An efficient genetic transformation method for Lagerstroemia indica

By using Agrobacterium-mediated genetic transformation method on crape myrtle, using leaves to induce callus regeneration, the problem of slow progress in the construction of the genetic transformation system of crape myrtle was solved, and efficient production of transgenic plants and gene function verification was achieved.

CN115976101BActive Publication Date: 2025-06-27INST OF BOTANY JIANGSU PROVINCE & CHINESE ACADEMY OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211431154.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-16
Publication Date
2025-06-27
Estimated Expiration
2042-11-16

AI Technical Summary

Technical Problem

Crabbit meadow has problems such as long childhood and easy browning of receptor materials, which leads to slow progress in the construction of its efficient and rapid genetic transformation system, which limits the improvement of ornamental traits.

Method used

Leaves were used as explants for Agrobacterium-mediated genetic transformation, induce callus and perform plant regeneration to obtain transgenic positive plants. This method does not require ultrasonic or vacuum hydraulic auxiliary treatment, and it is simple to operate, short period and high positive rate.

Benefits of technology

Through this method, the genetic transformation cycle of crape myrtle is shortened, the positive rate of transgenic plants is improved, and the identification of positive plants is simplified, providing an efficient technical approach for molecular breeding and genetic function verification of crape myrtle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976101B_ABST
    Figure CN115976101B_ABST
Patent Text Reader

Abstract

The present invention discloses an efficient genetic transformation method for Lagerstroemia indica. In this method, the young leaves of aseptic tissue culture seedlings of Lagerstroemia indica are used as explants for Agrobacterium-mediated infection. After the infection, the bacterial liquid on the surface of the explants is blotted dry. After co-cultivation, the explants are transferred to a callus induction medium, and after 18 - 20 days, they are transferred to a regeneration medium for cultivation for 30 - 40 days. Transgenic positive plants are obtained based on the chlorophyll fluorescence screening technology, and the positive rate is as high as 86.67% - 90.00%. The invention has a short cycle, simple operation and high genetic transformation efficiency, provides important technical support for molecular breeding, transgenic production and gene function verification of Lagerstroemia indica, and accelerates the breeding process of new varieties of Lagerstroemia indica.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to an efficient Lagerstroemia indica genetic transformation method. Background Art

[0002] Crape Myrtle Lagerstroemia indica ) is also known as the itch tree, is a species of the genus Lagerstroemia in the family Lythraceae ( Lagerstroemia ) is a deciduous shrub or small tree native to China, with a cultivation history of more than 1,600 years. It has bright flowers and beautiful tree shape. It is a famous summer flowering small tree in my country and even in the world. It combines flower viewing, leaf viewing and stem viewing, and has high ornamental value. It has been widely used in gardens in public green spaces, residential areas, roads and other places.

[0003] Crape myrtle has a strong ability to adapt to the environment, a long lifespan, good drought tolerance, and can absorb harmful gases in the air, block dust and reduce noise, and at the same time play a role in purifying the environment and beautifying the environment. Therefore, it can be widely used in urban greening. However, with the improvement of people's quality of life, the requirements for the varieties of horticultural ornamental plants are increasing. The improvement of new varieties and the clarification of the internal mechanism of mutants are currently a major problem. The construction of a genetic transformation system at the gene level that can be used to study the ornamental traits of woody plants is the key prerequisite for the cultivation of new varieties of crape myrtle, and it is also the main problem that urgently needs to be solved.

[0004] Like other woody plants, crape myrtle has problems such as a long juvenile period and easy browning of the recipient material, which leads to relatively slow progress in the construction of an efficient and rapid genetic transformation system, and the improvement of ornamental traits is also limited. Using modern molecular biology and genetic engineering technology, the target gene is integrated into the crape myrtle genome to obtain the corresponding traits. It is fast, efficient, and purposeful, which greatly speeds up the breeding speed and improves the efficiency of breeding. It is an effective technical means to solve the problem of breeding new crape myrtle varieties. Therefore, establishing an efficient and stable crape myrtle genetic system is crucial for the functional research of genes and molecular design breeding. Summary of the invention

[0005] The present invention provides an efficient genetic transformation method for crape myrtle, which uses leaves as explants for Agrobacterium-mediated genetic transformation, induces callus tissue to occur, and then regenerates plants to obtain transgenic positive plants, providing a new technical approach for the directional breeding of new varieties of crape myrtle, so as to achieve the purpose of accelerating the molecular breeding process of crape myrtle and producing transgenic plants.

