Construction of a saccharomyces cerevisiae strain for extracellular transport of lycopene and its application
By constructing a recombinant Saccharomyces cerevisiae strain, enhancing the expression of specific enzymes and proteins, heterologously expressing key genes and knocking out repressor factors, the problem of intracellular accumulation of lycopene in Saccharomyces cerevisiae was solved, achieving efficient extracellular secretion of lycopene and improving production capacity.
Patent Information
- Application Number
- CN202211004881.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-22
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-08-22
AI Technical Summary
Existing Saccharomyces cerevisiae strains exhibit feedback inhibition and cytotoxicity due to intracellular accumulation in lycopene production, limiting the improvement of lycopene production capacity. There is a lack of effective strategies to promote extracellular secretion using lycopene transporters.
A recombinant Saccharomyces cerevisiae strain was constructed to enhance the expression of 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, NADH kinase POS5, and ABC transporter Snq2. A mutant CrtYBM1, containing geranyl-geranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, and bifunctional lycopene cyclase/phytoene synthase CrtYB, was also heterologously expressed. The ROX1, EXG1, and GAL80 genes were knocked out, and the URA3 gene was reintroduced.
It improved the extracellular secretion capacity of lycopene in Saccharomyces cerevisiae, with the secretion amount reaching 16.5 times that of the control strain, thus achieving efficient lycopene production.
Smart Images

Figure CN115975830B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the construction and application of a Saccharomyces cerevisiae strain that transports lycopene extracellularly, belonging to the field of fermentation engineering technology. Background Technology
[0002] Lycopene, a tetraterpenoid compound, is one of the most widely used carotenoids in the health supplement market. It has antioxidant, anti-aging, and cancer-preventive effects and is widely used in food, medicine, cosmetics, and dietary supplements, and has extremely high market value.
[0003] With the development of metabolic engineering, introducing the lycopene synthesis pathway into a microbial heterologous host has become a more economical and sustainable strategy for lycopene production. As a platform microorganism widely used in industrial fermentation, *Saccharomyces cerevisiae* (Saccharomyces cerevisiae)... S. cerevisiae It has many advantages, such as short reproductive cycle, simple nutritional requirements, and ease of genetic manipulation. The mevalonic acid (MVA) pathway present in its cells can naturally provide precursors for the synthesis of terpenoid products, thus making it an excellent host for heterologous production of lycopene.
[0004] However, as a non-oil-producing yeast, the excessive synthesis of lycopene in *Saccharomyces cerevisiae* accumulates intracellularly, causing feedback inhibition and cytotoxicity, thus limiting further improvements in lycopene production. Promoting the extracellular secretion of excess lycopene through transport proteins is a potential strategy to alleviate this bottleneck; however, there are currently no reports on lycopene transport proteins, making the efficient secretion of lycopene a major challenge in existing research. Summary of the Invention
[0005] To identify whether endogenous lycopene transport proteins exist in Saccharomyces cerevisiae and to explore the secretion mechanism, thereby improving the extracellular secretion capacity of the producing strain of lycopene.
[0006] This invention provides a recombinant Saccharomyces cerevisiae strain, wherein the recombinant Saccharomyces cerevisiae strain enhances the expression of truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, NADH kinase POS5, and ABC transporter Snq2; heterologously expresses a mutant CrtYBM1 of geranyl geranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, and bifunctional lycopene cyclase / phytoene synthase CrtYB; knocks out the ROX1, EXG1, and GAL80 genes in the Saccharomyces cerevisiae; and replenishes the orotidine 5'-phosphate decarboxylase URA3 gene.
[0007] In one embodiment of the present invention, the recombinant brewer's yeast utilizes P GPDThe promoter expresses tHMG1, utilizing P PGK1 The promoter expresses INO2, using P TEF1 The promoter expresses ERG20 and IDI1, utilizing P GAL1,10 Bidirectional promoters express CrtI and CrtE, utilizing P GAL7 The promoter expresses POS5 and heterologously expresses CrtYBM1, using P TDH3 The promoter expression Snq2 utilizes P URA3 The promoter expresses URA3.
[0008] In one embodiment of the present invention, the enhanced expression refers to the expression of 2 copies of tHMG1, 1 copy of IDI1, 1 copy of ERG20, 1 copy of INO2, 1 copy of POS5 and 1 copy of Snq2 on the Saccharomyces cerevisiae genome.
[0009] In one embodiment of the present invention, the heterologous expression refers to the expression of 3 copies of CrtE, 3 copies of CrtI, and 1 copy of CrtYBM1 on the Saccharomyces cerevisiae genome.
[0010] In one embodiment of the present invention, the recombinant brewing yeast uses brewing yeast BY4741 as the starting strain.
[0011] In one embodiment of the present invention, the Gene ID of the tHMG1 sequence is 42650, the Gene ID of IDI1 is 855986, the Gene ID of ERG20 is 853272, the Gene ID of INO2 is 851701, the Gene ID of POS5 is 855913, the Gene ID of the Snq2 protein is 851574, the GenInfo Identifier of CrtE is 45505274, the GenInfo Identifier of CrtI is 37729024, the GenBank number of CrtYB is ALK24266.1, the Gene ID of ROX1 is 856178, the Gene ID of EXG1 is 851007, the Gene ID of GAL80 is 854954, and the Gene ID of URA3 is 856692.
[0012] In one embodiment of the present invention, the mutant CrtYBM1 is based on CrtYB, with tryptophan at position 61 mutated to arginine W61R.
[0013] In one embodiment of the present invention, the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is based on tHMG1 with 530 amino acids truncated at the N-terminus, and the nucleotide sequence is shown in SEQ ID NO. 15.
[0014] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae integrates 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 into the ROX1 site on the Saccharomyces cerevisiae genome through gene recombination; and integrates into the ERG20 site on the Saccharomyces cerevisiae genome, wherein the Gene ID of ERG20 is 853272;
[0015] The isopentenyl pyrophosphate isomerase IDI1 was integrated into the 911b site on the Saccharomyces cerevisiae genome, located on chromosome 9, with the guide sequence GTAATATTGTCTTGTTTCCC.
[0016] P TEF1 The promoter-enhanced expression of farnesyl pyrophosphate synthase ERG20 was integrated into the ERG20 site on the Saccharomyces cerevisiae genome, and the Gene ID of ERG20 was 853272.
[0017] The natural promoter of the endoplasmic reticulum size regulator INO2 on the Saccharomyces cerevisiae genome was replaced with P. PGK1 promoter;
[0018] The ABC transporter Snq2 was integrated into the 208a site on the Saccharomyces cerevisiae genome, which is located on chromosome 2, with the guide sequence GTCCGCTAAACAAAAGATCT.
