A polyketone compound, a preparation method and application thereof
Aspertaichunol A, a polyketide compound obtained by fermentation of Aspergillus taichungis SMU01, solved the problem of insufficient anti-tumor activity of Th9 cells. By promoting the proliferation and secretion of Th9 cells and cytokines, it significantly enhanced their anti-tumor ability.
Patent Information
- Application Number
- CN202211077335.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-02
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-09-02
AI Technical Summary
There is room for improvement in the anti-tumor effect of Th9 cells in existing technologies, and new strategies need to be developed to enhance their immunotherapy efficacy.
Aspertaichunol A, a polyketide compound obtained by fermentation of Aspergillus taichungis SMU01, enhances the anti-tumor effect of Th9 cells by promoting Th9 cell proliferation, increasing IFN-γ and TNF-α secretion and IL-9 expression.
The polyketide compound Aspertaichunol A significantly promotes the proliferation of Th9 and CD8+ T cells, increases the secretion of IFN-γ and TNF-α, enhances IL-9 expression, and strengthens the anti-tumor effect of Th9 cells, which is of great value for the development of anti-tumor drugs.
Smart Images

Figure QLYQS_1 
Figure QLYQS_2 
Figure BDA0003829958060000031
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of medical compounds, and particularly relates to a polyketide compound and a preparation method and application thereof. BACKGROUND
[0002] CD4 + T helper cells play an important role in adoptive immunity by mediating both cellular and humoral immunity. In addition to co-activating CD8 + T cells to directly kill pathogens or tumors, CD4 + T cells also activate macrophages to destroy pathogens in their vesicles. In addition, CD4 + T cells can promote the immune action of B cells and modulate the production of antibodies by promoting the switching of antibody types through the provision of cytokines and costimulatory signals at the priming site. Recent studies have shown that CD4 + T cells also have cytotoxic capabilities, indicating that they can play a more direct role in pathogen and tumor clearance.
[0003] Th9 cells are a newly defined subset of CD4 + T cells that secrete large amounts of interleukin-9 (IL-9). Compared with other Th subsets, Th9 cells have a significant anti-tumor effect in addition to their helper B cell and pro-inflammatory effects. It has been reported that CD4 + Th9 cells and CD8 + Tc9 cells produce IL-9 to clear tumors. IL-9 is essential in the process of IL-9 producing tumor clearance. Studies have shown that Th9 cells have a unique anti-tumor effect by killing late-stage tumors and antigen-loss tumors. Therefore, further enhancing the anti-tumor effect of Th9 cells is a promising new strategy in cancer immunotherapy. Obtaining effective ingredients with corresponding pharmacological effects through microbial fermentation has important value for the development and application of anti-tumor drugs. SUMMARY
[0004] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a Taichung Aspergillus SMU01.
[0005] The present application also proposes a product containing the above-mentioned strain.
[0006] The present application also proposes a polyketide compound.
[0007] The present application also proposes a preparation method of the above-mentioned polyketide compound.
[0008] The present application also proposes the application of the above-mentioned strain, the product containing the above-mentioned strain, or the above-mentioned polyketide compound.
[0009] In an aspect of the present application, a strain is provided, which is Aspergillus tichungensis SMU01, deposited in Guangdong Microbial Culture Collection Center, with a deposit number of GDMCC NO: 62752 and a deposit date of August 30, 2022.
[0010] In some embodiments of the present application, the Aspergillus tichungensis SMU01 is isolated from a Periplaneta americana.
[0011] In some embodiments of the present application, the strain has an ITS sequence shown in SEQ ID NO: 1.
[0012] In a second aspect of the present application, a product is provided, comprising at least one of (1) to (6):
[0013] (1) the strain described above;
[0014] (2) a microbial agent containing the strain described above;
[0015] (3) a viable bacterial liquid containing the strain described above;
[0016] (4) a dead bacterial liquid containing the strain described above;
[0017] (5) a metabolite containing the strain described above;
[0018] (6) an extract containing the strain described above.
[0019] In some embodiments of the present application, the product is a pharmaceutical product or a food product.
[0020] In some embodiments of the present application, the pharmaceutical product further comprises a pharmaceutical carrier and / or a pharmaceutical excipient.
[0021] In some embodiments of the present application, the pharmaceutical carrier comprises at least one of a diluent, an excipient, a filler, a binder, a disintegrant, an absorption enhancer, a surfactant, an adsorption carrier, a lubricant, a sweetener, and an aroma.
