Bacteroides eggerthii heparinase i fusion protein, encoding gene and preparation method thereof

By introducing a specific linker peptide between Bacteroides heparinase I and maltose-binding protein to express a fusion protein, the problem of insufficient activity and yield of heparinase I in Escherichia coli was solved, and the industrial application of high-activity and high-yield heparinase I fusion protein was realized.

CN115975040BActive Publication Date: 2026-02-27CHONGQING DONGYU ZHONGNENG IND CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210899330.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-28
Publication Date
2026-02-27
Estimated Expiration
2042-07-28

AI Technical Summary

Technical Problem

In the existing technology, the expression of heparinase I in Escherichia coli easily forms insoluble inclusion bodies, and its activity and yield are difficult to reach industrial levels, which limits its commercial application.

Method used

A fusion protein was formed by combining Bacteroides heparinase I with maltose-binding protein, and a linker peptide with a specific nucleotide sequence, such as SEQ ID NO.11 or SEQ ID NO.12, was introduced between the two to improve the enzyme's activity and yield through a prokaryotic expression system.

Benefits of technology

The expression of heparinase I fusion protein with high activity and high yield was achieved, which is suitable for industrial application and solves the problems of insufficient activity and yield in the existing technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115975040B_ABST
    Figure CN115975040B_ABST
Patent Text Reader

Abstract

The present application relates to heparinase fusion protein preparation technical field, specifically to the Bacteroides heparinase I fusion protein and its coding gene and preparation method. The Bacteroides heparinase I fusion protein includes heparinase I and maltose binding protein, and a connecting peptide is connected between heparinase I and maltose binding protein, and the nucleotide sequence of the connecting peptide is shown in SEQ ID NO.11 or SEQ ID NO.12. The present application can solve the technical problem of limited enzyme activity of heparinase obtained by using bioengineering technology, and has important theoretical and practical significance for establishing a high-efficiency and high-enzyme-activity heparinase recombinant expression system.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of heparinase fusion protein preparation, in particular to Bacteroides heparinolyticus heparinase I fusion protein, its coding gene and preparation method. BACKGROUND

[0002] Heparinase is a kind of polysaccharide lyase acting on heparin or acetyl heparin molecules, which is heparinase I, II and III. Heparinase is mainly isolated from some bacteria using heparin as carbon source, which is originally from Flavobacterium heparinum. In addition, heparinase is also found in many microorganisms, but so far Flavobacterium heparinum is still the only source of commercial heparinase.

[0003] Since the 1990s, there have been a large number of genetic engineering expression researches and practices of heparinase I. Among them, the heterologous expression research and application of Escherichia coli as host are the most. However, the expression of heparinase I in Escherichia coli is easy to aggregate into insoluble inclusion bodies, and it is difficult to renature the inclusion body heparinase I. In addition, many fusion expression strategies have been used to improve the production of heparinase I. However, the research on heparinase I fusion protein is based on heparinase I from Flavobacterium heparinum, and the activity and yield of expressed heparinase I are difficult to reach the industrial level. Therefore, it is of great theoretical and practical significance to find and establish a recombinant expression technology with high expression efficiency and high enzyme activity, and to find a new type of commercial heparinase I. SUMMARY

[0004] The present application aims to provide Bacteroides heparinolyticus heparinase I fusion protein to solve the technical problem of limited enzyme activity of heparinase obtained by using biological engineering technology.

[0005] To achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0006] The Bacteroides heparinolyticus heparinase I fusion protein comprises heparinase I and maltose binding protein, and a connecting peptide is connected between the heparinase I and the maltose binding protein, and the nucleotide sequence of the connecting peptide is shown in SEQ ID NO. 11 or SEQ ID NO. 12.