[0006] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows:

[0007] (1) Preparation of Agrobacterium carrying target gene:

[0008] The plant expression vector containing the target gene was introduced into the competent cells of Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method. After picking monoclonal colonies and determining positive monoclonal colonies by PCR detection of the target gene, the bacteria were cultured overnight, the cells were collected and resuspended with the resuspension solution.

[0009] (2) Infection of Lagerstroemia indica leaves: Place fresh leaves in the resuspended Agrobacterium tumefaciens solution, completely immerse the leaves, incubate at 100 rpm for 15 minutes. After blotting the Agrobacterium tumefaciens solution on the leaf surface with absorbent paper, transfer the leaves to the co-culture medium and incubate in the dark at 25℃ - 28℃ for 48 hours.

[0010] (3) Callus induction and regeneration of Lagerstroemia indica leaves: The co-cultured leaves were transferred to the callus induction medium for callus induction, and then transferred to the regeneration medium for regeneration after 18 - 20 days. Regenerated plants were obtained after 30 - 40 days. When the height of the regenerated plants reached 1.5 - 3.0 cm, they were cut and placed in the rooting medium.

[0011] (4) Detection of positive plants: For the leaves of the regenerated plant seedlings in step (3), DNA was extracted and PCR detection of the reporter gene was performed. Fluorescence detection was carried out on the leaves of the regenerated plants.

[0012] (5) Hardening off and transplanting of positive plants: Select transgenic positive seedlings with strong roots, loosen the caps of the tissue culture bottles. After 5 - 7 days, wash the medium on the roots, cut off the old leaves, leaving 4 - 6 leaves at the top, and transplant them into the growth chamber and then move them out after one week.

[0013] In steps (2 - 4), the pH values of all media were adjusted to 5.8 - 6.0.

[0014] The method for preparing the Agrobacterium tumefaciens solution described in step (1) is as follows:

[0015] a. The plant expression vector containing the target gene was transformed into the competent cells of Agrobacterium tumefaciens EHA105 by the freeze-thaw method. The expression vector containing the target gene was pBI121.

[0016] b. In the sterile operating table, use an inoculation loop to pick the transformed Agrobacterium tumefaciens EHA105 and streak it onto the LB solid medium containing 100 mg / L kanamycin and 50 mg / L rifampicin, and incubate it at 28℃ in an inverted position for 48 - 72 h.

[0017] c. Pick monoclonal colonies into 1 mL of LB liquid medium (containing 100 mg / L kanamycin and 50 mg / L rifampicin), and culture them at 28℃ with shaking for 24 h until the liquid becomes turbid. Transfer the turbid Agrobacterium tumefaciens to 100 mL of LB liquid medium and culture it overnight (containing 100 mg / L kanamycin, 50 mg / L rifampicin, and 200 μmol / L acetosyringone).

[0018] d. When the bacterial liquid concentration reaches OD 600 of 0.8 - 1.0, after centrifugation, pour off the supernatant and collect the bacterial cells;

[0019] e. Add the resuspension solution until the OD 600 is 0.6 - 0.8, and place it at room temperature in the dark for 3 h to obtain the infection solution;

[0020] The one described in step (2) is the young leaves of Lagerstroemia indica aseptic tissue culture seedlings.

[0021] The resuspension solution in step (2) is H2O + 10 mmol / L 2-(N-morpholino)ethanesulfonic acid + 10 mmol / L MgCl2 + 200 μmol / L acetosyringone, pH = 6.0. After resuspension, the Agrobacterium bacterial liquid concentration is OD600 = 0.8 - 1.0.

[0022] The formula of the co-culture medium in step (2) is WPM + 6-BA (6-Benzylaminopurine) 1.0 mg / L + NAA (1-Naphthylacetic acid) 0.1 mg / L + sucrose 30 g / L + gel 3 g / L.

[0023] The composition of the callus induction medium in step (3) is WPM + 6-BA 0.8 mg / L + NAA 0.5 mg / L + Tim (Timentin) 200 mg / L + sucrose 30 g / L + gel 3 g / L.

[0024] The composition of the callus regeneration medium in step (4) is WPM + 6-BA 1.0 mg / L + NAA 0.1 mg / L + Tim (Timentin) 200 mg / L + sucrose 30 g / L + gel 3 g / L.

[0025] The present invention at least provides the following beneficial effects:

[0026] 1. The present invention discloses an efficient genetic transformation method for Lagerstroemia indica, which shortens the period for the regenerated new plants to be obtained from the callus of the transgenic leaves.

[0027] 2. The present invention introduces the target gene into the plant genome by the method of soaking the leaf tissue with Agrobacterium, without the need for auxiliary treatments such as ultrasonic waves and vacuum hydraulic pressure, and has the advantages of simple operation, short cycle and high positive rate.