[0022] In some embodiments of the present application, the excipient comprises water.
[0023] In some embodiments of the present application, the filler comprises at least one of starch and sucrose.
[0024] In some embodiments of the present application, the binder comprises at least one of a cellulose derivative, an alginate, a gelatin, and a polyvinylpyrrolidone.
[0025] In some embodiments of the present application, the wetting agent comprises glycerol.
[0026] In some embodiments of the application, the disintegrant includes at least one of agar, calcium carbonate, and sodium bicarbonate.
[0027] In some embodiments of the application, the absorption enhancer includes a quaternary ammonium compound.
[0028] In some embodiments of the application, the surfactant includes cetyl alcohol.
[0029] In some embodiments of the application, the adsorptive carrier includes at least one of kaolin and saponite clay.
[0030] In some embodiments of the application, the lubricant includes at least one of talc, calcium stearate, magnesium stearate, and polyethylene glycol.
[0031] According to a third aspect of the present application, there is provided a polyketide compound, the structure of which is shown in the following formula (I):
[0032]
[0033] According to a fourth aspect of the present application, there is provided a method for preparing the above-mentioned polyketide compound, the method comprising the following steps: fermenting and culturing the above-mentioned Aspergillus takatomii SMU01 to obtain a fermentation product; extracting the fermentation product to obtain an extract; and separating and purifying the extract to obtain the polyketide compound.
[0034] In some embodiments of the present application, the fermenting and culturing includes the step of adding a seed solution of the Aspergillus takatomii SMU01 to a fermentation medium.
[0035] In some embodiments of the present application, the preparation of the seed solution of the Aspergillus takatomii SMU01 includes: inoculating a slant strain of the Aspergillus takatomii SMU01 to a solid culture medium to activate, to obtain an activated strain of the Aspergillus takatomii SMU01, inoculating the activated strain to a liquid culture medium, and culturing for 2-5 days to obtain the seed solution.
[0036] In some embodiments of the present application, the culturing condition of inoculating the activated strain to the liquid culture medium is a rotation speed of 100-350 r / min and a culture temperature of 25-30°C.
[0037] In some embodiments of the present application, the solid culture medium includes a culture medium suitable for fungal culture.
[0038] In some embodiments of the present application, the solid culture medium includes a PDA culture medium.
[0039] In some embodiments of the present application, the liquid culture medium includes a culture medium suitable for fungal culture. In some embodiments of the present application, the liquid culture medium includes a culture medium suitable for fungal culture.
[0040] In some embodiments of the present application, the liquid culture medium comprises PDA liquid culture medium.
[0041] In some embodiments of the present application, the formula of the fermentation culture medium comprises rice 40-80 g, glucose 0.1-0.4 g, yeast extract 0.2-0.5 g, and H2O 60-100 mL.
[0042] In some embodiments of the present application, the fermentation time is 20-36 d.
[0043] In some embodiments of the present application, the fermentation time is 24-30 d.
[0044] In some embodiments of the present application, the fermentation temperature is 24-32℃.
[0045] In some embodiments of the present application, the content of rice in the rice fermentation culture medium is 6-8 g / mL.
[0046] In some embodiments of the present application, the PDA culture medium comprises 100-300 g of potato and 10-30 g of glucose per liter of water.
[0047] In some embodiments of the present application, the extraction step comprises crushing the fermentation product, soaking with a first organic phase, removing the organic phase to obtain an aqueous phase, extracting the aqueous phase with a second organic phase for 1-5 times, and combining the extraction liquid to obtain the extract.
[0048] In some embodiments of the present application, the first organic phase is methanol, ethanol, or isopropanol.
[0049] In some embodiments of the present application, the second organic phase is ethyl acetate, dichloromethane, or chloroform.
[0050] In some embodiments of the present application, the soaking time is 10-16 h.
[0051] In some embodiments of the present application, the volume ratio of the aqueous phase to the second organic phase is (1-2):(1-3).
[0052] In some embodiments of the present application, the method for removing the organic phase is reduced pressure concentration.
[0053] In some embodiments of the present application, the separation and purification comprises the steps of sequentially subjecting the extract to normal phase silica gel column chromatography, MCI chromatographic column, gel resin, thin layer chromatography, and high performance liquid chromatography separation and purification.
[0054] In some embodiments of the present application, the step of separation and purification by normal phase silica gel chromatography comprises eluting the extract with a first eluent after loading the extract into a normal phase silica gel chromatography column to obtain a first fraction.