[0019] Will Taxus x media Geraniol-geraniol diphosphate synthase CrtE was integrated into the Saccharomyces cerevisiae genome at site 308a, located on chromosome 3, with the guide sequence CACTTGTCAAACAGAATATA; site 1309a, located on chromosome 13, with the guide sequence CCTGTGGTGACTACGTATCC; and site 416d, located on chromosome 4, with the guide sequence TAGTGCACTTACCCCACGTT.
[0020] Will Blakeslea trisporaThe phytopene dehydrogenase CrtI from this source was integrated into the 308a site of the Saccharomyces cerevisiae genome, located on chromosome 3, with the guide sequence CACTTGTCAAACAGAATATA; the 1309a site, located on chromosome 13, with the guide sequence CCTGTGGTGACTACGTATCC; and the 416d site, located on chromosome 4, with the guide sequence TAGTGCACTTACCCCACGTT.
[0021] The NADH kinase POS5 was integrated into the EXG1 site on the Saccharomyces cerevisiae genome, and the Gene ID of the EXG1 site is 851007.
[0022] Will Phaffia rhodozyma The mutant CrtYBM1, obtained by replacing T with C at nucleotide 181 of the bifunctional lycopene cyclase / hydrolycopene synthase CrtYB, was integrated into the YPRCδ15c site on the Saccharomyces cerevisiae genome. This site is located on chromosome 16 and the guide sequence is AATCCGACAACAGAGCATA.
[0023] The orotic 5'-phosphate decarboxylase URA3 was reintegrated into the URA3 site on the Saccharomyces cerevisiae genome, and the Gene ID of the URA3 was 856692.
[0024] Simultaneously, the transcriptional repressor ROX1 of the ergosterol biosynthesis (ERG) gene, glucan 1,3-β-glucosidase EXG1, and galactose / lactose metabolism regulator GAL80 were knocked out.
[0025] In one embodiment of the present invention, the P GPD The nucleotide sequence of the promoter is shown in SEQ ID NO. 8, wherein P PGK1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 9, P TEF1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 10, P GAL1,10 The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO. 11, wherein P GAL7 The nucleotide sequence of the promoter is shown in SEQ ID NO. 12, wherein P TDH3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 13, wherein P URA3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 14.
[0026] The present invention also provides a method for constructing the above-mentioned recombinant brewer's yeast, the method comprising the following steps:
[0027] (1) Knock out the gene encoding ROX1 on the genome of Saccharomyces cerevisiae and P GPD -tHMG1-T ADH1 The fragment was integrated into the ROX1 site on the BY4741 genome to construct the Saccharomyces cerevisiae strain Y1.
[0028] (2) P TEF1 -IDI1-T CYC1 The fragment was integrated into the 911b site on the genome of strain Y1 to construct Saccharomyces cerevisiae strain Y2.
[0029] (3) P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 The fragment was integrated into the ERG20 site on the genome of strain Y2 to construct Saccharomyces cerevisiae strain Y3.
[0030] (4) P PGK1 -INO2-T INO2 The fragment was integrated into the INO2 site on the genome of strain Y3 to construct Saccharomyces cerevisiae strain Y4.
[0031] (5) T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 The fragment was integrated into the 308a site on the genome of strain Y4 to construct the Saccharomyces cerevisiae strain L1.
[0032] (6) T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 The fragment was integrated into the genome of strain L1 for 416 days to construct Saccharomyces cerevisiae strain L2.
[0033] (7) Knock out the gene encoding the GAL80 enzyme on the L2 genome to construct the Saccharomyces cerevisiae strain L3;
[0034] (8) T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 The fragment was integrated into the L3 strain genome at 1309a to construct the Saccharomyces cerevisiae strain L4.
[0035] (9) Knock out the gene encoding EXG1 on the L4 genome and remove P GAL7 -POS5-T CYC1 The fragment was integrated into the EXG1 site on the BY4741 genome to construct the Saccharomyces cerevisiae strain L5.
[0036] (10) P GAL7-CrtYBM1-T CYC1 The YPRCδ15c site was integrated into the genome of strain L5 to construct Saccharomyces cerevisiae strain L6.
[0037] (11) P URA3 -URA3-T URA3 The fragment was integrated into the URA3 site on the genome of strain L6 to construct Saccharomyces cerevisiae strain L7.
[0038] (12) P TDH3 -SNQ2-T CYC1 The fragment was integrated into the 208a site on the L7 strain genome to construct the Saccharomyces cerevisiae strain L7Z2.
[0039] In one embodiment of the present invention, the P GPD -tHMG1-T ADH1 Fragment, P TEF1 -IDI1-T CYC1 Fragment, P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 Fragment, P PGK1 -INO2-T INO2 The sequence of the fragment is disclosed in the invention patent with publication number CN113684141 A.
[0040] In one embodiment of the present invention, the T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 The nucleotide sequence of the fragment is shown in SEQ ID NO. 1, wherein P GAL7 -POS5-T CYC1 The nucleotide sequence of the fragment is shown in SEQ ID NO. 4, wherein P GAL7 -CrtYBM1-T CYC1 The nucleotide sequence of the fragment is shown in SEQ ID NO. 5, wherein P URA3 -URA3-T URA3 The nucleotide sequence of the fragment is shown in SEQ ID NO. 6, wherein P TDH3 -SNQ2-T CYC1 The nucleotide sequence of the fragment is shown in SEQ ID NO. 7.
[0041] The present invention also provides a method for preparing lycopene, which is prepared by fermentation of the above-mentioned recombinant brewing yeast.
[0042] In one embodiment of the present invention, the method is to inoculate the recombinant brewing yeast into a seed culture medium to prepare a seed liquid, and inoculate the prepared seed liquid into a fermentation culture medium at an inoculation rate of 2% to 4% (v / v) for fermentation culture to prepare lycopene.
[0043] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is inoculated into SD-Trp medium and cultured at 30°C and 220 rpm for 16-24 h to obtain seed culture.
[0044] In one embodiment of the present invention, the SD-Trp culture medium comprises per liter of: 50 mg uracil, 50 mg leucine, 50 mg histidine, 6.7 g amino-free yeast nitrogen source (YNB), and 20 g anhydrous glucose.
[0045] In one embodiment of the present invention, the prepared seed liquid is inoculated into the fermentation medium at an inoculation rate of 2% to 4% (v / v) and cultured at 30°C and 220 rpm for 84 to 96 h.
[0046] In one embodiment of the present invention, the fermentation medium comprises per liter of: 50 g soybean peptone, 25 g anhydrous glucose, 25 g sucrose, 25 g glycerol, and 0.6 g K2HPO4.
