 1 of the sequence listing;

[0017] (B2) a DNA molecule as shown in SEQ ID NO: 1 of the sequence listing;

[0018] (B3) a DNA molecule encoding the region as shown in SEQ ID NO: 3 of the sequence listing;

[0019] (B4) a DNA molecule as shown in SEQ ID NO: 3 of the sequence listing;

[0020] (B5) a DNA molecule hybridizing under stringent conditions to the DNA sequence defined in any one of (B1) to (B4) and encoding a SiWSLl protein;

[0021] (B6) a DNA molecule having 90% or more homology with the DNA sequence defined in any one of (B1) to (B4) and encoding a SiWSLl protein.

[0022] The above stringent conditions are hybridization in a solution of 2 x SSC, 0.1% SDS at 68°C and washing the membrane twice for 5 min each time, and then hybridization in a solution of 0.5 x SSC, 0.1% SDS at 68°C and washing the membrane twice for 15 min each time.

[0023] In a third aspect, the present application protects a biological material related to the SiWSLl protein or the SiWSLl gene; the biological material is any one of the following (1) to (8)

[0024] (1) an expression cassette containing the above gene;

[0025] (2) a recombinant expression vector containing the above gene or the expression cassette of (1);

[0026] (3) a transgenic cell line or a recombinant bacterium containing the above gene or the expression cassette of (1) or the recombinant expression vector of (2);

[0027] (4) a nucleic acid molecule capable of reducing the activity and / or expression amount of the above protein;

[0028] (5) a nucleic acid molecule capable of inhibiting the expression of the above gene;

[0029] (6) an expression cassette containing the nucleic acid molecule of (4) or (5);

[0030] (7) a vector containing the nucleic acid molecule of (4) or (5) or the expression cassette of (6);

[0031] (8) a transgenic cell line or a recombinant bacterium containing the nucleic acid molecule of (4) or (5) or the expression cassette of (6) or the vector of (7).

[0032] In a fourth aspect, the present application protects the use of the above-mentioned SiWSL1 protein or SiWSL1 gene or the above-mentioned biological material in regulating the leaf color phenotype of a plant. The regulation specifically refers to changing the leaf color phenotype of a plant. In the embodiments of the present application, the mutant wsl1 with white striped leaves is restored to green leaves by complementing the SiWSL1 gene.

[0033] The use of a substance that reduces the activity and / or expression amount of the protein described in sequence 2 in the target plant in changing the green phenotype of a plant into a white striped phenotype is also within the protection scope of the present application.

[0034] Or, the use of a substance that inhibits the expression of the nucleic acid molecule described in sequence 1 in the target plant in changing the green phenotype of a plant into a white striped phenotype is also within the protection scope of the present application.

[0035] Or, the use of a substance that mutates the protein described in sequence 2 into the protein described in sequence 4 in the target plant in changing the green phenotype of a plant into a white striped phenotype is also within the protection scope of the present application.

[0036] The use of the protein described in sequence 2 or its encoding nucleic acid molecule in restoring the white striped phenotype of a plant into a green leaf phenotype of a plant is also within the protection scope of the present application.

[0037] In a fifth aspect, the present application protects a method for cultivating a transgenic plant, which is method A or method B.

[0038] The method A comprises the following steps: reducing the activity and / or content of the SiWSL1 protein in the target plant to obtain a transgenic plant; and the transgenic plant exhibits a white striped leaf color phenotype.

[0039] The method B comprises the following steps: performing gene editing on the SiWSL1 protein in the target plant to obtain a transgenic plant with a white striped leaf color phenotype.

[0040] In a sixth aspect, the present application protects a method for cultivating a transgenic plant, which is method C or method D.

[0041] The method C comprises the following steps: inhibiting the expression of the SiWSL1 gene in the target plant to obtain a transgenic plant; and the transgenic plant exhibits a white striped leaf color phenotype.

[0042] The method D comprises the following steps: performing gene editing on the SiWSL1 gene in the target plant to obtain a transgenic plant with a white striped leaf color phenotype.

[0043] The gene editing is to transfer the knockout vector pBWA(V)HU-ylCas9-WSL1 into a wild type callus to obtain a transgenic plant with a white striped leaf color phenotype.

[0044] In a seventh aspect, the present application also protects the use of the above-mentioned SiWSL1 protein or SiWSL1 gene or biological material or method in the research of plant chloroplast development and photosynthesis mechanism or plant breeding.

[0045] The plant described above is as follows (D1) or (D2) or (D3):

[0046] (D1) a dicotyledonous plant or a monocotyledonous plant;

[0047] (D2) a plant of the family Poaceae;

[0048] (D3) foxtail millet.

[0049] The foxtail millet can be specifically foxtail millet variety Changnong No. 35.

[0050] The present application takes the temperature-sensitive leaf color mutant wsl1 of foxtail millet variety Changnong No. 35 as the main research material, identifies the mutant, analyzes the agronomic characters and genetic mode, and preliminarily studies the chlorophyll content, cell morphology, chloroplast ultrastructure and photosynthetic characteristics of the mutant, and takes the F2 separation population of “wsl1 x Pinzi No. 39” hybridization as a positioning population, uses the resequencing BSA-seq strategy to finely locate the mutant gene SiWSL1, and obtains a transgenic plant with a white striped leaf color phenotype by mutating the gene. BRIEF DESCRIPTION OF DRAWINGS

[0051] Figure 1 It is the leaf color and young ear phenotype of wild type Changnong No. 35 and mutant wsl1 at the seedling stage. A, B and C: wild type and wsl1 leaf phenotype at the seedling stage; D and E: wild type and wsl1 young ear phenotype at the heading stage.

[0052] Figure 2 It is the difference in leaf color and young ear phenotype between mutant wsl1 and wild type (Changnong No. 35) under different temperature conditions. A-D: plant phenotype under 20℃; F-I: plant phenotype under 25℃; K-N: plant phenotype under 30℃; A, F and K: wild type seedling phenotype; B, G and L: wsl1 seedling phenotype; C, H and M: wild type seedling second leaf phenotype; D, I and N: wsl1 seedling second leaf phenotype; E: wild type (left) and wsl1 (right) young ear phenotype in late August-early September (average temperature is 17.5℃); J: wild type (left) and wsl1 (right) young ear phenotype in early August in Changzhi (average temperature is 22.8℃); O: wild type (left) and wsl1 (right) young ear phenotype in mid-July in Changzhi (average temperature is 25.9℃).

[0053] Figure 3 It is the fine mapping and candidate gene map-based cloning of SiWSL1 gene.

[0054] Figure 4 Analysis of WSL1 protein sequence.

[0055] Figure 5 Analysis of WSL1 expression pattern. A: Expression of WSL1 in various tissues and organs of wild type; B: Expression analysis of WSL1 in wild type and mutant seedling leaves under incubator L30 / D28, L25 / D23 and L20 / D18 conditions.

[0056] Figure 6 Subcellular localization of WSL1 and mutant wsl1 protein. GFP: fluorescence channel of target protein WSL1 and wsl1; Chl: chloroplast fluorescence channel; Bright Field: bright field; Merge: superimposed image of GFP, Chl and bright field.