[0055] In some embodiments of the present application, the first eluent is a dichloromethane and methanol solution with a volume ratio of (0-100):(100-0).
[0056] In some embodiments of the present application, the first eluent is a dichloromethane and methanol solution with a volume ratio of 70-100:0-30.
[0057] In some embodiments of the present application, the first fraction is separated by eluting the first fraction with a second eluent after loading the first fraction into a MCI column to obtain a second fraction.
[0058] In some embodiments of the present application, the second eluent is a methanol and water solution with different gradient with a volume ratio of 20-100:80-0.
[0059] In some embodiments of the present application, the second fraction is separated by eluting the second fraction with a third eluent after loading the second fraction into a gel resin column to obtain a third fraction.
[0060] In some embodiments of the present application, the gel resin is a Toyopearl HW-40F column.
[0061] In some embodiments of the present application, the third eluent is a methanol solution.
[0062] In some embodiments of the present application, the step of separation and purification by thin layer chromatography comprises loading the third fraction into a thin layer chromatography plate and using a dichloromethane and methanol solution with a volume ratio of (8-12):(1-3) as the developing agent to collect a fraction with an Rf of 0.3 as a fourth fraction.
[0063] In some embodiments of the present application, the step of separation and purification by high performance liquid chromatography comprises eluting the fourth fraction with a fourth eluent after loading the fourth fraction into a high performance liquid chromatography column to obtain the polyketide compound.
[0064] In some embodiments of the present application, the fourth eluent is a methanol, water and formic acid solution with a volume ratio of 60-70:30-40:0.005-0.05.
[0065] In some embodiments of the present application, the high performance liquid chromatography is a semi-preparative high performance liquid chromatography.
[0066] In a fifth aspect of the present application, the use of the above-mentioned Aspergillus taichungensis SMU01, product or the above-mentioned polyketide is provided, and the use is the use in the preparation of an anti-tumor product. In addition to directly targeting and killing tumor cells expressing specific antigens, Th9 cells can also stimulate mononuclear cells recruited into tumors to release type I interferons, thereby activating the host's immune system to kill antigen-loss tumor cells, and ultimately achieving the purpose of completely eradicating tumors.
[0067] In some embodiments of the present application, the use is the use in the preparation of a product for promoting the proliferation of Th9 cells.
[0068] In some embodiments of the present application, the use is the use in the preparation of a product for promoting the proliferation of CD8 + T cells.
[0069] In some embodiments of the present application, the use is the use in the preparation of an IL-9 expression promoter.
[0070] In some embodiments of the present application, the use is the use in the preparation of an IL-9 expression promoter in Th9 cells.
[0071] In some embodiments of the present application, the use is the use in the preparation of an IFN-γ and / or TNF-a secretion promoter.
[0072] In some embodiments of the present application, the use is the use in the preparation of an IFN-γ and / or TNF-a secretion promoter in Th9 cells.
[0073] According to some embodiments of the present application, at least the following beneficial effects are provided: the polyketide Aspertaichunol A is isolated from Aspergillus taichungensis SMU01, and it is found that the polyketide Aspertaichunol A has the effects of promoting the proliferation of Th9 and CD8 + T cells, increasing the secretion of IFN-γ and TNF-a, and increasing the expression of IL-9, which can be effectively used to enhance the anti-tumor effect of Th9 cells, and has important value for the development and application of anti-tumor drugs. BRIEF DESCRIPTION OF DRAWINGS
[0074] The present application will be further described below in conjunction with the drawings and examples, in which:
[0075] Figure 1 FIG. 1 is an ITS sequence identification chart in Example 1 of the present application;
[0076] Figure 2Figure for the results of two-dimensional nuclear magnetic COSY, HMBC and ROESY spectrum analysis in Example 3 of the present application;
[0077] Figure 3 Figure for the results of quantum chemistry ECD calculation in Example 3 of the present application;
[0078] Figure 4 Figure for the results of two-dimensional nuclear magnetic COSY, HMBC and ROESY spectrum analysis in Example 3 of the present application; 13 Figure for the results of C NMR calculation;
[0079] Figure 5 Figure for the results of flow cytometry detection in Example 4 of the present application;
[0080] Figure 6 Figure for the results of IL-9 expression detection in Example 4 of the present application;
[0081] Figure 7 Figure for the results of CFSE dilution test analysis in Example 4 of the present application, wherein, A and B are figures for the results of flow cytometry detection of CFSE proliferation cell percentage analysis; C is a figure for the results of secretion effect detection of IFN-γ and TNF-a in Th9 cells. DETAILED DESCRIPTION
[0082] The concept and the technical effects of the present application will be described below in combination with examples, so as to fully understand the purpose, features and effects of the present application. Obviously, the described examples are only a part of the examples of the present application, but not all the examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor are within the protection scope of the present application.