[0047] This invention also provides the application of ABC transporter Snq2 in improving the production of lycopene from recombinant Saccharomyces cerevisiae.
[0048] In one embodiment of the present invention, the Gene ID of the ABC transporter Snq2 is 851574.
[0049] In one embodiment of the present invention, the method for constructing the recombinant brewing yeast is as described above.
[0050] This invention also provides a method for enhancing the extracellular secretion of lycopene in *Saccharomyces cerevisiae*, the method comprising: enhancing the expression of truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, NADH kinase POS5, and ABC transporter Snq2 in *Saccharomyces cerevisiae*; heterologously expressing a mutant of geranyl-geranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, and bifunctional lycopene cyclase / phytoene synthase CrtYB, CrtYBM1; knocking out the ROX1, EXG1, and GAL80 genes in *Saccharomyces cerevisiae*; and reintroducing the orotidine 5'-phosphate decarboxylase URA3 gene.
[0051] In one embodiment of the present invention, the recombinant brewer's yeast utilizes P GPD The promoter expresses tHMG1, utilizing P PGK1 The promoter expresses INO2, using P TEF1 The promoter expresses ERG20 and IDI1, utilizing P GAL1,10 Bidirectional promoters express CrtI and CrtE, utilizing P GAL7 The promoter expresses POS5 and heterologously expresses CrtYBM1, using P TDH3 The promoter expression Snq2 utilizes P URA3 The promoter expresses URA3.
[0052] In one embodiment of the present invention, the Gene ID of tHMG1 is 42650, the Gene ID of IDI1 is 855986, the Gene ID of ERG20 is 853272, the Gene ID of INO2 is 851701, the Gene ID of POS5 is 855913, the Gene ID of Snq2 protein is 851574, the GenInfo Identifier of CrtE is 45505274, the GenInfo Identifier of CrtI is 37729024, the GenBank number of CrtYB is ALK24266.1, the Gene ID of ROX1 is 856178, the Gene ID of EXG1 is 851007, the Gene ID of GAL80 is 854954, and the Gene ID of URA3 is 856692.
[0053] In one embodiment of the present invention, the P GPD The nucleotide sequence of the promoter is shown in SEQ ID NO. 8, wherein P PGK1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 9, P TEF1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 10, P GAL1,10 The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO. 11, wherein P GAL7 The nucleotide sequence of the promoter is shown in SEQ ID NO. 12, wherein P TDH3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 13, wherein P URA3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 14.
[0054] In one embodiment of the present invention, the recombinant brewing yeast uses brewing yeast BY4741 as the starting strain.
[0055] In one embodiment of the present invention, the recombinant Saccharomyces cerevisiae is genetically recombined by integrating 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 into the ROX1 site on the Saccharomyces cerevisiae genome;
[0056] The isopentenyl pyrophosphate isomerase IDI1 was integrated into the 911b site on the Saccharomyces cerevisiae genome, located on chromosome 9, with the guide sequence GTAATATTGTCTTGTTTCCC.
[0057] The farnesyl pyrophosphate synthase ERG20 was integrated into the ERG20 site on the Saccharomyces cerevisiae genome;
[0058] The endoplasmic reticulum size regulator INO2 was integrated into the INO2 site on the Saccharomyces cerevisiae genome, and the Gene ID of INO2 was 851701;
[0059] The ABC transporter Snq2 was integrated into the 208a site on the Saccharomyces cerevisiae genome, which is located on chromosome 2, with the guide sequence GTCCGCTAAACAAAAGATCT.
[0060] Will Taxus x media Geraniol-geraniol diphosphate synthase CrtE was integrated into the Saccharomyces cerevisiae genome at site 308a, located on chromosome 3, with the guide sequence CACTTGTCAAACAGAATATA; site 1309a, located on chromosome 13, with the guide sequence CCTGTGGTGACTACGTATCC; and site 416d, located on chromosome 4, with the guide sequence TAGTGCACTTACCCCACGTT.
[0061] Will Blakeslea trispora The phytopene dehydrogenase CrtI from this source was integrated into the 308a site of the Saccharomyces cerevisiae genome, located on chromosome 3, with the guide sequence CACTTGTCAAACAGAATATA; the 1309a site, located on chromosome 13, with the guide sequence CCTGTGGTGACTACGTATCC; and the 416d site, located on chromosome 4, with the guide sequence TAGTGCACTTACCCCACGTT.
[0062] The NADH kinase POS5 was integrated into the EXG1 site on the Saccharomyces cerevisiae genome, and the Gene ID of the EXG1 site is 851007.
[0063] Will Phaffia rhodozymaThe mutant CrtYBM1, obtained by replacing T with C at nucleotide 181 of the bifunctional lycopene cyclase / hydrolycopene synthase CrtYB, was integrated into the YPRCδ15c site on the Saccharomyces cerevisiae genome. This site is located on chromosome 16 and the guide sequence is AATCCGACAACAGAGCATA.
[0064] The orotic 5'-phosphate decarboxylase URA3 was reintegrated into the URA3 site on the Saccharomyces cerevisiae genome, and the Gene ID of the URA3 site was 856692.
[0065] Simultaneously, the transcriptional repressor ROX1 of the ergosterol biosynthesis (ERG) gene, glucan 1,3-β-glucosidase EXG1, and galactose / lactose metabolism regulator GAL80 were knocked out.
[0066] The present invention also provides the application of the above-mentioned recombinant brewing yeast, or the above-mentioned method, in the preparation of products containing lycopene.
[0067] Beneficial effects
[0068] This invention constructs a recombinant strain capable of extracellularly transporting lycopene. S. cerevisiae Strain L7, when used for biphasic fermentation in 250 mL shake flasks, achieved a lycopene yield of 35.74 mg / g DCW (organic phase content 0.76 mg / L). Recombinant lycopene synthesized from this strain by overexpressing the Snq2 transporter protein was also observed. S. cerevisiae The L7Z2 strain increased lycopene secretion to 16.5 times that of the control L7 strain. The recombinant strain constructed by this invention has a stronger extracellular lycopene secretion capacity and has broad application prospects. Attached Figure Description
[0069] Figure 1 Lycopene intracellular content (mg / g DCW), lycopene extracellular secretion (mg / L), and biomass (OD) of different recombinant brewer's yeasts 600 ). Detailed Implementation
[0070] The BY4741 strain involved in the following examples was purchased from Beijing Huayueyang Biotechnology Co., Ltd.
[0071] The culture media involved in the following examples are as follows:
[0072] LB liquid medium: contains 10 g tryptone, 10 g NaCl and 5 g yeast extract per liter.