[0057] Figure 7 Transgenic complementation of SiWSL1 and CRISPR-Cas9 verification. DETAILED DESCRIPTION

[0058] The following examples facilitate a better understanding of the present application, but do not limit the present application.

[0059] The experimental methods in the following examples are all routine methods, unless otherwise specified.

[0060] The experimental materials used in the following examples are all purchased from routine biochemical reagent stores, unless otherwise specified. The quantitative tests in the following examples are all set up with three repeated experiments, and the results are averaged.

[0061] The millet variety Changnong No. 35 is recorded in the following literature: Guo Erhu, Fan Huiping, Wang Xiujing, et al. Breeding of New High-Quality Millet Variety Changnong No. 35 [J]. China Agricultural Science Bulletin, 2008(08): 198-201. The variety is a millet variety selected by the Millet Institute of Shanxi Academy of Agricultural Sciences and approved by the state in 2005, and is now a national millet variety regional adaptability joint identification control variety. The public can obtain it from the Millet Institute of Shanxi Academy of Agricultural Sciences.

[0062] Example 1, Identification of millet white stripe leaf white spike mutant wsl1

[0063] I. Phenotypic identification and agronomic trait analysis of millet white stripe leaf color mutant wsl1

[0064] A spontaneous mutant with white-striped leaf color was obtained from millet variety Changnong 35, named Changnong 35 mutant wsl1 and deposited in the National Germplasm Repository (No. 00029710). The mutant wsl1 and wild type were simultaneously planted in the experimental field of the Millet Institute of Shanxi Agricultural University at the appropriate sowing period. Ten plants of each were selected at the seedling stage, heading stage and mature stage for investigation of agronomic traits, including heading stage, plant height, length of lower internode, first internode thickness, second internode thickness, third internode thickness, ear length, ear thickness, ear weight, ear grain weight, 1000-grain weight and seed setting rate.

[0065] The results are shown in Table 1. Figure 1 and Table 1.

[0066] The results show that the leaf and young ear color phenotype of the mutant is white at the 3-leaf stage, gradually turns green along the veins from the new leaf tip at the 4-5 leaf stage, and completely turns green at the adult stage. The inner and outer glumes of the young ear are white, the ear axis and small branch are green, and the glume shell turns yellow after maturation. Figure 1 Compared with the wild type, the mutant wsl1 has extremely significantly prolonged heading stage, extremely significantly increased plant height, significantly increased 1000-grain weight, extremely significantly increased length of lower internode, and extremely significantly decreased ear thickness, ear weight, ear grain weight and seed setting rate (Table 1), but has no obvious difference in ear length, first internode thickness, second internode thickness and third internode thickness.

[0067] Table 1 Comparison of agronomic traits and yield traits of Changnong 35 and wsl1

[0068]

[0069] II. Comparison of agronomic traits and yield traits of Changnong 35 and wsl1

[0070] According to the phenotype of the mutant wsl1 under different environmental temperatures, under the same conditions of soil, water and light, three temperatures of 20°C, 25°C and 30°C were set, and the mutant wsl1 and wild type were planted in an artificial climate incubator to observe the leaf color change and growth status at the seedling stage. The wild type and mutant were sown in the field in April, May and June under different environmental temperatures, and the corresponding heading stages were in mid-July, early August and late August to early September, respectively, to observe the color of the inner and outer glumes of the mutant at the early heading stage.

[0071] The results are shown in Table 1. Figure 2The results show that the mutant wsl1 phenotype is different under different temperature conditions. At 20℃, the mutant shows white stripe phenotype; at 25℃, the mutant leaf shows white stripe; and at 30℃, the mutant leaf and the wild type have no obvious difference at each period (green leaf), so the material belongs to low temperature sensitive mutant, at the same time, the mutant inner and outer glume color of the ear shows corresponding temperature sensitivity, under the condition of lower temperature from late August to early September, the inner and outer glume of the mutant ear is white.

[0072] Example 2, fine mapping of millet white stripe leaf color mutant wsl1

[0073] I. Genetic analysis of millet white stripe leaf color mutant wsl1

[0074] By constructing "wsl1 x Changnong No. 35", "Changnong No. 35 x wsl1" reciprocal F2 populations with wild type Changnong No. 35 which has relatively consistent genetic background with wsl1, and selecting 09K65 and Zichan No. 39 which have large genetic differences with wsl1 to construct "wsl1 x 09K65" and "wsl1 x Zichan No. 39" hybrid self-cross F2 segregation populations, the four populations are planted in the field by hole seeding, and the population size is about 150 plants. The segregation ratio of F2 seedling green leaf and white stripe leaf (chi-square test) is investigated and counted to determine the genetic way of the mutant.

[0075] The genetic analysis results show that in the mutant wsl1 and wild type reciprocal combination, and in the mutant wsl1 and 09K65, Zichan No. 39 hybrid combination, the leaf color and young ear color of all F1 plants are consistent with the phenotype of green parent, showing green leaf and green ear, and the F2 offspring are all separated, the leaf color has green and white stripe, the young ear has green and white, and the two traits are co-segregated. After chi-square χ 2 test, the trait segregation ratio is consistent with 3:1 (green: white stripe) segregation (Table 2), which shows that the white stripe leaf color is controlled by a pair of recessive nuclear genes.

[0076] Table 2 is the leaf color segregation analysis of different F2 populations

[0077]

[0078] Note: χ 2 0.05 = 3.84.

[0079] II. Fine mapping of SiWSL1 gene and candidate gene map-based cloning

[0080] A F2 population of 416 plants of the cross "wsl1 x Pinzi 39" was planted in a field. 50 dominant plants and 50 recessive plants were selected from the F2 population of the cross "wsl1 x Pinzi 39" to construct a pool, respectively. By re-sequencing BSA-seq method, the SiWSL1 gene was located in the 3.34 Mb (1132000-1608000) region of the 9th chromosome of foxtail millet by using SNP-index two kinds of association mapping methods. Further, 1393 F2 recessive plants were used to find variation sites (InDel and SNP) in the located interval according to the results of parent re-sequencing. 12 InDel markers and 2 CAPS markers (Table 3) were developed by the applicant, and the interval was reduced to the 19.78 kb physical interval between markers MRI607 and MRI844. Figure 3

[0081] Table 3 is the information of 12 InDel markers and 2 CAPS markers developed by the applicant

[0082]

[0083] Note: The CAPS markers are highlighted in bold.

[0084] The target segment was searched by using Phytozome Setaria italica v2.2 (https: / / phytozome.jgi.doe.gov / pz / portal.html#!info?alias=Org_Sitalica) database, and it was found that there were 4 open reading frames (ORFs) in the interval. Functional annotation showed that ORF1 (Seita.9G185600) encoded a pentatricopeptide repeat (PPR) protein, ORF2 (Seita.9G185700) and ORF3 (Seita.9G185800) were both unknown function expression proteins, and ORF4 (Seita.9G185900) encoded a low oligosaccharide glycosyltransferase γ subunit.