[0083] The culture medium and its preparation method involved in the following examples are as follows:
[0084] Potato glucose water culture medium: 200 g of potatoes were boiled with 500 mL of pure water for 20 min, and the potato juice was obtained by filtration. Then 20 g of glucose was added, and the water was added to 1000 mL. The medium was sterilized by high-pressure steam at 110℃ for 25 min.
[0085] Fermentation medium: 60 g of rice, 0.3 g of glucose and 0.3 g of yeast extract were weighed, 80 mL of H2O was added, and the medium was sterilized by high-pressure steam at 110℃ for 25 min.
[0086] Example 1 Obtaining of Aspergillus taichungensis SMU01
[0087] 1. Isolation of Aspergillus taichungensis SMU01 strain
[0088] The specific method for isolating Aspergillus taichungensis SMU01 strain is as follows: 10 American cockroaches (from Baiyun campus of Southern Medical University, identified by authoritative classification experts of Kunming Institute of Zoology) are sampled, soaked in 75% ethanol for 1 min, and under sterile operation conditions, the insect bodies are transferred to 10% sodium hypochlorite for 5 min, then rinsed with sterile water for 10 times to achieve the effect of surface disinfection of the insect bodies (in order to test the surface disinfection effect, the last time the sterile water is coated and cultured at 30°C for 2d, if no bacterial colony appears, it proves that the surface sterilization of the insect body is complete, and the result obtained by the endophyte is reliable). The dried insect bodies are dissected, the internal organs are taken out, and the internal organs are ground with a sterile mortar. A small amount is taken into a 15 mL sterile centrifuge tube, a small amount of sterile water is added, and the PDA medium (containing 50 μg / mL ampicillin and 50 μg / mL kanamycin) is coated by using the dilution method, the strain is isolated, and it is identified as Aspergillus taichungensis SMU01 by ITS sequence.
[0089] 2. Identification of Aspergillus taichungensis SMU01 strain
[0090] (1) 16s rDNA gene sequence identification
[0091] The strain spergillus taichungensis SMU01 is identified by ITS sequence, and the ITS sequence identification diagram is as follows: Figure 1As shown, the ITS sequence of the strain is: GGAAGGATCATTACCGAGTGAGGGTTTCTCTGAAGCCCAACCTCCCACCCGTGTATACCGTACCCTGTTGCTTCGGCGGGCCCGCCTCACGGCCGCCGGGGGACCTCGCGTCCCCGGGCCCGCGCCCGCCGAAGACCCCAACACGAACACTGTCTGAAAAGTGCAGTCTGAGTCGATTGTTACCAATCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCCCGGTACCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGCAGGCCCGGCCGGCGCCAGCCGACCAACCCAACCATTTTTTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC (SEQ ID NO. 1).
[0092] By submitting the amplified data of the screened fungal ITS sequence to GenBank, using NCBI for homology comparison, similar sequence information was obtained, and finally Aspergillus taichungensis was determined to be Aspergillus taichungensis, with a homology score of 99.8.
[0093] After the above identification results, it was determined that Aspergillus taichungensis SMU01 strain was Aspergillus taichungensis. The strain was deposited with the Guangdong Microbial Culture Collection Center (GDMCC) on August 30, 2022, at 100 Xianlie Road, Guangzhou, China, in Building 59, 5th Floor, and the deposit number was GDMCC NO:62752.
[0094] Isolation of compounds of Example 2
[0095] This example prepared a polyketide compound isolated from the fermentation broth of Aspergillus taichungensis SMU01, the specific process is as follows:
[0096] (1) Preparation of spore suspension: the slant strain of Aspergillus taichungensis SMU01 was inoculated into PDA solid medium, and after the fungus grew spores, it was inoculated into potato glucose aqueous liquid medium (100 mL), and then cultured with a shaker (200 r / min, 28°C) for 3 days to obtain a spore suspension.