[0073] YPD liquid culture medium: contains 10 g yeast extract, 20 g tryptone and 20 g glucose per liter.
[0074] SD-Trp medium: uracil 50 mg, leucine 50 mg, histidine 50 mg, amino-free yeast nitrogen source (YNB) 6.7 g, anhydrous glucose 20 g.
[0075] SD-Ura medium: Each liter contains 50 mg of L-leucine, 50 mg of L-tryptophan, 50 mg of L-histidine, 6.7 g of amino-free yeast nitrogen source (YNB), and 20 g of anhydrous glucose.
[0076] Fermentation medium: Each liter contains 50 g soybean peptone, 25 g anhydrous glucose, 25 g sucrose, 25 g glycerol, and 0.6 g K2HPO4.
[0077] SD-Leu plates: Aminam-free yeast nitrogen source (YNB) 6.7 g / L, glucose 20 g / L, L-tryptophan 50 mg / L, L-histidine 50 mg / L, uracil 50 mg / L, agar powder 20 g / L.
[0078] SD His plates: Aminam-free yeast nitrogen source (YNB) 6.7 g / L, glucose 20 g / L, L-tryptophan 50 mg / L, L-leucine 50 mg / L, uracil 50 mg / L, agar powder 20 g / L.
[0079] SD Ura plates: Aminamine-free yeast nitrogen source (YNB) 6.7 g / L, glucose 20 g / L, L-tryptophan 50 mg / L, L-histidine 50 mg / L, L-histidine 50 mg / L, agar powder 20 g / L.
[0080] SD-Trp-Leu plates: amino-free yeast nitrogen source (YNB) 6.7 g / L, glucose 20 g / L, L-histidine 50 mg / L, uracil 50 mg / L, agar powder 20 g / L.
[0081] YPD solid plates: 1% yeast extract, 2% tryptone, 2% glucose, 1.5% agar powder.
[0082] The detection methods involved in the following embodiments are as follows:
[0083] Detection of lycopene content during biphasic fermentation:
[0084] The fermented bacterial broth was collected, centrifuged, and the dodecane layer at the top was aspirated, filtered through a membrane, and then transferred to a liquid chromatography (LC) bottle for detecting the lycopene content in the fermentation supernatant. The fermented broth after removing the dodecane was then shaken and transferred to a disruption tube for detecting intracellular lycopene content. An equal volume of ethyl acetate was added to the disruption tube as the extraction phase. Cells were disrupted using 0.5 mm diameter glass beads, centrifuged, and the ethyl acetate layer at the top was aspirated, diluted appropriately, filtered through a membrane, and transferred to a LC bottle. High-performance liquid chromatography (HPLC) was used to detect lycopene yield. HPLC conditions were as follows: an Agilent 1260 HPLC system was used, with a C18 ODS column (5 μm, 250 × 4.6 mm, Thermo Fisher Scientific, Waltham, MA, USA). Mobile phase: 50% HPLC-grade acetonitrile, 30% HPLC-grade methanol, and 20% HPLC-grade isopropanol; flow rate: 1 mL / min. -1 The column temperature was 40℃, the wavelength was 450 nm, and the injection volume was 10 μL.
[0085] Recombinant brewer's yeast OD 600 Detection methods:
[0086] Yeast seed culture, after 16-24 h of cultivation, was inoculated at a rate of 1% (v / v) into 250 mL shake flasks containing 25 mL of fermentation medium and 2.5 mL of dodecane, and incubated at 30°C and 220 rpm. Samples were taken and diluted appropriately before measuring the OD using a UV spectrophotometer. 600 .
[0087] The plasmids involved in the following examples were constructed in Escherichia coli. E. coli The plasmid was constructed using JM109 and then used as a template to amplify the expression cassette. Simultaneously, the homologous arms upstream and downstream of the integration site and auxotrophic markers containing LoxP sites at both ends were amplified, and the recombinant Saccharomyces cerevisiae strain was constructed by transformation.
[0088] The primer sequences involved in the following examples are shown in Table 1:
[0089] Table 1: Primer sequences
[0090]
[0091] Example 1: Construction of Saccharomyces cerevisiae strain Y1
[0092] The specific steps are as follows:
[0093] (1) Fragment synthesis:
[0094] Artificially synthesized gene fragment P GPD -tHMG1-T ADH1 (The sequence is recorded in the invention patent with publication number: CN 113684141 A);
[0095] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment ROX1-UP was amplified using primers ROX1-UP-F and ROX1-UP-R with the primer sequences described in Table 1.
[0096] The gene fragment ROX1-DOWN was amplified using primers ROX1-DOWN-F and ROX1-DOWN-R.
[0097] Using plasmid pMHyLp-His (sequence described in invention patent publication number: CN 113684141 A) as a template, the ROX1-His fragment was amplified using primers ROX1-loxH-F and ROX1-loxH-R.
[0098] (2) Take the four segments P from step (1) GPD -tHMG1-T ADH1 ROX1-UP, ROX1-DOWN, and ROX1-His were subjected to fusion PCR. The correct bands obtained from the gel were excised and recovered to obtain the fusion gene fragment ΔROX1-P containing the upstream and downstream homologous arms of ROX1. GPD -tHMG1-T ADH1 .
[0099] (3) The fusion gene fragment from step (2) was transformed into competent cells of *Saccharomyces cerevisiae* strain BY4741. The cells were cultured on SD His plates at 30°C for 2-3 days. Single-colony PCR was performed using primers YZ-tHMG1-F and YZ-tHMG1-R as described in Table 1. Single colonies with correct bands were selected to obtain strain BY4741-ΔROX1-P. GPD -tHMG1-T ADH1 -His.
[0100] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid (sequence described in the invention patent with publication number: CN 113684141 A), and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak it on YPD plates containing 1 mg / mL of 5-fluoroorotic acid (5-FOA) and culture it at 30℃ for 2-3 days. Perform spot verification on SD Ura, SD His, and YPD solid plates respectively. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain BY4741-ΔROX1-P. GPD -tHMG1-T ADH1 It was named Saccharomyces cerevisiae Y1.
[0101] Example 2: Construction of Saccharomyces cerevisiae strain Y2
[0102] (1) Artificially synthesized gene fragment P TEF1 -IDI1-T CYC1 (The sequence is recorded in the invention patent with publication number: CN 113684141 A);
[0103] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 911b-UP was amplified by primers 911b-UP-F and 911b-UP-R with the primer sequences shown in Table 1.
[0104] The gene fragment 911b-DOWN was amplified using primers 911b-DOWN-F and 911b-DOWN-R.
[0105] Using plasmid pMHyLp-His as a template, the IDI1-His fragment was amplified using primers 911b-loxH-F and 911b-loxH-R.