[0007] The principle and advantages of the present scheme are: heparinase I is mostly studied from Flavobacterium heparinum, and the present scheme studies heparinase I from Bacteroides hallii, which broadens the source of the enzyme. The inventors cloned the heparinase I gene from Bacteroides hallii and conducted a large number of studies on the properties and expression conditions thereof. Different from the common heparinase I gene, when the heparinase I gene from Bacteroides hallii is used for expression of a bioengineering bacterium, the inventors found that the activity of the expressed heparinase I is limited, and therefore tried to use a fusion protein to improve the activity of the target protein. Through a large number of studies and screening, it was found that when preparing the fusion protein of heparinase I and maltose binding protein, a nucleotide sequence such as the linker peptide shown in SEQ ID NO. 11 or SEQ ID NO. 12 needs to be connected between the two proteins. Due to the addition of the above two kinds of linker peptides, it is ensured that the fusion protein expressed by the engineering bacterium can be correctly folded, and the desired enzyme activity is ensured. If no linker peptide is added between heparinase I and maltose binding protein, the activity of the obtained fusion protein is significantly lower than that of the fusion protein containing the linker peptide. If the linker peptide of the present scheme is replaced by other types of linker peptides, the activity of the obtained fusion protein is also not as good as that of the fusion protein prepared according to the present scheme. It can be seen that the selection of the linker peptide is crucial to the present scheme, and the use of the linker peptide with the nucleotide sequence shown in SEQ ID NO. 11 or SEQ ID NO. 12 can significantly increase the target activity of the fusion protein, reduce the amount of inclusion body heparinase I, and further broaden the source of heparinase I, thereby overcoming the technical problems that the activity and yield of the existing heparinase I are difficult to reach the industrial level, which has important theoretical and practical significance.

[0008] Further, the amino acid sequence of the Bacteroides hallii heparinase I fusion protein is shown in SEQ ID NO. 13 or SEQ ID NO. 14. The protein sequence formed by fusion of heparinase I, linker peptide and maltose binding protein is SEQ ID NO. 13 or SEQ ID NO. 14. The above protein has a high prokaryotic expression amount and activity, and is suitable for industrial application and large-scale production.

[0009] Further, the nucleotide sequence of the gene of the Bacteroides hallii heparinase I fusion protein is shown in SEQ ID NO. 9 or SEQ ID NO. 10. The gene sequence formed by fusion of the heparinase I gene, linker peptide nucleotide sequence and maltose binding protein gene is SEQ ID NO. 9 or SEQ ID NO. 10. The above gene can be expressed in large amounts in a prokaryotic expression system to form a fusion protein with high activity and suitable for industrial application.

[0010] Further, the gene of the B. eggerthii heparinase I fusion protein is integrated into the multiple cloning site of the vector pMAL-c2x to form an expression vector. The vector pMAL-c2x is provided with a maltose binding protein tag and is a commonly used commercial vector, which is easy to obtain and operate.

[0011] Further, the method for preparing the B. eggerthii heparinase I fusion protein comprises the following steps performed in sequence:

[0012] S1 Construction of an expression vector:

[0013] S2 Preparation of an engineered bacterium: the expression vector is transformed into E. coli to obtain the engineered bacterium; the strain of the E. coli is one of TB1, BL21, BL21(DE3), BL21(DE3)pLysS and BL21-CodonPlus(DE3)-RIPL;

[0014] S3 Expression of the fusion protein: the engineered bacterium is fermented and induced to obtain enzyme bacteria; the B. eggerthii heparinase I fusion protein is expressed in the enzyme bacteria.

[0015] The engineered bacterium is obtained through the transgenic competent cells, and the engineered bacterium is induced to express the target protein, so that the B. eggerthii heparinase I fusion protein can be massively expressed.

[0016] Further, it further comprises S4 Purification of the fusion protein: after the enzyme bacteria are broken, the supernatant is obtained by centrifugation, and the crude enzyme is obtained; the purified fusion protein is obtained through affinity column chromatography. Through cell disruption and subsequent purification steps, the target protein with high purity can be obtained, and the high-purity protein will be used for subsequent pharmaceutical and preparation of detection reagents.

[0017] Further, in the step of S1 construction of an expression vector, the following steps are included:

[0018] The upstream primer P1 with the sequence shown in SEQ ID NO. 3 and the downstream primer P2 with the sequence shown in SEQ ID NO. 4 are used, and the maltose binding protein gene shown in SEQ ID NO. 2 is used as a template to clone MBP-F;

[0019] The upstream primer P4 with the sequence shown in SEQ ID NO. 6 and the downstream primer P5 with the sequence shown in SEQ ID NO. 7 are used, and the B. eggerthii heparinase I gene shown in SEQ ID NO. 1 is used as a template to clone F-HEP;

[0020] The three fragments of MBP-F, F-HEP and the cleaved vector pMAL-c2x are connected to obtain an expression vector.