[0097] (2) Seed liquid culture of Aspergillus taichungensis SMU01: 3 ml of spore suspension obtained in step (1) was inoculated into fermentation medium (60 g of rice, 0.3 g of glucose, 0.3 g of yeast extract, and 80 mL of H2O), and the fermentation broth was collected after incubation at room temperature (26°C) for 28 days.
[0098] (3) The fermentation broth (including the bacterial body and the rice solid medium) was crushed with a cell disrupter to obtain a paste-like mixture, which was then soaked in 100% methanol for 12 h. The extraction was repeated five times, and the extract was combined and concentrated under reduced pressure to remove methanol. The water phase was collected; the water phase was extracted with ethyl acetate (1:1 by volume), and concentrated to obtain 108.0 g of ethyl acetate extract (containing bacterial bodies and fermentation broth components).
[0099] (4) The total extract was separated by silica gel column chromatography, specifically: the normal phase silica gel (100-200 mesh) was dry mixed with the sample, then loaded into a conventional silica gel column, and column chromatography was performed at room temperature under reduced pressure. The dichloromethane-methanol system was gradient eluted with the volume ratio of dichloromethane:methanol being 100:0, 95:5, 90:10, 80:20, 70:30, 60:40, 50:50, and 0:100, respectively, and 1.5 L of eluent was used for each gradient. Different eluents were obtained, and finally the eluent was detected by TLC and HPLC to combine 8 fractions (Fr.A-Fr.H). The sample eluted with the volume ratio of dichloromethane:methanol being 90:10 was collected to obtain fraction Fr.C; fraction Fr.C was separated by MCI column with methanol / water (volume ratio 20:80-100:0, 2 L for each gradient) gradient elution to obtain six fractions (Fr.C1-Fr.C6); among them, fraction Fr.C2 eluted with methanol / water (v / v, 40:60-50:50) gradient elution was separated by Toyopearl HW-40F column (with methanol as eluent), and R fThe values of approximately 0.3 were combined to form fraction Fr.C21. Fraction Fr.C21 was further purified by semi-preparative HPLC (YMC-Pack ODS-A column, 250 × 10⁻⁵ μm, 12 nm), eluting isocratically with methanol / water / formic acid (v / v / v, 64:36:0.01) to obtain compound Aspertaichunol A (2.3 mg, t). R =21.5 min, 3 mL / min).
[0100] Structural analysis of the compound in Example 3
[0101] The structure of the new compound Aspertaichunol A was analyzed, and the following experimental data were obtained:
[0102] (1) One-dimensional NMR data analysis
[0103] Aspertaichunol A, colorless gel, high-resolution mass spectrometry (HRESIMS) results are given at m / z 319.1910 [M–H]. - Ion peak, combination 13 CNMR data (as shown in Table 1) suggest that its molecular formula is C1. 19 H 28 O4, with an unsaturation degree of 6. The signal on the proton spectrum indicates the presence of four methyl groups [δ]. H 1.201 (s, H3-11), 1.62 (d, J = 4.9 Hz, H3-16), 1.57 (d, J = 2.2 Hz, H3-18), 1.198 (d, J = 7.1 Hz, H3-19)] and two olefin methylene groups [δ H 5.41(m,H-14), 5.42(m,H-15)]. 13 C10 NMR and HSQC spectra revealed 19 carbon signals, including four methyl groups, two methylene groups, nine methylene groups (two oxidized and two olefinic), and four aprotic carbons (one aliphatic, two olefinic, and one carboxyl group). These NMR data suggest that the compound is likely a polyketide.