[0106] (2) Take the four segments P from step (1) TEF1 -IDI1-T CYC1 911b-UP, 911b-DOWN, and IDI1-His were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 911b-P containing the upstream and downstream homologous arms of 911b. TEF1 -IDI1-T CYC1 .
[0107] (3) The gene fragment from step (2) was transformed into competent cells of strain Y1 prepared in Example 1, and cultured on SDHis plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-IDI1-F and YZ-IDI1-R for verification. Single colonies with correct bands were selected to obtain strain Y1-P. TEF1 -IDI1-T CYC1 -His.
[0108] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot testing on SD Ura, SD His, and YPD solid plates to verify the growth. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain Y1-P. TEF1 -IDI1-T CYC1 It was named Saccharomyces cerevisiae Y2.
[0109] Example 3: Construction of Saccharomyces cerevisiae strain Y3
[0110] The specific steps are as follows:
[0111] (1) Artificially synthesized gene fragment P GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 (The sequence is recorded in the invention patent with publication number: CN 113684141 A);
[0112] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment ERG20-UP was amplified using primers ERG20-UP-F and ERG20-UP-R with the primer sequences described in Table 1.
[0113] The gene fragment ERG20-DOWN was amplified using primers ERG20-DOWN-F and ERG20-DOWN-R.
[0114] Using plasmid pMHyLp-His as a template, the ERG20-His fragment was amplified using primers ERG20-loxH-F and ERG20-loxH-R.
[0115] (2) Take the four segments P from step (1) GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1ERG20-UP, ERG20-DOWN, and ERG20-His were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment ΔERG20-UP containing the upstream and downstream homologous arms of ERG20. GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 ;
[0116] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain Y2 prepared in Example 2, and cultured on SD His plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-ERG20-F and YZ-ERG20-R to verify the fusion gene fragment. Single colonies with the correct bands were selected to obtain strain Y2-P. GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 -His.
[0117] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot plating verification on SD Ura, SD His, and YPD solid plates. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain Y2-P. GPD -tHMG1-T ADH1 -P TEF1 -ERG20-T CYC1 It was named Saccharomyces cerevisiae Y3.
[0118] Example 4: Construction of Saccharomyces cerevisiae strain Y4
[0119] The specific steps are as follows:
[0120] (1) Artificially synthesized gene fragment P PGK1 -INO2-T INO2 (The sequence is recorded in the invention patent with publication number: CN 113684141 A);
[0121] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment INO2-UP was amplified using primers INO2-UP-F and INO2-UP-R with the primer sequences described in Table 1.
[0122] The gene fragment INO2-DOWN was amplified using primers INO2-DOWN-F and INO2-DOWN-R.
[0123] Using plasmid pMHyLp-His as a template, the INO2-His fragment was amplified using primers INO2-loxH-F and INO2-loxH-R.
[0124] (2) Take the four segments P from step (1) PGK1 -INO2-T INO2 INO2-UP, INO2-DOWN, and INO2-His were fused using PCR. The correct bands obtained from gel chromatography were excised and recovered to yield the fusion gene fragment ΔP containing the upstream and downstream homologous arms of INO2. INO2 -P PGK1 -INO2-T INO2 ;
[0125] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain Y3 prepared in Example 3, and cultured on SD His plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-INO2-F and YZ-INO2-R to verify the fusion gene fragment. Single colonies with the correct bands were selected to obtain strain Y3-P. PGK1 -INO2-T INO2 -His.
[0126] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot plating verification on SD Ura, SD His, and YPD solid plates. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain Y3-P. PGK1 -INO2-T INO2 It was named Saccharomyces cerevisiae Y4.
[0127] Example 5: Construction of Saccharomyces cerevisiae strain L1
[0128] The specific steps are as follows:
[0129] (1) Artificially synthesized gene fragment T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 (The nucleotide sequence is shown in SEQ ID NO. 1);
[0130] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 308a-UP was amplified by primers 308a-UP-F and 308a-UP-R with the primer sequences described in Table 1.
[0131] Gene fragment 308a-DOWN was amplified using primers 308a-DOWN-F and 308a-DOWN-R;
[0132] Using plasmid pMHyLp-Leu (which replaces the His-LoxP sequence at positions 207-2068 of the pMHyLp-His plasmid with the Leu-LoxP sequence, the Leu-LoxP nucleotide sequence is shown in SEQ ID NO. 2) as a template, the 308a-Leu fragment was amplified using primers 308a-loxL-F and 308a-loxL-R.
[0133] (2) Take the four segments T from step (1) CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 308a-UP, 308a-DOWN, and 308a-Leu were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 308a-T containing the upstream and downstream homologous arms of 308a. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;
[0134] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain Y4 prepared in Example 4, and cultured on SD Leu plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-CrtEI-1F and YZ-CrtEI-1R to verify the fusion gene fragment. Single colonies with the correct bands were selected to obtain strain Y4-T. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Leu.
[0135] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot plating verification on SD Ura, SD Leu, and YPD solid plates. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain Y4-T. CYC1 -CrtI-P GAL1,10 -CrtE-TADH1 It was named Saccharomyces cerevisiae L1.
[0136] Example 6: Construction of Saccharomyces cerevisiae strain L2
[0137] The specific steps are as follows:
[0138] (1) Artificially synthesized gene fragment T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;
[0139] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 416d-UP was amplified using primers 416d-UP-F and 416d-UP-R with the primer sequences described in Table 1.
[0140] The gene fragment 416d-DOWN was amplified using primers 416d-DOWN-F and 416d-DOWN-R.
[0141] Using plasmid pMHyLp-His as a template, the 416d-His fragment was amplified using primers 416d-loxH-F and 416d-loxH-R.
[0142] (2) Take the four segments T from step (1) CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 416d-UP, 416d-DOWN, and 416d-His were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 416d-T containing the upstream and downstream homologous arms of 416d. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;
[0143] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain L1 prepared in Example 5, and cultured on SD His plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-CrtEI-1F and YZ-CrtEI-2R. Single colonies with correct bands were selected to obtain strain L1-T. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -His.
[0144] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot plating verification on SD Ura, SD His, and YPD solid plates. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain L1-T. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 It was named Saccharomyces cerevisiae L2.
[0145] Example 7: Construction of Saccharomyces cerevisiae strain L3
[0146] The specific steps are as follows:
[0147] (1) Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment GAL80-UP was amplified by primers GAL80-UP-F and GAL80-UP-R using the primer sequences described in Table 1.
[0148] The gene fragment GAL80-DOWN was amplified using primers GAL80-DOWN-F and GAL80-DOWN-R.