[0085] The genomic sequences of the 4 ORFs were cloned from the mutant and wild type, respectively. After sequence alignment, it was found that there was no difference in the sequences of ORF2, ORF3 and ORF4 except for the sequence of ORF1. Meanwhile, expression analysis showed that the expression of ORF1 was significantly different between the mutant and the wild type. It is preliminarily considered that ORF1 (Seita.9G185600) is a candidate gene for controlling the white stripe leaf color mutation trait.

[0086] III. Bioinformatics analysis of SiWSL1​

[0087] The conserved domain of SiWSL1 protein was analyzed by NCBI database (http: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi), and the subcellular localization of SiWSL1 protein and mutant protein was predicted by Chloro P (http: / / www.cbs.dtu.dk / services / ChloroP / ) and Target P (http: / / www.cbs.dtu.dk / services / TargetP / ).

[0088] The full length of SiWSL1 open reading frame is 2253 bp, and it does not contain intron. The genome sequence alignment found that there was a 189 bp deletion (including ATG) upstream and downstream of ATG of Siwsl1 in the mutant, which resulted in the change of the gene translation initiation site (start codon) (see Figure 4 ), and the protein prediction found that the mutant protein lacked 68 amino acids at the N-terminus. The prediction of SiWSL1 protein and mutant protein by Chloro P (http: / / www.cbs.dtu.dk / services / ChloroP / ) and Target P (http: / / www.cbs.dtu.dk / services / TargetP / ) found that there was a chloroplast transit peptide (CTP) at the N-terminus of SiWSL1 protein, and the mutant protein did not have a signal peptide (-) or had a small probability of having a signal peptide (0.121), which suggested that the 189 bp deletion was not directly related to the presence of the chloroplast transit peptide of the gene.

[0089] The cDNA sequence of wild type SiWSL1 gene is shown in sequence 1 of the sequence listing, and the coding region is 249-2501 of sequence 1, and the encoded protein is shown in sequence 2 of the sequence listing. The cDNA sequence of mutant SiWSL1 gene is shown in sequence 3 of the sequence listing, and the coding region is 264-2312 of sequence 3, and the encoded protein is shown in sequence 4 of the sequence listing.

[0090] The cDNA of mutant SiWSL1 gene lacks 189 bp compared with the cDNA of wild type SiWSL1 gene.

[0091] The mutant SiWSL1 protein lacks 68 amino acid residues compared with the wild type SiWSL1 protein.

[0092] Four, expression pattern analysis of SiWSL1

[0093] 1. Total RNA was extracted from various tissues of wild-type millet variety Changnong 35, including young leaves (3, 4, and 6 leaves), leaves at the jointing stage (10 leaves), flag leaves, young stems, developing stems, young panicles, heading, and roots. The RNA was transcribed into cDNA. RT-PCR was used to detect the expression of SiWSL1. Primer pair consisting of primers SiWSL1F and SiWSL1R was used to detect the expression of SiWSL1. Primer pair consisting of primers ACTIN-7 and ACTIN-7R was used to detect the internal reference gene ACTIN-7.

[0094] SiWSL1F: 5'-CTCATTGTTGCTCTATGCTCAC-3';

[0095] SiWSL1R: 5'-GGAGAAAGTCCCTTCACAGTTA-3';

[0096] ACTIN-7F: 5'TGATCTCACTGACAGTCTGATG 3';

[0097] ACTIN-7R: 5'ATGTCTCTTACAATTTCCCGC 3'.

[0098] The results are as follows Figure 5 As shown in Figure A, the results indicate that SiWSL1 is expressed in various tissues, including wild-type young leaves (3, 4, and 6 leaves), leaves at the jointing stage (10 leaves), flag leaves, young stems, seeding stems, young spikes, heading, and roots. It is a constitutively expressed gene, with the highest expression level in young leaves and the lowest expression level in roots.

[0099] 2. The expression of SiWSL1 in wild-type and mutant wsl1 seedlings (1 leaf and 1 heart) was detected by RT-PCR under the conditions of L30 / D28 (30℃ light for 14h, 28℃ darkness for 10h), L25 / D23 (25℃ light for 14h, 23℃ darkness for 10h) and L20 / D18 (20℃ light for 14h, 18℃ darkness for 10h) incubators. The primers used were the same as above.

[0100] The results are as follows Figure 5 As shown in Figure B, each group of bar charts has the wild-type WT on the left and the mutant wsl1 on the right. The results show that under the L30 / D28 condition, the expression of the SiWSL1 gene is low. As the temperature decreases, the expression level of the gene increases. Under the L20 / D18 condition, the expression of the SiWSL1 gene in both the wild-type and the mutant is significantly increased, indicating that the protein encoded by this gene is highly expressed in young leaves at low temperatures.

[0101] V. Subcellular localization of SiWSL1 protein

[0102] To understand the subcellular localization of WSL1 protein, first in the website Chloro P (http: / / www.cbs.dtu.dk / services / Chloro P / ) and Target P (http: / / www.cbs.dtu.dk / services / Target P / ) SiWSL1 protein was predicted, found that the N-terminal presence of chloroplast transit peptide (CTP), but its mutant signal peptide probability is small or does not exist.

[0103] 1. Constructing recombinant expression vector pBWA(V)HS-WSL1(WT)-GFP

[0104] The total RNA of wild type foxtail millet variety Changnong 35 was extracted and reverse transcribed into cDNA, and the cDNA was used as a template to perform PCR amplification with a primer pair composed of primer SiWSL1-YF and primer SiWSL1-YR to obtain a PCR amplification product. The PCR amplification product was connected to the vector pBWA(V)HS-GFP (Wuhan Boyuan Biology) by Bpi I enzyme digestion to obtain a recombinant expression vector pBWA(V)HS-WSL1(WT)-GFP (which has been sequenced and verified).

[0105] SiWSL1-YF: 5'-cagtGAAGACaacaacatggcctgcgcgtcgtacct-3';

[0106] SiWSL1-YR: 5'-cagtGAAGACaatacatctgtaagtccattgagggt-3'.

[0107] 2. Constructing recombinant expression vector pBWA(V)HS-wsl1(mutant)-GFP

[0108] The total RNA of mutant wsl1 was extracted and reverse transcribed into cDNA, and the cDNA was used as a template to perform PCR amplification with a primer pair composed of primer Swsl1-YF and primer Swsl1-YR to obtain a PCR amplification product. The PCR amplification product was connected to the vector pBWA(V)HS-GFP (Wuhan Boyuan Biology) by Bpi I enzyme digestion to obtain a recombinant expression vector pBWA(V)HS-wsl1(mutant)-GFP (which has been sequenced and verified).

[0109] Siwsl1-YF: 5'-cagtGAAGACaacaacatgctgaactcggcgctcgc-3';

[0110] Siwsl1-YR: 5'-cagtGAAGACaatacatctgtaagtccattgagggt-3'.

[0111] 3. Transform the recombinant expression vector obtained in step 1 and step 2 into protoplasts of rice variety 9311, respectively, and cultivate in dark at 28°C for 24-48h, and observe under laser confocal microscope.