[0021] Further, in the step of constructing the S1 expression vector, the following steps are included:

[0022] Using the upstream primer P1 with sequence as shown in SEQ ID NO. 3 and the downstream primer P3 with sequence as shown in SEQ ID NO. 5, and taking the maltose binding protein gene shown in SEQ ID NO. 2 as the template, the MBP-R is cloned;

[0023] Using the upstream primer P6 with sequence as shown in SEQ ID NO. 8 and the downstream primer P5 with sequence as shown in SEQ ID NO. 7, and taking the Bacteroides heparinase I gene shown in SEQ ID NO. 1 as the template, the R-HEP is cloned;

[0024] The three fragments of the MBP-R, the R-HEP and the cleaved vector pMAL-c2x are connected to obtain the expression vector.

[0025] Using the above primers, the target gene can be obtained through multi-step PCR reflection and subsequent fragment connection process, and the target gene is connected to the empty vector to obtain the expression vector.

[0026] Further, in the preparation of the S2 engineering bacteria, the expression vector is transformed into E. coli BL21-CodonPlus (DE3)-RIPL to obtain the engineering bacteria. The two fusion proteins MBP-F-HEP and MBP-R-HEP have the highest enzyme activity in E. coli BL21-CodonPlus (DE3)-RIPL, so the optimal host bacteria is E. coli BL21-CodonPlus (DE3)-RIPL. The second screening experiment also verifies that E. coli BL21-CodonPlus (DE3)-RIPL is the best host, which can be applied to the subsequent industrial production.

[0027] Further, in the expression of the S3 fusion protein, the engineering bacteria are cultured in LB medium at 30-37°C for 12-16h; then the engineering bacteria are cultured in M9YE medium at 30-37°C until the OD 600 value is 0.6-0.8; finally, 0.2mM IPTG is used to induce at 15-20°C for 20-24h. Through a large number of screening experiments, when the final concentration of IPTG is 0.2mM, the fermentation enzyme activity of the obtained product is the highest, which is an optimized scheme. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 PCR amplification result of the MBP with flexible connecting peptide in Example 1 of the application.

[0029] Figure 2PCR amplification result of MBP with rigid linker peptide of Example 1 of the present application.

[0030] Figure 3 PCR amplification result of HEP with flexible linker peptide of Example 1 of the present application.

[0031] Figure 4 PCR amplification result of HEP with rigid linker peptide of Example 1 of the present application.

[0032] Figure 5 PCR verification result of MBP-F-HEP of Example 1 of the present application.

[0033] Figure 6 PCR verification result of MBP-R-HEP of Example 1 of the present application.

[0034] Figure 7 Fusion proteinase activity determination result of Example 2 of the present application.

[0035] Figure 8 Protein electrophoresis detection result of MBP-F-HEP fusion protein of Example 2 of the present application.

[0036] Figure 9 Protein electrophoresis detection result of MBP-R-HEP fusion protein of Example 2 of the present application.

[0037] Figure 10 Second screening result of optimal engineering bacteria of Example 3 of the present application.

[0038] Figure 11 IPTG addition amount screening result of Example 4 of the present application.

[0039] Figure 12 Linker peptide action research result of comparative example of the present application. DETAILED DESCRIPTION

[0040] The present application will be further described in conjunction with the examples below, but the embodiments of the present application are not limited thereto. If not specifically indicated, the technical means used in the following examples are the conventional means known to those skilled in the art; the experimental methods used are conventional methods, and can be completed according to the described recombination techniques (see Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can be obtained from commercial channels.

[0041] Example 1: Construction of expression vector

[0042] The following examples are used to illustrate the present application. HiFi DNA Assembly was used, and the Bacteroides heparinase I gene fragment (HEP, its nucleotide sequence is shown in SEQ ID NO.1) was inserted into the multiple cloning site of the vector pMAL-c2x according to the instructions (using the kit). HiFi DNA Assembly is then performed, and the linker peptide between the MBP tag (maltose-binding protein, whose nucleotide sequence is shown in SEQ ID NO.2) and the heparinase sequence is replaced with a flexible or rigid linker peptide. The specific steps are as follows:

[0043] 1. Primer design

[0044] (1) MBP primer pair

[0045] Primer pairs were designed based on the MBP tag sequence, with a portion of a flexible or rigid linker peptide added to the primer sequences. The upstream primer must have overlapping homologous sequences adjacent to pMal-c2x, and the downstream primer must have overlapping homologous sequences with the adjacent Bacteroides heparinase I sequence. The MBP primer pair sequences are as follows:

[0046] MBP-F (MBP primer pair containing flexible linker peptides):

[0047] Upstream primer P1:

[0048] (The bordered base is the Nde I restriction site, SEQ ID NO.3)

[0049] Downstream primer P2:

[0050] 5'- AACCACCGCCACCGGATCCACCACCGCCGCTACCGCCGCCACCGCTGCCGCCACCACC CCTTCCCTCGATC CCGAGGTT-3' (The underlined bases represent the added flexible linker peptide, SEQ ID NO.4)

[0051] MBP-R (MBP primer pair containing rigid linker peptides):

[0052] Upstream primer P1: (The bordered base is the Nde I restriction site, SEQ ID NO.3)

[0053] Downstream primer P3:

[0054] 5'- TCGCCGCTGCCTCTTTTGCGGCCGCCTCTTTCGCTGCCGCTTCCTTTGCGGCAGCCTC CCTTCCCTCGATC CCGAGGTT-3' (underlined bases indicate the added rigid linker peptide, SEQ ID NO.5)

[0055] (2) B. elliworthii HEP I primer pair

[0056] The primer pair was designed according to the sequence of B. elliworthii HEP I, and a part of the flexible (Flexibility) or rigid (Rigidity) linker peptide was added in the primer sequence. The downstream primer has an overlapping homologous sequence adjacent to pMal-c2x. The sequence of B. elliworthii HEP I primer pair is as follows:

[0057] F-HEP (HEP primer pair containing a flexible linker peptide):

[0058] Upstream primer P4:

[0059] 5’- GCGGCGGTAGCGGCGGTGGTGGATCCGGTGGCGGTGGTTCTGGTGGTGGTGGCAGC AAAAAGAACATCTTC ATCATC-3’ (the underlined bases are another part of the flexible linker peptide added, SEQ ID NO. 6)

[0060] Downstream primer P5:

[0061] (the underlined part is the homologous part with pMal vector, and the boxed bases are the stop codon added, SEQ ID NO. 7)

[0062] R-HEP (HEP primer pair containing a rigid linker peptide):

[0063] Upstream primer P6:

[0064] 5’- AGCGGCAGCGAAAGAGGCGGCCGCAAAAGAGGCAGCGGCGAAAGAAGCTGCGGCCAAG AAAAAGAACATCT TCATCATC-3’ (the underlined bases are another part of the rigid linker peptide added, SEQ ID NO. 8)

[0065] Downstream primer P5:

[0066] (the underlined part is the homologous part with pMal vector, and the boxed bases are the stop codon added, SEQ ID NO. 7)

[0067] 2. PCR amplification of MBP and HEP

[0068] PCR reaction system: Q5TM High-Fidelity DNA Polymerase from NEB was used to prepare the reaction system according to the instructions. The primers in “1. Primer design” were used to amplify MBP and HEP in vitro, respectively. The amplification program was as follows: 98°C pre-denaturation for 30s, 98°C denaturation for 10s, 55-70°C primer annealing for 30s, 72°C extension for 90s, 34 cycles, and 72°C final extension for 5min to end the reaction.

[0069] PCR results as follows Figure 1-4 As shown ( Figure 1-4 The numbers at the bottom indicate the annealing temperature used (in °C), indicating that the MBP sequence with rigid-flexible linker peptides and the heparinase sequence were amplified, and sequencing alignment showed that the molecular cloning was correct. Figure 1 For the MBP sequence with a flexible linker peptide (MBP-F), the optimal annealing temperature is 55℃; Figure 2 For MBP sequences with rigid linker peptides (MBP-R), the optimal annealing temperature is 67℃; Figure 3 The optimal annealing temperature for the heparinase sequence with a flexible linker peptide (F-HEP) is 68.9-60.7℃. Figure 4 The optimal annealing temperature for the heparinase sequence with a rigid linker peptide (R-HEP) is 55°C.

[0070] 3. Construct cloning vectors containing the target fragment.