[0149] Using plasmid pMHyLp-Trp (which replaces the His-LoxP sequence at positions 207-2068 of the pMHyLp-His plasmid with the Trp-LoxP sequence, the Trp-LoxP nucleotide sequence is shown in SEQ ID NO. 3) as a template, the GAL80-Trp fragment was amplified using primers GAL80-loxT-F and GAL80-loxT-R.
[0150] (2) The three fragments GAL80-UP, GAL80-DOWN and GAL80-Trp from step (1) were subjected to fusion PCR. The correct bands obtained by gel running were cut and recovered to obtain the fusion gene fragment ΔGAL80 containing the upstream and downstream homologous arms of GAL80.
[0151] (3) The fusion gene fragment from step (2) was transformed into competent cells of the L2 strain prepared in Example 6, and cultured on SD Trp plates at 30°C for 2-3 days. Single colony PCR verification was performed using primers YZ-ΔGAL80-F and YZ-ΔGAL80-R as described in Table 1. Single colonies with correct bands were selected to obtain strain L2-ΔGAL80-Trp.
[0152] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot testing on SD Ura, SD Trp, and YPD solid plates to verify the growth. The single colony that grows only on YPD medium is the correct Saccharomyces cerevisiae strain L2-ΔGAL80-Trp, and is named Saccharomyces cerevisiae L3.
[0153] Example 8: Construction of Saccharomyces cerevisiae strain L4
[0154] The specific steps are as follows:
[0155] (1) Artificially synthesized gene fragment T CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;
[0156] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 1309a-UP was amplified by primers 1309a-UP-F and 1309a-UP-R with the primer sequences described in Table 1.
[0157] Gene fragment 1309a-DOWN was amplified using primers 1309a-DOWN-F and 1309a-DOWN-R;
[0158] Using plasmid pMHyLp-Leu as a template, the 1309a-Leu fragment was amplified using primers 1309a-loxL-F and 1309a-loxL-R.
[0159] (2) Take the four segments T from step (1) CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 1309a-UP, 1309a-DOWN, and 1309a-Leu were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 1309a-T containing the upstream and downstream homologous arms of 1309a. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 ;
[0160] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain L3 prepared in Example 7, and cultured on SD Leu plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-CrtEI-1F and YZ-CrtEI-3R. Single colonies with correct bands were selected to obtain strain L3-T. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Leu.
[0161] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot testing on SD Ura, SD Leu, and YPD solid plates to verify the growth. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain L3-T. CYC1 -CrtI-P GAL1,10 -CrtE-T ADH1 -Leu, named Saccharomyces cerevisiae L4.
[0162] Example 9: Construction of Saccharomyces cerevisiae strain L5
[0163] The specific steps are as follows:
[0164] (1) Artificially synthesized gene fragment P GAL7 -POS5-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 4);
[0165] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment EXG1-UP was amplified using the primer sequences described in Table 1 with primers EXG1-UP-F and EXG1-UP-R.
[0166] The gene fragment EXG1-DOWN was amplified using primers EXG1-DOWN-F and EXG1-DOWN-R.
[0167] Using plasmid pMHyLp-His as a template, the EXG1-His fragment was amplified using primers EXG1-loxH-F and EXG1-loxH-R.
[0168] (2) Take the four segments P from step (1) GAL7 -POS5-T CYC1EXG1-UP, EXG1-DOWN, and EXG1-His were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment EXG1-P containing the upstream and downstream homologous arms of EXG1. GAL7 -POS5-T CYC1 ;
[0169] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of the L4 strain prepared in Example 8, and cultured on SD His plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-POS5-F and YZ-POS5-R to verify the fusion gene fragment. Single colonies with the correct bands were selected to obtain strain L4-P. GAL7 -POS5-T CYC1 -His.
[0170] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot testing on SD Ura, SD His, and YPD solid plates to verify the growth. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain L4-P. GAL7 -POS5-T CYC1 -His, named Saccharomyces cerevisiae L5.
[0171] Example 10: Construction of Saccharomyces cerevisiae strain L6
[0172] The specific steps are as follows:
[0173] (1) Artificially synthesized gene fragment P GAL7 -CrtYBM1-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 5);
[0174] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment YPRCδ15c-UP was amplified by primers YPRCδ15c-UP-F and YPRCδ15c-UP-R with the primer sequences described in Table 1.
[0175] The gene fragment YPRCδ15c-DOWN was amplified using primers YPRCδ15c-DOWN-F and YPRCδ15c-DOWN-R.
[0176] Using plasmid pMHyLp-Leu as a template, the YPRCδ15c-Leu fragment was amplified using primers YPRCδ15c-loxL-F and YPRCδ15c-loxL-R.
[0177] (2) Take the four segments P from step (1) GAL7 -CrtYBM1-T CYC1 YPRCδ15c-UP, YPRCδ15c-DOWN, and YPRCδ15c-Leu were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment YPRCδ15c-P containing the upstream and downstream homologous arms of YPRCδ15c. GAL7 -CrtYBM1-T CYC1 ;
[0178] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain L5 prepared in Example 9, and cultured on SD Leu plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-CrtYBM1-F and YZ-CrtYBM1-R. Single colonies with correct bands were selected to obtain strain L5-P. GAL7 -CrtYBM1-T CYC1 -Leu.
[0179] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform spot testing on SD Ura, SD Leu, and YPD solid plates to verify the growth. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain L5-P. GAL7 -CrtYBM1-T CYC1 -Leu, named brewer's yeast L6.
[0180] Example 11: Construction of Saccharomyces cerevisiae strain L7
[0181] The specific steps are as follows:
[0182] (1) Artificially synthesized gene fragment P URA3 -URA3-T URA3 (The nucleotide sequence is shown in SEQ ID NO. 6);
[0183] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment URA3-UP was amplified using primers URA3-UP-F and URA3-UP-R with the primer sequences described in Table 1.
[0184] The gene fragment URA3-DOWN was amplified using primers URA3-DOWN-F and URA3-DOWN-R.
[0185] (2) Take the four segments P from step (1) URA3 -URA3-T URA3 URA3-UP and URA3-DOWN were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment URA3-P containing the upstream and downstream homologous arms of URA3. URA3 -URA3-T URA3 ;
[0186] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain L6 prepared in Example 10, and cultured on SD Ura plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-URA3-F and YZ-URA3-R. Single colonies with correct bands were selected to obtain strain L6-P. URA3 -URA3-T URA3 It was named Saccharomyces cerevisiae L7.