[0112] The results are shown in Table 1. Figure 6 As shown in Table 1, WSL1 (wild type) is located in chloroplast and co-localized with chlorophyll autofluorescence (used as Marker for chloroplast), but wsl1 (mutant) is located in nucleus and not co-localized with chlorophyll autofluorescence, which is consistent with the prediction of bioinformatics for WSL1 protein and mutant protein, and the N-terminal deletion of 68 amino acids of mutant protein affects the subcellular localization of the protein.

[0113] Example 3, verification of SiWSL1 gene function

[0114] I. Transgenic complementation test

[0115] 1. Construction of complementation vector pBWA(V)HU-WSL1

[0116] Using the genomic DNA of wild type foxtail millet variety Changnong 35 as template, the primer pair composed of primer CSL1(+) and primer CSL1(-) was used for PCR amplification, and a PCR amplification product was obtained (the PCR product has nucleotides 249-2501 of SEQ ID NO: 1).

[0117] The PCR amplification product was digested with Aar I and ligated to pBWA(V)HU vector (Wuhan Boyuan Biotech), to obtain the complementation vector pBWA(V)HU-WSL1 (which has been sequenced and verified).

[0118] CSL1(+): 5'-cagtCACCTGCaaaacaacatggcctgcgcgtcgtacct-3';

[0119] CSL1(-): 5'-cagtCACCTGCaaaatacatcatctgtaagtccattgag-3'.

[0120] 2. The complementary vector pBWA(V)HU-WSL1 obtained in step 1 was first transformed into Agrobacterium competent cells EHA105. The bacterial solution was then used to genetically transform mature millet embryos by Agrobacterium infection (Yang ZR, Zhang HS, Li XK, et al (2020) A mini foxtail millet with an Arabidopsis-like life cycle as a C4 model system. Nature Plants, 6(9):1167-1178). pBWA(V)HU-WSL1 was then transformed into callus of mature wsl1 mutant embryos. 24 positive T0 generation lines were obtained by screening for callus resistance (hygromycin), which are the complementary lines.

[0121] 3. After harvesting seeds from 24 T0 positive lines, T1 generation complementary lines were planted for phenotypic observation, with wild type (millet variety Changnong 35) and mutant (wsl1) as controls.

[0122] The results are as follows Figure 7 As shown, the wild type has green leaves, wsl1 has a white striped phenotype, and the complementary line is the T1 generation complementary line. It can be seen that the seedling phenotype of the complementary line restored the wild type phenotype, and there are a total of 5 complementary lines.

[0123] Meanwhile, all five strains were positive after PCR verification (primers were CSL1(+) and CSL1(-), and the strain that yielded a 615bp amplification product was positive). Sequencing results showed that the white stripe phenotype of the wsl1 mutant was caused by a 189bp deletion in the SiWSL1 gene.

[0124] II. CRISPR-Cas9 Knockout Experiment

[0125] 1. Construct the knockout vector pBWA(V)HU-ylCas9-WSL1

[0126] Three targets were selected near the start codon of the SiWSL1 gene: target 1 (118 bp downstream of ATG, cccctccgcgtgtacgccgcctc), target 2 (18 bp downstream of ATG, cctagcctcctactcccgcgcct), and target 3 (near the 5' UTR region of ATG, ccaaatgcttgcggtattgccac). Intermediate vectors WSL1-Y1, WSL1-B1, and WSL1-A1 were constructed using these targets. Primers for the intermediate vectors were synthesized as follows:

[0127] WSL1-Y1 primers:

[0128] WSL1--Y1(+): cagtGGTCTCaggcagaggcggcgtacacgcggag

[0129] WSL1--Y1(-): cagtGGTCTCaaaacctccgcgtgtacgccgcctc

[0130] WSL1--Y2(+): cagtGGTCTCaggcaaggcgcgggagtaggaggct

[0131] WSL1--Y2(-): cagtGGTCTCaaaacagcctcctactcccgcgcct

[0132] WSL1--Y3(+): cagtGGTCTCaggcagtggcaataccgcaagcatt

[0133] WSL1--Y3(-): cagtGGTCTCaaaacaatgcttgcggtattgccac

[0134] Specifically as follows:

[0135] Firstly, the primer WSL1--Y1 is denatured and annealed to obtain the gRNA fragment of WSL1--Y1, which is cut by ECO31I and then connected to the empty vector pBWA(V)HU which is also cut by ECO31I to obtain the pBWD(V)HU-ylCas9-WSL1--Y1 plasmid;

[0136] Then, the primers WSL1--Y2 and WSL1--Y3 are respectively denatured and annealed to obtain the gRNA fragments of WSL1--Y2 and WSL1--Y3, respectively, to obtain the WSL1--Y2 and WSL1--Y3 plasmids, which are respectively cut by ECO31I and connected by T4 ligase to obtain the WSL1--Y2+Y3 double-target plasmid.

[0137] Then, the primers WSL1--Y2 and WSL1--Y3 are respectively denatured and annealed to obtain the gRNA fragments of WSL1--Y2 and WSL1--Y3, respectively, to obtain the WSL1--Y2 and WSL1--Y3 plasmids, which are respectively cut by ECO31I and connected by T4 ligase to obtain the WSL1--Y2+Y3 double-target plasmid.

[0138] The dual-target vector WSL1—Y2+Y3 was constructed by ligation using LguI restriction enzyme. Then, the correctly sequenced dual-target plasmid was ligated with the pBWD(LB)-WSL1—Y1 plasmid using LguI restriction enzyme digestion to construct the triple-target vector pBWD(V)HU-WSL1--Y1+Y2+Y3, abbreviated as pBWA(V)HU-ylCas9-WSL1 (bacterial detection band size: approximately 1700bp, Pbw2-: gcgattaagttgggtaacgccaggg, yl-F1: accggtaaggcgcgccgtagt). After sequencing, the triple-target vector plasmid pBWA(V)HU-ylCas9-WSL1 was obtained.

[0139] The three-target vector plasmid pBWA(V)HU-ylCas9-WSL1 is obtained by replacing the DNA molecule shown in sequence 5 of the sequence listing with the fragment between the Tnos and RNAi backbone sites of the pBWA(V)HU-ylCas9 vector (Wuhan Boyuan Biotechnology), resulting in the knockout vector pBWA(V)HU-ylCas9-WSL1 (which has been verified by sequencing).

[0140] In the DNA molecule shown in Sequence 5 of the pBWA(V)HU-ylCas9 vector insertion sequence, positions 382-401 are the gRNA fragment of WSL1-Y1, positions 874-893 are the gRNA fragment of WSL1-Y2, and positions 1366-1385 are the gRNA fragment of WSL1-Y3.

[0141] 2. Preparation of gene-edited positive lines

[0142] The knockout vector pBWA(V)HU-ylCas9-WSL1 obtained in step 1 was used to infect callus tissue induced from wild-type mature seeds via Agrobacterium-mediated transformation. After screening for callus resistance (hygromycin), the plants differentiated into seedlings, resulting in 9 gene-edited positive plants, which are the T0 generation gene-edited positive plants. The specific method is described in Yang ZR, Zhang HS, Li XK, et al. (2020) A mini foxtail millet with an Arabidopsis-like life cycle as a C4 model system. Nature Plants, 6(9):1167-1178.