[0104] Table 1
[0105]
[0106] The polyketone compound has the structural formula Aspertaichunol A, as shown in formula (1):
[0107]
[0108] (2) Determination of planar structure
[0109] The planar structure of Aspertaichunol A was determined primarily by analysis of the 2D NMR data. The 2D NMR data are shown in Figure 2 Figure 1. From the figure, it can be seen that the 1 H- 1 H COSY spectrum shows correlations of H-2 / H-3 / H-4 / H-5 / H3-19 and H-8 / H-9 / H-10 / H-12 / H-13 / H-14. The HMBC spectrum shows correlations of H2 / C-3, C-6 and H-5 / C-2, C-7, confirming the presence of a five-membered ring bearing two hydroxyl groups. The HMBC spectrum also shows a correlation of H3-18 with C-6 (δ C 143.8) / C-7 (δ C 132.8), confirming the attachment of the methyl group to C-7. In addition, the HMBC spectrum shows a correlation of H-2 with C-5 / C-6, H-8 with C-11 (δ C 10.5) and H3-11 with C-1 (δ C 45.8) / C-8 (δ C 60.1) / C-10 (δ C 47.5) and H3-18 with C-8, indicating the presence of a five-membered ring with a bridgehead double bond (retro-Bredt system). This clearly indicates that the bicyclo[3.3.0]octane carbon skeleton shares the C-2-C-6 bond. Further analysis of the HMBC spectrum reveals a correlation of H-9 with C-7, C-8, C-17 (δ C 178.5), and a correlation of H-8 with C-17 indicates the presence of the C-8-C-9 bond and a carboxyl group attached to C-9. In addition, a correlation of H-9 with C-10 (δ 1 H- 1 H COSY spectrum shows correlations of H-9 / H-10 / H-12 / H-13 / H-14, H-10 / H-16, and in the HMBC spectrum, a correlation of H-10 with C-12 / C-13, H-13 with C-14 (δ C 132.3) / C-15 (δ C 126.0) and H-13 with C-14 / C-15 also confirms the presence of the short aliphatic chain. In addition to the 5 / 5 ring system, two double bonds and a carboxylic acid group account for five degrees of unsaturation, leaving one degree of unsaturation to form Compound 1. The HMBC spectrum shows a correlation of H-10 with C-1 / C-2 / C-11, combined with the chemical shifts of C-1 (δ C 45.8) and C-10 (δ C 47.5), reveals the presence of a four-membered rigid structure in nature. Thus, the planar structure of Aspertaichunol A is shown in Figure 2 Figure 1.
[0110] (3) ROESY spectral analysis
[0111] The relative configuration of the stereocrystal center of 1 was further determined by analyzing the ROESY spectrum. The results are as follows: Figure 2 As shown in the figure, the ROESY correlations between H-3 and H-5, H-2 and H-4, H-4 and H3-19, and H3-19 and H-2 indicate that H-2, H-4, and H3-19 are α-configurations, while H-3 and H-5 are β-configurations. Furthermore, the ROESY correlations between H-3 / H3-11 and H-8 / H3-11 indicate that these protons are spatially adjacent. Considering the naturally occurring rigid tricyclic [6.2.0.02,6]decane carbon skeleton in this compound, the relative configurations of C-1 and C-8 are easily determined. Additionally, the ROESY correlations between H-9 / H2-13, H3-11 / H2-12, and H3-11 / H2-13 confirm the relative configurations of C-9 and C-10. Finally, Δ... 14 The E-type of the double bond was determined by the ROESY correlation of H-14 / H3-16. Therefore, the relative configurations of the chiral carbons in Aspertaichunol A were determined to be 1S*2R*3S*4S*5R*8R*9R*10R*. In summary, we determined the relative configurations of the chiral carbons in Aspertaichunol A using quantum chemical ECD and... 13 C10 NMR calculations determined the absolute configuration of compound Aspertaichunol A to be 1S, 2R, 3S, 4S, 5R, 8R, 9R, 10R (e.g., ...). Figure 3 and Figure 4 (As shown).
[0112] Example 4: Application of the polyketide compound Aspertaichunol A in increasing IL-9 expression in Th9 cells.
[0113] This embodiment demonstrates the application of the polyketide compound Aspertaichunol A in increasing IL-9 expression in Th9 cells. The specific experimental steps are as follows:
[0114] (1)CD4 + T cell acquisition: Spleens were isolated from 6- to 8-week-old C57BL / 6 mice and filtered through a 70 μM filter. The tissue was homogenized using the rubber side of a 5 mL syringe. The filter was rinsed with PBS, and the cell suspension was transferred to a 15 mL centrifuge tube. The cells were centrifuged at 1500 rpm for 5 min at 4°C, and the supernatant was discarded. Red blood cell lysis buffer was added, and lysis was performed at room temperature for 2 min. Lysis was terminated with PBS, and the cells were centrifuged again at 1500 rpm for 5 min at 4°C. The supernatant was discarded, and the cells were resuspended. CD4 cells were sorted using a STEM cell sorting kit. + T cells.