[0187] Example 12: Construction of Saccharomyces cerevisiae strain L7Z2
[0188] The specific steps are as follows:
[0189] (1) Artificially synthesized gene fragment P TDH3 -SNQ2-T CYC1 (The nucleotide sequence is shown in SEQ ID NO. 7);
[0190] Using the genome of Saccharomyces cerevisiae BY4741 as a template, the gene fragment 208a-UP was amplified by primers 208a-UP-F and 208a-UP-R with the primer sequences described in Table 1.
[0191] Gene fragment 208a-DOWN was amplified using primers 208a-DOWN-F and 208a-DOWN-R;
[0192] Using plasmid pMHyLp-Trp as a template, the 208a-Trp fragment was amplified using primers 208a-loxT-F and 208a-loxT-R.
[0193] (2) Take the four segments P from step (1) TDH3 -SNQ2-T CYC1208a-UP, 208a-DOWN, and 208a-Trp were subjected to fusion PCR. The correct bands obtained by gel running were excised and recovered to obtain the fusion gene fragment 208a-P containing the upstream and downstream homologous arms of 208a. TDH3 -SNQ2-T CYC1 ;
[0194] (3) The fusion gene fragment obtained in step (2) was transformed into competent cells of strain L7 prepared in Example 11, and cultured on SD Trp plates at 30°C for 2-3 days. Single colony PCR was performed using primers YZ-SNQ2-F and YZ-SNQ2-R. Single colonies with correct bands were selected to obtain strain L7-P. TDH3 -SNQ2-T CYC1 -Trp.
[0195] (4) Prepare competent cells from the strain obtained in step (3), transform them into the pY26-Cre plasmid, and culture them on SD Ura plates at 30℃ for 2-3 days. Take a single colony and inoculate it into YPD medium and culture it for 15-24 h. Streak the colony onto a YPD plate containing 1 mg / mL of 5-FOA and culture it at 30℃ for 2-3 days. Perform TLC verification on SD Ura, SD Trp, and YPD solid plates. Only single colonies growing on YPD medium are the correct Saccharomyces cerevisiae strain L7-P. TDH3 -SNQ2-T CYC1 -Trp, named Saccharomyces cerevisiae L7Z2.
[0196] Example 13: Recombinant strains obtained from different transport proteins
[0197] The specific implementation method is the same as in Examples 1-12, except that the SNQ2 transporter gene sequence in Example 12 is updated to PDR5 (Gene ID 854324), YOR1 (Gene ID 853198), and PDR10 (Gene ID 854506), and the artificially synthesized gene fragment P... TDH3 -PDR5-T CYC1 P TDH3 -YOR1-T CYC1 P TDH3 -PDR10-T CYC1 .
[0198] Saccharomyces cerevisiae L7Z1, L7Z3, and L7Z4 were prepared respectively.
[0199] Example 14: Lycopene yield of recombinant strain under shake-flask fermentation conditions
[0200] The specific steps are as follows:
[0201] (1) The above recombinant Saccharomyces cerevisiae strains L7Z1, L7Z2, L7Z3 and L7Z4 were inoculated into SD-Trp medium, and recombinant Saccharomyces cerevisiae strain L7 was inoculated into SD-Ura medium as a control strain. The cultures were cultured at 30℃ and 220 rpm for 16-24 h to prepare seed culture. The prepared seed culture was inoculated into a 250 mL Erlenmeyer flask containing 25 mL of fermentation medium and 2.5 mL of dodecane at an inoculation rate of 2% (v / v). The cultures were cultured at 30℃ and 220 rpm for 96 h to prepare fermentation broth.
[0202] (2) Calculate the extracellular lycopene yield:
[0203] After centrifugation, the supernatant dodecane was removed, and the mixture was filtered through a membrane into a liquid chromatography vial for high-performance liquid chromatography (HPLC) analysis. The fermentation yield of the engineered strain was calculated by converting the peak area with that of the lycopene standard. The results are shown in Table 2. Figure 1 As shown, the lycopene content in the extracellular dodecane of the L7Z2 strain overexpressing Snq2 protein reached 12.58 mg / L.
[0204] (3) Calculate the intracellular lycopene production:
[0205] The fermentation broth, after removing dodecane, was resuspended, diluted 100 times, and the OD was measured using a UV spectrophotometer. 600 The cell dry weight (DCW) is obtained by conversion using a formula.
[0206] 600 μL of the resuspended fermentation broth was taken, washed and resuspended with an equal volume of deionized water, and then placed in a disruption tube with 600 μL of ethyl acetate and an appropriate amount of 0.5 mm glass beads. Cells were disrupted using a whole-cell homogenizer. After centrifugation, ethyl acetate was taken, appropriately diluted, and filtered through a membrane into a liquid chromatography vial for high-performance liquid chromatography (HPLC) analysis. The fermentation yield of the engineered strain was calculated by converting the peak area with that of lycopene standard.
[0207] The results are shown in Table 2 and... Figure 1 As shown, the OD600 of strain L7Z2 reached 52.04, and the intracellular lycopene production was 33.08 mg / g DCW.
[0208] Table 2: Lycopene production and OD at the end of the reaction of different recombinant Saccharomyces cerevisiae. 600
[0209]
[0210] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A recombinant brewing yeast, characterized in that, The recombinant Saccharomyces cerevisiae was enhanced to express truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, NADH kinase POS5, and ABC transporter Snq2; and heterologously expressed [missing information]. Taxus x media Geraniol geraniol diphosphate synthase CrtE, Blakeslea trispora The source of phytoene dehydrogenase CrtI, Phaffia rhodozyma The mutant CrtYBM1, derived from the bifunctional lycopene cyclase / hydrolycopene synthase CrtYB, was used; the transcriptional repressor ROX1, glucan 1,3-β-glucosidase EXG1, and galactose / lactose metabolism regulator GAL80 of the ergosterol biosynthesis (ERG) gene were knocked out; and orotidine 5'-phosphate decarboxylase URA3 was added back. The recombinant brewer's yeast utilizes P GPD The promoter expresses tHMG1, utilizing P PGK1 The promoter expresses INO2, using P TEF1 The promoter expresses ERG20 and IDI1, utilizing P GAL1,10 Bidirectional promoters express CrtI and CrtE, utilizing P GAL7 The promoter expresses POS5 and heterologously expresses CrtYBM1, using P TDH3 The promoter expression Snq2 utilizes P URA3 The promoter expresses URA3; The P GPD The nucleotide sequence of the promoter is shown in SEQ ID NO. 8, wherein P PGK1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 9, P TEF1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 10, P GAL1,10 The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO. 11, wherein P GAL7 The nucleotide sequence of the promoter is shown in SEQ ID NO. 12, wherein P TDH3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 13, wherein P URA3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 14; With brewer's yeast ( Saccharomyces cerevisiae BY4741 is the originating strain; The Gene ID of tHMG1 is 42650, the Gene ID of IDI1 is 855986, the Gene ID of ERG20 is 853272, the Gene ID of INO2 is 851701, the Gene ID of POS5 is 855913, the Gene ID of Snq2 protein is 851574, the GenInfo Identifier of CrtE is 45505274, the GenInfo Identifier of CrtI is 37729024, the GenBank number of CrtYB is ALK24266.1, the Gene ID of ROX1 is 856178, the Gene ID of EXG1 is 851007, and the Gene ID of GAL80 is... The ID is 854954, and the GeneID of URA3 is 856692; the mutant CrtYBM1 is based on CrtYB, with tryptophan at position 61 mutated to arginine W61R; the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is based on tHMG1, with 530 amino acids truncated at the N-terminus.