[0143] 3. Molecular identification of gene-edited positive lines

[0144] Genomic DNA of leaf of T0 generation gene editing positive line was extracted as a template, and PCR amplification was carried out with MRI1121-F:(cas9yl-F3+:) AGAACCTCTCCGATGCTATCC (21 bp position at 5456-5478 of the vector) and MRI1121-R:(cas9yl-R3-:) AGCAAGAGGACCAACGTAG (19 bp position at 5925-5943 of the vector).

[0145] The amplification product contains a 430 bp product, which is a positive plant of successful gene editing, and 9 T0 generation positive plants of successful gene editing are obtained.

[0146] After being sent for sequencing, it was found that the SiWSL1 gene in the positive plant of successful gene editing occurred a frameshift mutation and could not encode SiWSL1 protein.

[0147] 4, Phenotype observation of gene editing positive line

[0148] After the T0 generation gene editing positive line was harvested, the T1 generation gene editing positive line (editing-1) was obtained by planting.

[0149] After sowing in the artificial climate chamber, the phenotype was observed when the seedlings grew to 2 leaves 1 heart, and the results are shown in Figure 7 It can be seen that the T1 generation gene editing positive line (editing-1) has a mutant phenotype of white striped leaves in the seedling stage.

[0150] The above results show that the mutation of the N-terminal of the gene by gene editing will cause the wild type to appear a mutant phenotype.