[0028] 3. The identification of positive plants by traditional PCR methods is somewhat simplified by the chlorophyll fluorescence screening combined with PCR technology for the transgenic plants, effectively shortening the genetic transformation cycle of Lagerstroemia indica.

[0029] 4. This invention uses woody plants (Lagerstroemia indica) as materials. Compared with herbaceous plants, it is difficult to establish a regeneration system for woody plants. In this invention, the leaf tissue of Lagerstroemia indica is used as the receptor for genetic transformation, providing important technical support for transgenic production and gene function verification. It can be used for the molecular genetic improvement of Lagerstroemia indica, verifying gene functions and innovating germplasm resources, and also providing a reference basis for the molecular breeding of other forest trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Callus induction and regeneration system. A, B: Inserting leaves into the callus induction medium; C, D: Induction of callus; E, F: Regeneration of callus; G, H: Rooting of regenerated plants; I, J: Transplanting of regenerated plants.

[0031] Figure 2 Agrobacterium infection, callus induction and regeneration. A: Preparation of Agrobacterium liquid; B: Callus induction of leaves; C: Regeneration of callus; D: Regenerated plants.

[0032] Figure 3 Fluorescence and PCR positive rate detection. A: Fluorescence detection, B: PCR detection. M, Marker; P, plasmid positive control; 1 - 7 randomly selected regenerated plants.

[0033] Figure 4 Acclimatization and transplantation. A: Hardening off; B, C: Transplanting. DETAILED DESCRIPTION OF THE INVENTION

[0034] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.

[0035] The reagents used in the implementation cases mainly include molecular biology experimental reagents and reagent kits, etc., all of which can be obtained through commercial channels. The methods provided in the embodiments of the present invention are all conventional methods if not otherwise specified.

[0036] Embodiment 1

[0037] (1) Preparation of Agrobacterium carrying the target gene:

[0038] The plant expression vector containing the target gene is introduced into the Agrobacterium competent cells by the freeze - thaw method and prepared into a resuspension. The preparation method is as follows:

[0039] a. The plant expression vector containing the target gene was transformed into the competent cells of Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method. The expression vector containing the target gene was pBI121.

[0040] b. In a sterile operating bench, the transformed Agrobacterium EHA105 was picked up with an inoculation loop and streaked onto an LB solid medium containing 100 mg / L kanamycin and 50 mg / L rifampicin, and cultured upside down at 28 °C for 48 - 72 h.

[0041] c. A monoclonal colony was picked and transferred into 1 mL of LB liquid medium (containing 100 mg / L kanamycin and 50 mg / L rifampicin), and cultured with shaking at 28 °C for 24 h until the liquid became turbid. The turbid Agrobacterium was transferred into 100 mL of LB liquid medium and cultured overnight (containing 100 mg / L kanamycin, 50 mg / L rifampicin, and 200 μmol / L acetosyringone).

[0042] d. When the bacterial liquid concentration reached OD 600 of 0.8 - 1.0, after centrifugation, the supernatant was discarded and the bacterial cells were collected.

[0043] e. Resuspension solution was added until OD 600 reached 0.8, and it was placed at room temperature in the dark for 3 h.

[0044] (2) Infection of Lagerstroemia indica leaves: The fresh leaf tissue was inoculated into the resuspended Agrobacterium bacterial liquid, and the bacterial liquid completely submerged the leaf tissue. It was shaken at 100 rpm for 15 min. After the bacterial liquid on the leaf surface was blotted dry with absorbent paper, the petiole part was vertically inserted into the co-culture medium and cultured in the dark at 25 - 28 °C for 48 h.

[0045] (3) Callus induction and regeneration of Lagerstroemia indica leaves: The leaves after transgenic co-culture were transferred to the callus induction medium for callus induction, and after 18 days, they were transferred to the regeneration medium for regeneration. The surviving callus and regenerated plants could be used for the next transformation detection. After the regenerated seedlings reached a height of 3 cm, the regenerated seedlings were cut, and their stems were inserted into the rooting medium for rooting culture.

[0046] (4) Detection of positive plants: The regenerated plant seedlings in step (3) were detected for the reporter gene, and at the same time, the leaves of the regenerated plants were subjected to fluorescence detection.

[0047] The specific primer sequences of the eGFP gene are as follows:

[0048] eGFP detect-F: AGTGCTTCAGCCGCTACCCC

[0049] eGFP detect-R: CCATGCCGAGAGTGATCCCG

[0050] The results showed that a specific fragment with a length of approximately 490 bp was obtained by PCR from the resistant regenerated plant samples. This fragment was excised from the gel, recovered, and sequenced. The sequencing results were aligned with the eGFP sequence, and the sequence identity was 100%. A total of 120 regenerated plants were tested in batches, and 108 were positive plants, with a positive rate of 90.00%.