[0115] (2) In vitro differentiation of Th9 cells: After coating with anti-CD3 monoclonal antibody at 4°C overnight, Th9 polarization medium containing 20 nM of Comp1 (Aspertaichunol A), IL-4 (10 ng / mL), TGF-β (1 ng / mL), anti-IFN-γ monoclonal antibody (20 μg / mL), and anti-CD28 monoclonal antibody (1 μg / mL) was used to culture CD4 + CD62L + After 3 days of T cell culture, the medium was replaced and the cells were transferred to a new well CD4 + CD62L + T cells, 20 nM of Comp1 was re-added when the culture medium was replaced; the control group was different from the experimental group in that it did not contain Comp1 (Ctrl group), and the expression of cell surface and intracellular nuclear markers and IL-9 in Th9 cells was detected by flow cytometry and enzyme-linked immunosorbent assay (ELISA) on the third or fourth day of culture.
[0116] (3) T cell proliferation: Th9 cells obtained in step (2) were incubated with PBS solution containing 1.25 μM CFSE at 37°C for 20 min, then washed thoroughly, and T cell proliferation was measured by relative CFSE dilution method.
[0117] The experimental results are shown in Figures 5-6 As can be seen from the figure, in the presence or absence of Comp1, purified CD4 + T cells differentiated into Th9 cells, and Comp1 (Aspertaichunol A) stimulation significantly increased the expression of IL-9 in Th9 cells, as detected by flow cytometry or enzyme-linked immunosorbent assay (ELISA), **P < 0.01.
[0118] The results of the CFSE dilution test are shown in Figure 7 Figures A and B show the percentage of CFSE proliferating cells detected by flow cytometry when Th9 cells (Tc1 cells) were additionally treated with 20 nM of Comp1 for 3 days, as shown in Figure A, the proliferation ability of Th9 cells was enhanced after 1 treatment, as shown in Figure B, Comp1 also promoted the proliferation of CD8 + T cells, Figure C shows the expression of IFN-g and TNF-a in Th9 cells when 20 nM of Comp1 was added or not added on the fourth day, as shown in Figure C, Comp1 also promoted the secretion of IFN-γ and TNF-a in Th9 cells.
[0119] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application. Furthermore, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.
Claims
1. A strain, characterized in that, The strain is *Aspergillus taichungense* (… Aspergillus taichungensis SMU01, deposited at Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC NO: 62752, deposited on August 30, 2022.
2. A product characterized by, comprises at least one of (1)-(6): (1) the strain of claim 1; (2) a microbial agent containing the strain of claim 1; (3) a viable bacterial liquid containing the strain of claim 1; (4) a dead bacterial liquid containing the strain of claim 1; (5) a metabolite containing the strain of claim 1; (6) an extract containing the strain of claim 1; the metabolite is a polyketide compound Aspertaichunol A; the extract is a polyketide compound Aspertaichunol A; the polyketide compound Aspertaichunol A has a structural formula as shown in the following formula (I): 。 3. A polyketide compound, characterized by, the polyketide compound has a structural formula as shown in the following formula (I): 。 4. The method for producing a polyketide compound according to claim 3, wherein the method comprises the following steps: S1, fermenting the strain of claim 1 to obtain a fermentation product; S2, extracting the fermentation product to obtain an extract; S3, separating and purifying the extract to obtain the polyketide compound.
5. The preparation method according to claim 4, characterized in that, The fermentation culture comprises the step of adding the seed liquid of the Aspergillus taichungensis SMU01 to the fermentation culture medium.
6. The production method according to claim 5, wherein The preparation of the seed liquid of the Aspergillus taichungensis SMU01 comprises the steps of inoculating the Aspergillus taichungensis SMU01 slant strain into a solid culture medium to activate, obtaining the activated Aspergillus taichungensis SMU01 strain, inoculating the activated strain into a liquid culture medium, and culturing for 2-5 days to obtain the seed liquid.
7. The preparation method according to claim 4, characterized in that, The extraction step comprises the steps of crushing the fermentation product, soaking with a first organic phase, removing the organic phase to obtain an aqueous phase, extracting the aqueous phase with a second organic phase for 1-5 times, combining the extraction liquid to obtain the extract; The first organic phase is methanol, ethanol or isopropanol, and the second organic phase is ethyl acetate, dichloromethane or chloroform.
8. The preparation method according to claim 4, characterized in that, The separation and purification comprises the steps of sequentially subjecting the extract to normal phase silica gel column chromatography, MCI chromatographic column, gel resin, thin layer chromatography and high performance liquid chromatography separation and purification.
Citation Information
Cited By
Biosynthetic gene cluster of fungus polyketone compound and application of biosynthetic gene cluster
CN122168645A