[0071] The pMal-c2x empty vector (containing Factor Xa and MBP, with a linker sequence between Factor Xa and MBP) was double-digested with EcoRI and HindIII, and then... HiFi DNA Assembly was used to ligate three fragments: pMal-c2x, MBP-F, and F-HEP, as well as three fragments: pMal-c2x, MBP-R, and R-HEP. The reaction systems were prepared according to the manufacturer's instructions and incubated at 50°C for 20 min, yielding ligation products containing the MBP-F-HEP fragment (the nucleic acid sequence of the MBP-F-HEP fusion protein, SEQ ID NO. 9) and the MBP-R-HEP fragment (the nucleic acid sequence of the MBP-R-HEP fusion protein, SEQ ID NO. 10). The sequence of the flexible linker peptide F is shown in SEQ ID NO. 11, and the sequence of the rigid linker peptide R is shown in SEQ ID NO. 12.

[0072] Both the MBP-F-HEP and MBP-R-HEP fragments were linked to pMal-c2x to obtain two expression vectors: one for expressing the MBP-F-HEP fusion protein and the other for expressing the MBP-R-HEP fusion protein.

[0073] 4. Gene transformation and positive clone screening

[0074] The two ligation products obtained in "3. Construction of cloning vector containing target fragment" were transformed into E. coli DH5a competent cells respectively by conventional methods of prior art. Spread on LB resistance plates containing 100 μg / mL ampicillin for screening, incubated at 37°C for 16 h (optional range: 12-20 h). MBP-F-HEP selected colonies and used as templates for colony PCR identification with primers P1 and P5, colony PCR was performed using 2x Easy Taq SuperMix, and the PCR reaction system and reaction conditions were set according to the instructions. MBP-R-HEP colonies were extracted for plasmid and verified by EcoR I and Hind III digestion. After the reaction, the products were detected by 1% agarose gel electrophoresis. The results of MBP-F-HEP are as follows Figure 5 , lanes 1-5 are the results of colony PCR amplification, lanes 1, 2, 4 and 5 are positive, lane 3 is negative, and lane M is Marker; the results of MBP-R-HEP are as follows Figure 6 , lanes 1-4 are the results of enzyme digestion verification, lanes 2 and 4 are positive, lanes 1 and 3 are negative, and lane M is Marker. The positive clone bacteria screened were sent to Shengong Bio for sequencing. The sequencing alignment results of No. 2 bacteria of MBP-F-HEP and No. 4 bacteria of MBP-R-HEP were correct. The recombinant vectors were named as MBP-F-HEP expression vector and MBP-R-HEP expression vector. The MBP-F-HEP fragment and the MBP-R-HEP fragment were both connected to pMal-c2x, obtaining two expression vectors, namely an expression vector for expressing MBP-F-HEP fusion protein (MBP-F-HEP expression vector) and an expression vector for expressing MBP-R-HEP fusion protein (MBP-R-HEP expression vector).

[0075] Example 2: Expression and purification of B. eggerthii heparinase I fusion protein

[0076] 1. Expression of fusion protein

[0077] The MBP-F-HEP expression vector and the MBP-R-HEP expression vector in E. coli DH5a were extracted, and the E. coli TB1, BL21, BL21(DE3) (referred to as DE3), BL21(DE3)pLysS (referred to as pLysS), BL21-CodonPlus(DE3)-RIPL (referred to as RIPL) (manufacturers: Weidi Biology, and the item numbers are EC1030 / EC1001 / EC1002 / EC1003 / EC1007, respectively) were transformed by the conventional transformation method, and TB1 / MBP-F-HEP, BL21 / MBP-F-HEP, DE3 / MBP-F-HEP, pLysS / MBP-F-HEP, RIPL / MBP-F-HEP and TB1 / MBP-R-HEP, BL21 / MBP-R-HEP, DE3 / MBP-R-HEP, pLysS / MBP-R-HEP, RIPL / MBP-R-HEP were obtained as the engineering bacteria for expressing MBP-F-HEP and MBP-R-HEP by ampicillin selection.