[0151] In combination with the above results, SiWSL1 is the target gene of the present application. SEQUENCE LISTING <110> Shanxi Academy of Agricultural Sciences Millet Research Institute <120> A warm-sensitive leaf color SiWSL1 gene of millet and application thereof <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 2501 <212> DNA <213> Artificial sequence <400> 1 gccttcgttg gctcgttgca gtcacggtgc cacactggat gcttcctctt tcccttcccc 60 tgttcgccag ctgcggcgag ccttgagttg agctcctctg cctcaatata cccgctttct 120 tctcagctcc gaccaacaat ccccttgctg cattctcccc agcggcgagc cttcgcttcg 180 cctgggcacc gccggcctcc gacctcgccc gctcgaggcg cgcaccaaat gcttgcggta 240 ttgccacaat ggcctgcgcg tcgtacctag cctcctactc ccgcgcctcg ccagcgccgg 300 cagcgtgccc gtgccatgtc cggccgcccg cgccgcgaac gcggcggcgt cgaccccgcc 360 ccgcgcccct ccgcgtgtac gccgcctccg accaccaaga gcggctcctc accgccctgc 420 gcgagcaggc ggaccccgag gcggcgctcc ggatgctgaa ctcggcgctc gcgcgggagg 480 acttcgcccc gagctccgac gtctacgagg agatcatccg gaagctcggg tccgccggcg 540 cgttcgacct gatgaagggg cttgtcgggg agatgcggcg ggaagggcac gaggtcaagg 600 ttggcatcgt gcagtcgttc gtggagagct acgcgcggct gcgccggttc gacgatgctg 660 tcgacctggt tctgaaccag ctcgacttgt tcggcgttca ggcggacacg gtcgtttaca 720 accacctcct caatgttctt gtggagggga gcaagatgaa gctactggag tcggtctaca 780 acgagatggc tagtcggggg atccgacctg atgttgtgac attcaatacc ctgatcaagg 840 ggctgtgccg ggcacatcag gtcaggactg cggtcttgat gctggaggag atgtcgagcc 900 atagtgtggc gcctgatgag accacattca ccaccttgat gcaaggcttt gttgaggagg 960 gaagcattga ggcggctttg agggtgaagg cgaagatgct ggagacgggg tgctctccaa 1020 caagggtaac agttaatgtt ctgattaatg ggtactgcaa gctggggaga gtggaagatg 1080 ctcttggcta catacagcaa gagattgcgg atggatttga acctgatcag gtcacataca 1140 atacttttgt tcatgggctg tgccaaaacg gacatgtcag tcatgccttg aaagtcatcg 1200 accttatgat tcaggagggc catgatcctg atgttttcac ctacaatact gttatcaatt 1260 gcctcagtaa aaatggagag cttgatgcgg ctaaaggaat tgtaaatgag atggtggata 1320 ggggttgctt gcctgacacc accacattca acactctcat tgttgctcta tgctcacaga 1380 atcgacttga ggaagcattg gaccttgcac gtgagctaac tgtgaaggga ctttctccag 1440 atgtttatac tttcaatatt ttgatcaatg ccctttgcaa ggtaggagat cctcatcttg 1500 gtatgcgatt gttcgaggag atgaagagca ctggatgcac ccctgatgaa gttacataca 1560 atatattgat tgatcatctt tgctcaatgg ggaagcttgg aaatgctttg gatttgttga 1620 aggagatgga atccagtggt tgccctcgga gtacagtgac atataacaca ataattgatg 1680 ggttatgcaa gaaaatgaga attgcagaag ccgaggaggt ttttgatcaa atggatatac 1740 atggtatttt aaggaatgct gtcacattta atacacttat tgatggcttg tgcaaggcca 1800 aaaggattga cgatgcaacg gaacttattg agcaaatgat aaaggaagga ttgcagcctg 1860 ataatatcac ttataattct attctaacac attattgcaa gcaaggaaac ataaagaaag 1920 cagctgatat tttagaaact atgacagcaa atggatttga agttgatgtt gtcacatatg 1980 gaacactcat taatggtcta tgcaaggctg gtaggactca ggttgctttg aagcttttaa 2040 gaggcatgcg aattaaaggg atgaggccta ctccaaaagc ttacaaccct gtcatacagt 2100 ctttgtttaa acggaataat ttaagagatg cccttaatct tttcagagag atgactgaag 2160 tgggtgagcc tcctgatgcc ctcacataca agattgtatt ccgtggtctc tgtcgtggtg 2220 gaggtcctat caaagaagct tttgatttct tggtggagat ggtgaataag ggtttcatgc 2280 cagagttttc atccttccgt atgctagctg aaggtctatt aaatctcggc atggatgatt 2340 atctaattag tgctattgaa ctagttatag aaaaggctga ctttagagag tctgatgctt 2400 ctgcaataag ggggtatctc aagatccgca aatattatga tgcattagca acttttggcc 2460 gtctcctaga gatcaacaac cctcaatgga cttacagatg a 2501 <210> 2 <211> 750 <212> PRT <213> Artificial sequence <400> 2 Met Ala Cys Ala Ser Tyr Leu Ala Ser Tyr Ser Arg Ala Ser Pro Ala 1 5 10 15 Pro Ala Ala Cys Pro Cys His Val Arg Pro Pro Ala Pro Arg Thr Arg 20 25 30 Arg Arg Arg Pro Arg Pro Ala Pro Leu Arg Val Tyr Ala Ala Ser Asp 35 40 45 His Gln Glu Arg Leu Leu Thr Ala Leu Arg Glu Gln Ala Asp Pro Glu 50 55 60 Ala Ala Leu Arg Met Leu Asn Ser Ala Leu Ala Arg Glu Asp Phe Ala 65 70 75 80 Pro Ser Ser Asp Val Tyr Glu Glu Ile Ile Arg Lys Leu Gly Ser Ala 85 90 95 Gly Ala Phe Asp Leu Met Lys Gly Leu Val Gly Glu Met Arg Arg Glu 100 105 110 Gly His Glu Val Lys Val Gly Ile Val Gln Ser Phe Val Glu Ser Tyr 115 120 125 Ala Arg Leu Arg Arg Phe Asp Asp Ala Val Asp Leu Val Leu Asn Gln 130 135 140 Leu Asp Leu Phe Gly Val Gln Ala Asp Thr Val Val Tyr Asn His Leu 145 150 155 160 Leu Asn Val Leu Val Glu Gly Ser Lys Met Lys Leu Leu Glu Ser Val 165 170 175 Tyr Asn Glu Met Ala Ser Arg Gly Ile Arg Pro Asp Val Val Thr Phe 180 185 190 Asn Thr Leu Ile Lys Gly Leu Cys Arg Ala His Gln Val Arg Thr Ala 195 200 205 Val Leu Met Leu Glu Glu Met Ser Ser His Ser Val Ala Pro Asp Glu 210 215 220 Thr Thr Phe Thr Thr Leu Met Gin Gly Phe Val Glu Glu Gly Ser He 225 230 235 240 Glu Ala Ala Leu Arg Val Lys Ala Lys Met Leu Glu Thr Gly Cys Ser 245 250 255 Pro Thr Arg Val Thr Val Asn Val Leu He Asn Gly Tyr Cys Lys Leu 260 265 270 Gly Arg Val Glu Asp Ala Leu Gly Tyr He Gin Gin Glu He Ala Asp 275 280 285 Gly Phe Glu Pro Asp Gin Val Thr Tyr Asn Thr Phe Val His Gly Leu 290 295 300 Cys Gin Asn Gly His Val Ser His Ala Leu Lys Val He Asp Leu Met 305 310 315 320 He Gin Glu Gly His Asp Pro Asp Val Phe Thr Tyr Asn Thr Val He 325 330 335 Asn Cys Leu Ser Lys Asn Gly Glu Leu Asp Ala Ala Lys Gly He Val 340 345 350 Asn Glu Met Val Asp Arg Gly Cys Leu Pro Asp Thr Thr Thr Phe Asn 355 360 365 Thr Leu He Val Ala Leu Cys Ser Gin Asn Arg Leu Glu Glu Ala Leu 370 375 380 Asp Leu Ala Arg Glu Leu Thr Val Lys Gly Leu Ser Pro Asp Val Tyr 385 390 395 400 Thr Phe Asn Ile Leu Ile Asn Ala Leu Cys Lys Val Gly Asp Pro His 405 410 415 Leu Gly Met Arg Leu Phe Glu Glu Met Lys Ser Thr Gly Cys Thr Pro 420 425 430 Asp Glu Val Thr Tyr Asn Ile Leu Ile Asp His Leu Cys Ser Met Gly 435 440 445 Lys Leu Gly Asn Ala Leu Asp Leu Leu Lys Glu Met Glu Ser Ser Gly 450 455 460 Cys Pro Arg Ser Thr Val Thr Tyr Asn Thr Ile Ile Asp Gly Leu Cys 465 470 475 480 Lys Lys Met Arg Ile Ala Glu Ala Glu Glu Val Phe Asp Gln Met Asp 485 490 495 Ile His Gly Ile Leu Arg Asn Ala Val Thr Phe Asn Thr Leu Ile Asp 500 505 510 Gly Leu Cys Lys Ala Lys Arg Ile Asp Asp Ala Thr Glu Leu Ile Glu 515 520 525 Gln Met Ile Lys Glu Gly Leu Gln Pro Asp Asn Ile Thr Tyr Asn Ser 530 535 540 Ile Leu Thr His Tyr Cys Lys Gln Gly Asn Ile Lys Lys Ala Ala Asp 545 550 555 560 Ile Leu Glu Thr Met Thr Ala Asn Gly Phe Glu Val Asp Val Val Thr 565 570 575 Tyr Gly Thr Leu Ile Asn Gly Leu Cys Lys Ala Gly Arg Thr Gln Val 580 585 590 Ala Leu Lys Leu Leu Arg Gly Met Arg Ile Lys Gly Met Arg Pro Thr 595 600 605 Pro Lys Ala Tyr Asn Pro Val Ile Gln Ser Leu Phe Lys Arg Asn Asn 610 615 620 Leu Arg Asp Ala Leu Asn Leu Phe Arg Glu Met Thr Glu Val Gly Glu 625 630 635 640 Pro Pro Asp Ala Leu Thr Tyr Lys Ile Val Phe Arg Gly Leu Cys Arg 645 650 655 Gly Gly Gly Pro Ile Lys Glu Ala Phe Asp Phe Leu Val Glu Met Val 660 665 670 Asn Lys Gly Phe Met Pro Glu Phe Ser Ser Phe Arg Met Leu Ala Glu 675 680 685 Gly Leu Leu Asn Leu Gly Met Asp Asp Tyr Leu Ile Ser Ala Ile Glu 690 695 700 Leu Val lie Glu Lys Ala Asp Phe Arg Glu Ser Asp Ala Ser Ala lie 705 710 715 720 Arg Gly Tyr Leu Lys lie Arg Lys Tyr Tyr Asp Ala Leu Ala Thr Phe 725 730 735 Gly Arg Leu Leu Glu lie Asn Asn Pro Gin Trp Thr Tyr Arg 740 745 750 <210> 3 <211> 2312 <212> DNA <213> Artificial sequence <400> 3 gccttcgttg gctcgttgca gtcacggtgc cacactggat gcttcctctt tcccttcccc 60 tgttcgccag ctgcggcgag ccttgagttg agctcctctg cctcaatata cccgctttct 120 tctcagctcc gaccaacaat ccccttgctg cattctcccc agcggcgagc cttcgcttcg 180 cctgggcacc gccggcctcc gaccaccaag agcggctcct caccgccctg cgcgagcagg 240 cggaccccga ggcggcgctc cggatgctga actcggcgct cgcgcgggag gacttcgccc 300 cgagctccga cgtctacgag