2. A method for preparing lycopene, characterized in that, It was prepared by fermentation using the recombinant brewing yeast described in claim 1.
3. The application of enhanced expression of ABC transporter Snq2 in increasing the yield of lycopene from recombinant Saccharomyces cerevisiae, characterized in that, The Gene ID of the ABC transporter Snq2 is 851574; The recombinant brewer's yeast is brewer's yeast ( Saccharomyces cerevisiae BY4741 was the starting strain, and truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, and NADH kinase POS5 were enhancedly expressed; and heterologous expression was also performed. Taxus x media Geraniol geraniol diphosphate synthase CrtE, Blakeslea trispora The source of phytoene dehydrogenase CrtI, Phaffia rhodozyma The mutant CrtYBM1, derived from the bifunctional lycopene cyclase / hydrolycopene synthase CrtYB, was used; the transcriptional repressor ROX1, glucan 1,3-β-glucosidase EXG1, and galactose / lactose metabolism regulator GAL80 of the ergosterol biosynthesis (ERG) gene were knocked out; and orotidine 5'-phosphate decarboxylase URA3 was added back. The recombinant brewer's yeast utilizes P GPD The promoter expresses tHMG1, utilizing P PGK1 The promoter expresses INO2, using P TEF1 The promoter expresses ERG20 and IDI1, utilizing P GAL1,10 Bidirectional promoters express CrtI and CrtE, utilizing P GAL7 The promoter expresses POS5 and heterologously expresses CrtYBM1, using P URA3 The promoter expresses URA3; The P GPD The nucleotide sequence of the promoter is shown in SEQ ID NO. 8, wherein P PGK1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 9, P TEF1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 10, P GAL1,10 The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO. 11, wherein P GAL7 The nucleotide sequence of the promoter is shown in SEQ ID NO. 12, wherein P TDH3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 13, wherein P URA3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 14; The Gene ID of tHMG1 is 42650, the Gene ID of IDI1 is 855986, the Gene ID of ERG20 is 853272, the Gene ID of INO2 is 851701, the Gene ID of POS5 is 855913, the GenInfo Identifier of CrtE is 45505274, the GenInfo Identifier of CrtI is 37729024, the GenBank number of CrtYB is ALK24266.1, the Gene ID of ROX1 is 856178, the Gene ID of EXG1 is 851007, the Gene ID of GAL80 is 854954, and the Gene ID of URA3 is... ID is 856692; the mutant CrtYBM1 is based on CrtYB, with tryptophan at position 61 mutated to arginine W61R; the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is based on tHMG1, with 530 amino acids truncated at the N-terminus.
4. A method for increasing the extracellular secretion of lycopene by Saccharomyces cerevisiae, characterized in that, The method involves: enhancing the expression of truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1, isopentenyl pyrophosphate isomerase IDI1, farnesyl pyrophosphate synthase ERG20, endoplasmic reticulum size regulator INO2, NADH kinase POS5, and ABC transporter Snq2 in *Saccharomyces cerevisiae*; and heterologously expressing geranyl-geranyl diphosphate synthase CrtE, phytoene dehydrogenase CrtI, and bifunctional lycopene cyclase / phytoene. The mutant CrtYBM1 is a synthase synthase CrtYB; the ROX1, EXG1, and GAL80 genes in Saccharomyces cerevisiae are knocked out; and the orotidine 5'-phosphate decarboxylase URA3 gene is added back; the mutant CrtYBM1 is based on CrtYB, with tryptophan at position 61 mutated to arginine W61R; the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is based on tHMG1 with 530 amino acids truncated from the N-terminus. Using P GPD The promoter expresses tHMG1, utilizing P PGK1 The promoter expresses INO2, using P TEF1 The promoter expresses ERG20 and IDI1, utilizing P GAL1,10 Bidirectional promoters express CrtI and CrtE, utilizing P GAL7 The promoter expresses POS5 and heterologously expresses CrtYBM1, using P TDH3 The promoter expression Snq2 utilizes P URA3 The promoter expresses URA3; The Gene ID of tHMG1 is 42650, the Gene ID of IDI1 is 855986, the Gene ID of ERG20 is 853272, the Gene ID of INO2 is 851701, the Gene ID of POS5 is 855913, the Gene ID of Snq2 protein is 851574, the GenInfo Identifier of CrtE is 45505274, the GenInfo Identifier of CrtI is 37729024, the GenBank number of CrtYB is ALK24266.1, the Gene ID of ROX1 is 856178, the Gene ID of EXG1 is 851007, and the Gene ID of GAL80 is... The ID is 854954, and the GeneID of URA3 is 856692; the mutant CrtYBM1 is based on CrtYB, with the tryptophan at position 61 mutated to arginine W61R; the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 is based on tHMG1, with 530 amino acids truncated at the N-terminus. With brewer's yeast ( Saccharomyces cerevisiae BY4741 is the originating strain; The P GPD The nucleotide sequence of the promoter is shown in SEQ ID NO. 8, wherein P PGK1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 9, P TEF1 The nucleotide sequence of the promoter is shown in SEQ ID NO. 10, P GAL1,10 The nucleotide sequence of the bidirectional promoter is shown in SEQ ID NO. 11, wherein P GAL7 The nucleotide sequence of the promoter is shown in SEQ ID NO. 12, wherein P TDH3 The nucleotide sequence of the promoter is shown in SEQ ID NO. 13, wherein P URA3 The nucleotide sequence of the promoter is shown in SEQ ID NO.
14.
5. The use of the recombinant brewing yeast of claim 1, or the method of claim 2 or 4, in the preparation of products containing lycopene.
Citation Information
Patent Citations
Construction and application of saccharomyces cerevisiae strain for extracellular transport of vitamin D3 precursor squalene
CN113684141A