[0078] The above engineering bacteria were expressed in parallel according to the following operation: the engineering bacteria were respectively cultured in LB medium containing 100 μg / mL ampicillin resistance at 37°C (optionally in the range of 30-37°C) for 16 h (optionally in the range of 12-16 h). Then, 1% inoculation amount was inoculated into M9YE medium (Yeast Extract 12.5 g / L, Na2HPO4·12H2O 17.76 g / L, KH2PO4 3 g / L, NaCl 0.5 g / L, NH4Cl 1 g / L, sterilized at 121°C for 20 min, cooled to 50°C, added with 1 mL of sterilized 1M MgSO4, 30 mL of 40% (w / v) glucose, and 10 mL of 0.1M CaCl2) at 37°C (optionally in the range of 30-37°C) to culture to OD 600 After the OD was 0.6-0.8, 0.2 mM IPTG was added at a final concentration, and the culture was induced at 16°C (optionally in the range of 15-20°C) for 22 h (optionally in the range of 20-24 h). The bacteria were collected by centrifugation at 10000 rpm for 6 min, washed twice with Tris buffer (Tris-HCL 20 mM, NaCl 500 mM, pH 7.4), and then resuspended. The resuspension was ultrasonically broken, and the supernatant obtained by centrifugation at 10000 rpm for 30 min was the crude enzyme containing B. elliottii heparinase I. The enzyme activity was detected by UV232 method, and the enzyme activity was defined as the activity (IU) of generating 1 μM unsaturated uronic acid by degrading the substrate heparin per minute at 30°C.

[0079] The engineering bacteria all expressed active soluble B. elliottii heparinase I protein, and the enzyme activity detection results were as follows: Figure 7As shown. It can be found that MBP-F-HEP and MBP-R-HEP have the highest enzyme activity in E. coli BL21-CodonPlus(DE3)-RIPL, respectively, so the optimal host strain is E. coli BL21-CodonPlus(DE3)-RIPL.

[0080] 2. Purification of fusion protein

[0081] The MBP-F-HEP and MBP-R-HEP proteins expressed by the optimal host strain E. coli BL21-CodonPlus(DE3)-RIPL were purified, respectively. Since MBP-F-HEP and MBP-R-HEP both have MBP tags, they can be adsorbed with Dextrin Beads to achieve purification effect. The following steps were followed.

[0082] Dextrin Beads were loaded into an empty chromatography column, and Tris buffer (Tris-HCL 20mM, NaCl 500mM, pH7.4) was used as column equilibration buffer. The column was equilibrated with 5 times the volume of the column equilibration buffer, and the crude enzyme was poured into the column. After rotating and mixing at 4°C for 1h, the column was washed with 2 times the volume of the column equilibration buffer, and then washed with a cleaning Tris buffer (Tris-HCL 20mM, NaCl 150mM, pH7.4) until no impurity protein flowed out. The target protein was eluted with an elution Tris buffer (Tris-HCL 20mM, NaCl 150mM, maltose 10mM, pH7.4), and the pure enzyme was obtained. The crude enzyme and the pure enzyme were subjected to protein electrophoresis, respectively. As shown in Figure 8 , M lane is Marker (from top to bottom, molecular weight is 130kDa, 100kDa, 70kDa, 50kDa, 35kDa, 25kDa, respectively), lanes 1-3 are cell disruption liquid, cell disruption supernatant (crude enzyme), and pure enzyme, respectively, and the arrow points to the fusion protein MBP-F-HEP (88kDa, SEQ ID NO. 13); the MBP-R-HEP fusion protein (SEQ ID NO. 14) is as shown in Figure 9 , M lane is Marker (from top to bottom, molecular weight is 130kDa, 100kDa, 70kDa, 50kDa, 35kDa, 25kDa, respectively), lanes 1-3 are cell disruption supernatant (crude enzyme), cell disruption liquid, and pure enzyme, respectively, and the arrow points to the fusion protein MBP-R-HEP (89kDa).

[0083] Example 3: Second screening of optimal engineering bacteria

[0084] After the first round of screening, MBP-F-HEP and MBP-R-HEP screened out TB1 / MBP-F-HEP, RIPL / MBP-F-HEP, TB1 / MBP-R-HEP, RIPL / MBP-R-HEP with better performance, respectively. Fermentation expression was carried out according to the same conditions of the first round. The results are shown in Figure 10 After the second round of screening, the host strains of MBP-F-HEP and MBP-R-HEP with the highest enzyme activity were still RIPL / MBP-F-HEP and RIPL / MBP-R-HEP, which further verified our conclusion.

[0085] Example 4: Screening of IPTG addition amount

[0086] According to the same fermentation expression method, taking RIPL / MBP-F-HEP strain as an example, different final concentrations of IPTG were selected, which were 0.04 mM, 0.08 mM, 0.12 mM, 0.16 mM and 0.20 mM, respectively. The experimental results are shown in Figure 11 It can be seen from the results that the final concentration of IPTG is 0.2 mM, and the fermentation enzyme activity and the enzyme liquid enzyme activity are the highest.