gagatcatcc ggaagctcgg gtccgccggc gcgttcgacc 360 cgagctccga cgtctacgag gagatcatcc ggaagctcgg gtccgccggc gcgttcgacc 360TGATGAAGGG GCTTGTCGGG GAGATGCGGC GGGAAGGGCA CGAGGTC AAG GTTGGCATCG 420 TGCAGTCGTT CGTGGAGAGC TACGC GCGC TGC CCGGTTCGACGATGCTGTCGACCTGG 480 TTCTGAACCA GCTCGACTTG TTCGGCGTTC AGGC GGACACGGTC GTTTAC AACCACCTCC 540 TCAATGTTCT TGTTGGA GGGG AGCAAGATGA AGCTACTGGA GTCGGTCTACAACGAGATGG 600 CTAGTCGGGG GATCCGACCT GATGTTGTGAC ATTC AATAC CCTGATCAAG GGGCTGTGCC 660 GGGCACATCA GGTCA GGACT GCGGTCTTGATGCTGGAGGAGATGTCGAGCC ATAGTGTGG 720 C GCCTGATGAG ACCACATTC ACCACCTTGA TGC AAGGCTTT GTTGA GGAG GGAAGC AT TG 780 AGGCGGCTTT GAGGGTGAAG GC GAAGATGC TGGAGACGGG GTGCTCTCCA ACAAGGGTA A 840 C AGTTAATGT TCTGATTAAT GGGTACTGCA AGCTGGGGAG AGTGG AAGAT GCTCTTGGCT 900 ACATACAGC AAGAGATTGC GGATGGATTT GAACCTGATC AGGTACATAC AATACTTTTG 960 TTCATGGGCT GTGCCAAAAC GGACATGTCA GTCATGCCTT GAAAGT CATCGACCTTATGA 1020 TTCAGGAGGG CCATGATCCT GATGTTTTCA CCTACAATAC TGTTATCAAT TGCCTCAGTA 1080 AAAATGGAGA GCTTGATGCG GCTAAAGGAA TTGTAATGAG ATGGTGGAT A GGGGTTGCT 1140 TGCCTGACAC CACCACATT C AACACTCTC ATTGTTGCTC TATGCTCAC AGAATCGACT TG 1200 AGGAAGCATT GGACCTTGCA CGTGAGCTAA CTGTGAAGGG ACTTTCTCCA GATGTTTATA 1260 CTTTCAATAT TTTGATCAAT GCCCTTTGCA AGGTTAGGAG ATCCTCATCT TGGTTGCAT 1320 TGTTTGAAGA GATGAAGAGC ACTGGATGCA CCCCTGATGA AGTTACATAC AATATATTGA 1380 TTGATCATCT TTGCTCAATG GGGAAGCTTG GAAATGCTTT GGATTTGTTG AAGGAGATGG 1440 AATCCAGTGG TTGCCCTCGG AGTACAGTGA CATATAACAC AATAATTGAT GGTTATGCA 1500 AGAAAATGAG AATTGCAGAA GCCGAGGAAG TTTTTGATCA AAATGGATAT ACATGGTATT 1560 TAAGGAATGC TGTCACATTT AATACACTTA TTGATGGCTT GTGCAAGGCC AAAAGGATTG 1620 ACGATGCAAC GGAAC TTATT GAGCAAATG ATAAAGGAAG GATTGCAGCCT GATAATATCA 1680 CTTATAATTC TATTCTAACA CATTATTGCA AGCAAGGAAC TATAAAGAAA GCAGCTGATA 1740 TTT TAGAAAC TATGACAGCA AATGGATTTG AAGTTGATGT TGTACATATG GAACACTCA 1800 ttaatggtct atgcaaggct ggtaggactc aggttgcttt gaagctttta agaggcatgc 1860 gaattaaagg gatgaggcct actccaaaag cttacaaccc tgtcatacag tctttgttta 1920 aacggaataa tttaagagat gcccttaatc ttttcagaga gatgactgaa gtgggtgagc 1980 ctcctgatgc cctcacatac aagattgtat tccgtggtct ctgtcgtggt ggaggtccta 2040 tcaaagaagc ttttgatttc ttggtggaga tggtgaataa gggtttcatg ccagagtttt 2100 catccttccg tatgctagct gaaggtctat taaatctcgg catggatgat tatctaatta 2160 gtgctattga actagttata gaaaaggctg actttagaga gtctgatgct tctgcaataa 2220 gggggtatct caagatccgc aaatattatg atgcattagc aacttttggc cgtctcctag 2280 agatcaacaa ccctcaatgg acttacagat ga 2312 <210> 4 <211> 682 <212> PRT <213> Artificial sequence <400> 4 Met Leu Asn Ser Ala Leu Ala Arg Glu Asp Phe Ala Pro Ser Ser Asp 1 5 10 15 Val Tyr Glu Glu Ile Ile Arg Lys Leu Gly Ser Ala Gly Ala Phe Asp 20 25 30 Leu Met Lys Gly Leu Val Gly Glu Met Arg Arg Glu Gly His Glu Val 35 40 45 Lys Val Gly Ile Val Gln Ser Phe Val Glu Ser Tyr Ala Arg Leu Arg 50 55 60 Arg Phe Asp Asp Ala Val Asp Leu Val Leu Asn Gln Leu Asp Leu Phe 65 70 75 80 Gly Val Gln Ala Asp Thr Val Val Tyr Asn His Leu Leu Asn Val Leu 85 90 95 Val Glu Gly Ser Lys Met Lys Leu Leu Glu Ser Val Tyr Asn Glu Met 100 105 110 Ala Ser Arg Gly Ile Arg Pro Asp Val Val Thr Phe Asn Thr Leu Ile 115 120 125 Lys Gly Leu Cys Arg Ala His Gln Val Arg Thr Ala Val Leu Met Leu 130 135 140 Glu Glu Met Ser Ser His Ser Val Ala Pro Asp Glu Thr Thr Phe Thr 145 150 155 160 Thr Leu Met Gln Gly Phe Val Glu Glu Gly Ser Ile Glu Ala Ala Leu 165 170 175 Arg Val Lys Ala Lys Met Leu Glu Thr Gly Cys Ser Pro Thr Arg Val 180 185 190 Thr Val Asn Val Leu Ile Asn Gly Tyr Cys Lys Leu Gly Arg Val Glu 195 200 205 Asp Ala Leu Gly Tyr Ile Gln Gln Glu Ile Ala Asp Gly Phe Glu Pro 210 215 220 Asp Gln Val Thr Tyr Asn Thr Phe Val His Gly Leu Cys Gln Asn Gly 225 230 235 240 His Val Ser His Ala Leu Lys Val Ile Asp Leu Met Ile Gln Glu Gly 245 250 255 His Asp Pro Asp Val Phe Thr Tyr Asn Thr Val Ile Asn Cys Leu Ser 260 265 270 Lys Asn Gly Glu Leu Asp Ala Ala Lys Gly Ile Val Asn Glu Met Val 275 280 285 Asp Arg Gly Cys Leu Pro Asp Thr Thr Thr Phe Asn Thr Leu Ile Val 290 295 300 Ala Leu Cys Ser Gln Asn Arg Leu Glu Glu Ala Leu Asp Leu Ala Arg 305 310 315 320 Glu Leu Thr Val Lys Gly Leu Ser Pro Asp Val Tyr Thr Phe Asn Ile 325 330 335 Leu Ile Asn Ala Leu Cys Lys Val Gly Asp Pro His Leu Gly Met Arg 340 345 350 Leu Phe Glu Glu Met Lys Ser Thr Gly Cys Thr Pro Asp Glu Val Thr 355 360 365 Tyr Asn Ile Leu Ile Asp His Leu Cys Ser Met Gly Lys Leu Gly Asn 370 375 380 Ala Leu Asp Leu Leu Lys Glu Met Glu Ser Ser Gly Cys Pro Arg Ser 385 390 395 400 Thr Val Thr Tyr Asn Thr Ile Ile Asp Gly Leu Cys Lys Lys Met Arg 405 410 415 Ile Ala Glu Ala Glu Glu Val Phe Asp Gln Met Asp Ile His Gly Ile 420 425 430 Leu Arg Asn Ala Val Thr Phe Asn Thr Leu Ile Asp Gly Leu Cys Lys 435 440 445 Ala Lys Arg Ile Asp Asp Ala Thr Glu Leu Ile Glu Gln Met Ile Lys 450 455 460 Glu Gly Leu Gln Pro Asp Asn Ile Thr Tyr Asn Ser Ile Leu Thr His 465 470 475 480 Tyr Cys Lys Gln Gly Asn Ile Lys Lys Ala Ala Asp Ile Leu Glu Thr 485 490 495 Met Thr Ala Asn Gly Phe Glu Val Asp Val Val Thr Tyr Gly Thr Leu 500 505 510 Ile Asn Gly Leu Cys Lys Ala Gly Arg Thr Gin Val Ala Leu Lys Leu 515 520 525 Leu Arg Gly Met Arg Ile Lys Gly Met Arg Pro Thr Pro Lys Ala Tyr 530 535 540 Asn Pro Val Ile Gin Ser Leu Phe Lys Arg Asn Asn Leu Arg Asp Ala 545 550 555 560 Leu Asn Leu Phe Arg Glu Met Thr Glu Val Gly Glu Pro Pro Asp Ala 565 570 575 Leu Thr Tyr Lys Ile Val Phe Arg Gly Leu Cys Arg Gly Gly Gly Pro 580 585 590 Ile Lys Glu Ala Phe Asp Phe Leu Val Glu Met Val Asn Lys Gly Phe 595 600 605 Met Pro Glu Phe Ser Ser Phe Arg Met Leu Ala Glu Gly Leu Leu Asn 610 615 620 Leu Gly Met Asp Asp Tyr Leu Ile Ser Ala Ile Glu Leu Val Ile Glu 625 630 635 640 Lys Ala Asp Phe Arg Glu Ser Asp Ala Ser Ala Ile Arg Gly Tyr Leu 645 650 655 Lys lie Arg Lys Tyr Tyr Asp Ala Leu Ala Thr Phe Gly Arg Leu Leu 660 665 670 Glu lie Asn Asn Pro Gin Trp Thr Tyr Arg 675 680 <210> 5 <211> 1385 <212> DNA <213> Artificial sequence <400> 5 aaggaatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60 tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120 ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 180 aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 240 tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 300 caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 360 ttgtgcagat gatccgtggc agaggcggcg tacacgcgga ggttttagag ctagaaatag 420 caagttaaaa taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt 480 ttttgtcgta gaaaggaatc tttaaacata cgaacagatc acttaaagtt cttctgaagc 540 aacttaaagt tatcaggcat gcatggatct tggaggaatc agatgtgcag tcagggacca 600 tagcacaaga caggcgtctt ctactggtgc taccagcaaa tgctggaagc cgggaacact 660 gggtacgttg gaaaccacgt gatgtgaaga agtaagataa actgtaggag aaaagcattt 720 cgtagtgggc catgaagcct ttcaggacat gtattgcagt atgggccggc ccattacgca 780 attggacgac aacaaagact agtattagta ccacctcggc tatccacata gatcaaagct 840 gatttaaaag agttgtgcag atgatccgtg gcaaggcgcg ggagtaggag gctgttttag 900 agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa agtggcaccg 960 agtcggtgct ttttttgtcg tagaaaggaa tctttaaaca tacgaacaga tcacttaaag 1020 ttcttctgaa gcaacttaaa gttatcaggc atgcatggat cttggaggaa tcagatgtgc 1080 agtcagggac catagcacaa gacaggcgtc ttctactggt gctaccagca aatgctggaa 1140 gccgggaaca ctgggtacgt tggaaaccac gtgatgtgaa gaagtaagat aaactgtagg 1200 agaaaagcat ttcgtagtgg gccatgaagc ctttcaggac atgtattgca gtatgggccg 1260 gcccattacg caattggacg acaacaaaga ctagtattag taccacctcg gctatccaca 1320 tagatcaaag ctgatttaaa agagttgtgc agatgatccg tggcagtggc aataccgcaa 1380 gcatt 1385

Claims

1. Application of biological materials that regulate the expression level and / or activity of the protein shown in sequence 2 in regulating the leaf color phenotype of millet; The biomaterial is a biomaterial that upregulates or downregulates the expression level and / or activity of the protein shown in sequence 2, wherein, The biological material whose protein expression level and / or activity is upregulated as shown in sequence 2 is any one of the following (1)-(4): (1) The nucleic acid molecule encoding the protein; (2) An expression cassette containing a nucleic acid molecule encoding the protein; (3) Contains a recombinant expression vector encoding the nucleic acid molecule of the protein; (4) A transgenic cell line or recombinant bacteria containing a nucleic acid molecule encoding the protein described herein; The biological material with the downregulated protein expression level and / or activity shown in sequence 2 is any one of the following (5)-(9): (5) Nucleic acid molecules capable of reducing the activity and / or expression level of the protein; (6) A nucleic acid molecule capable of inhibiting the expression of the nucleic acid molecule encoding the protein; (7) An expression cassette containing the nucleic acid molecule described in (5) or (6); (8) A carrier containing the nucleic acid molecule described in (5) or (6); (9) A transgenic cell line or recombinant bacteria containing the nucleic acid molecules described in (5) or (6); When the expression level and / or activity of the protein shown in sequence 2 are upregulated, the leaf color phenotype of the millet changes from white striped leaf color phenotype to green leaf color phenotype. When the expression level and / or activity of the protein shown in sequence 2 are downregulated, the leaf color phenotype of the millet changes from a green leaf phenotype to a white striped leaf phenotype.

2. Application of substances that reduce the activity and / or expression level of the protein shown in sequence 2 in target millet in changing the green leaf phenotype of millet to the white striped leaf phenotype.

3. Application of the substance that inhibits the expression of the nucleic acid molecule shown in sequence 1 in target millet in changing the green leaf phenotype of millet to the white striped leaf phenotype.

4. The application of a substance that mutates the protein shown in sequence 2 in millet to the protein shown in sequence 4 in changing the green leaf phenotype of millet to the white striped leaf phenotype.

5. Application of the protein shown in sequence 2 or its encoding nucleic acid molecule in restoring white-striped leaf phenotype millet to green-leaf phenotype millet.

6. A method for cultivating transgenic millet by reducing the activity and / or expression level of the protein shown in sequence 2 of the target millet to obtain transgenic millet with a white striped leaf phenotype.

7. A method for cultivating transgenic millet by inhibiting the expression of the nucleic acid molecule shown in sequence 1 in the target millet to obtain transgenic millet with a white striped leaf color phenotype.

Images