[0087] Comparative Example

[0088] In order to study the effect of the addition of the connecting peptide on the expression of the target protein, the comparative example constructed a fusion gene without the connecting peptide, that is, the connecting peptide sequence (SEQ ID NO. 12 or SEQ ID NO. 11) in MBP-R-HEP (SEQ ID NO. 10) or MBP-F-HEP (SEQ ID NO. 9) was removed to obtain the MBP-HEP gene. According to the methods of Example 1 and Example 2, the expression vector was constructed and the protein expression was carried out. The above processes are conventional technical means of molecular cloning, which will not be described here. According to the conventional transformation method, it was transformed into Escherichia coli TB1, BL21, BL21 (DE3) (referred to as DE3), BL21 (DE3) pLysS (referred to as pLysS), BL21-CodonPlus (DE3)-RIPL (referred to as RIPL), and TB1 / MBP-HEP, BL21 / MBP-HEP, DE3 / MBP-HEP, pLysS / MBP-HEP, RIPL / MBP-HEP were obtained as the engineering bacteria for expressing MBP-HEP. Crude enzyme was obtained by fermentation expression, and enzyme activity detection was carried out. The test results are shown in Figure 12 (Engineering bacteria for expressing MBP-HEP are Figure 12 The right side is five kinds of engineering bacteria, Figure 12 The left side is ten kinds of Figure 6 ). From Figure 12It can be seen that the enzyme activity of MBP-HEP introduced into each engineering bacteria is less than that of MBP-F-HEP and MBP-R-HEP after replacing the connecting peptide.

[0089] The above is only the embodiment of the present application, and the specific technical solutions and / or common knowledge of the scheme are not described in detail. It should be pointed out that for those skilled in the art, without departing from the technical solutions of the present application, a number of modifications and improvements can be made, which should also be considered as the protection scope of the present application, which will not affect the effect and practicality of the patent. The protection scope claimed in the present application should be subject to the content of its claims, and the specific implementation mode and the like recorded in the specification can be used to explain the content of the claims.

Claims

1. A B. eggerthii heparinase I fusion protein characterized in that: Heparinase I and maltose binding protein, the amino acid sequence of which is shown as SEQ ID NO.

13.

2. The gene of B. elli f B. heparinase I fusion protein according to claim 1, characterized by: The nucleotide sequence of which is shown as SEQ ID NO.

9.

3. The method for preparing the Bacteroides heparinase I fusion protein according to claim 1, characterized in that: The method comprises the following steps in sequence: S1 construction of expression vector: MBP-F is cloned by using the upstream primer P1 with the sequence shown as SEQ ID NO. 3 and the downstream primer P2 with the sequence shown as SEQ ID NO. 4, and taking the maltose binding protein gene shown as SEQ ID NO. 2 as a template; F-HEP is cloned by using the upstream primer P4 with the sequence shown as SEQ ID NO. 6 and the downstream primer P5 with the sequence shown as SEQ ID NO. 7, and taking the B. elki heparinase I gene shown as SEQ ID NO. 1 as a template; The three fragments of MBP-F, F-HEP and the cleaved vector pMAL-c2x are connected to obtain an expression vector; S2 preparation of engineering bacteria: the expression vector is transformed into E. coli to obtain engineering bacteria; the strain of the E. coli is BL21-CodonPlus (DE3)-RIPL; S3 expression of fusion protein: the engineering bacteria are fermented and induced to obtain enzyme bacteria; the B. elki heparinase I fusion protein is expressed in the enzyme bacteria; The engineered bacteria were cultured in LB medium at 30-37°C for 12-16h; then the engineered bacteria were cultured in M9YE medium at 30-37°C until OD 600 0.6-0.8; finally induced by 0.2mM IPTG at 15-20°C for 20-24h.

4. The method of claim 3, wherein the B. eggerthii heparinase I fusion protein is prepared by the method comprising the steps of: S4 purification of fusion protein: the enzyme bacteria are broken, and the supernatant is obtained by centrifugation to obtain a crude enzyme; the purified fusion protein is obtained by affinity column chromatography.

Citation Information

Patent Citations

  • Connecting peptide and application thereof

    CN105753945A