[0051] (5) Hardening and transplanting of positive plants: Select transgenic positive seedlings with strong roots, loosen the caps of the tissue culture bottles. After 7 days, wash the culture medium on the roots, cut off the old leaves near the roots, leaving 4 top leaves, and transplant them into the growth chamber, and then move them out after one week.

[0052] Embodiment 2

[0053] (1) Preparation of Agrobacterium carrying the target gene:

[0054] The plant expression vector containing the target gene was introduced into Agrobacterium competent cells by the freeze-thaw method and prepared into an infection solution. The preparation method of the infection solution is as follows:

[0055] a. The plant expression vector containing the target gene was transformed into Agrobacterium strain EHA105 competent cells by the freeze-thaw method. The expression vector containing the target gene was pBI121;

[0056] b. In a sterile operation bench, use an inoculation loop to pick the transformed Agrobacterium EHA105 and streak it onto an LB solid medium containing 100 mg / L kanamycin and 50 mg / L rifampicin, and culture it inverted at 28 °C for 48 - 72 h;

[0057] c. Pick a single colony and transfer it to 1 mL of LB liquid medium (containing 100 mg / L kanamycin and 50 mg / L rifampicin), and culture it with shaking at 28 °C for 24 h until the liquid becomes turbid. Transfer the turbid Agrobacterium to 100 mL of LB liquid medium and culture it overnight (containing 100 mg / L kanamycin, 50 mg / L rifampicin, and 200 μmol / L acetosyringone);

[0058] d. When the bacterial liquid concentration reaches OD 600 of 1.0, centrifuge and pour off the supernatant to collect the bacterial cells; add the resuspension solution until the OD 600 is 1.0, and place it at room temperature in the dark for 3 h;

[0059] (2) Infection of Lagerstroemia indica leaves: Immerse the fresh leaf tissues into the resuspended Agrobacterium bacterial liquid, completely submerge the leaf tissues with the bacterial liquid, shake at 100 rpm for 15 min. After blotting the bacterial liquid on the surface of the leaves with absorbent paper, vertically insert the petiole part into the co-culture medium, and culture it in the dark at 25 - 28 °C for 48 h;

[0060] (3) Callus induction and regeneration of Lagerstroemia indica leaves: Transfer the leaves after transgenic co-culture to the callus induction medium for callus induction. After 20 days, transfer them to the regeneration medium for regeneration. The surviving callus and regenerated plants can be used for the next transformation detection. After the regenerated seedlings reach a height of 1.5 cm, cut the regenerated seedlings and insert their stems into the rooting medium for rooting culture;

[0061] (4) Detection of positive plants: Detect the expression of the reporter gene in the regenerated plant seedlings in step (3). At the same time, take the leaves of the regenerated plants for preliminary fluorescence detection, extract DNA, and perform PCR detection of the target gene again;

[0062] The specific primer sequences of the eGFP gene are as follows:

[0063] eGFP detect-F: AGTGCTTCAGCCGCTACCCC

[0064] eGFP detect-R: CCATGCCGAGAGTGATCCCG

[0065] The results showed that a specific fragment with a length of approximately 490 bp was obtained by PCR of the resistant regenerated plant samples. The fragment was gel-cut, recovered, and sequenced. The sequencing result was compared with the eGFP sequence, and the sequence identity was 100%. A total of 120 regenerated plants were detected in batches. There were 103 positive plants, and the positive rate reached 86.67%.

[0066] (5) Hardening and transplantation of transgenic plants: Select transgenic positive seedlings with strong roots, loosen the caps of the tissue culture bottles. After 5 days, wash the medium on the roots, cut off the old leaves near the roots, leave 6 leaves at the top, and transplant them into the growth room and move them out after one week.

Claims

1. An efficient genetic transformation method for Lagerstroemia indica, characterized in that, It includes the following steps: (1) Preparation of Agrobacterium carrying the target gene: The plant expression vector containing the target gene is introduced into the competent cells of Agrobacterium tumefaciens strain EHA105 by the freeze-thaw method. After picking monoclonal colonies and determining the positive monoclonal colonies by PCR detection of the target gene, the bacteria are cultured overnight with shaking, the cells are collected and resuspended with the resuspension solution; the resuspension solution is H2O + 10 mmol / L 2-(N-morpholino)ethanesulfonic acid + 10 mmol / L MgCl2 + 200 μmol / L acetosyringone, pH = 6.0, and the concentration of the Agrobacterium resuspension solution is OD600 = 0.8 - 1.0; (2) Infection of Lagerstroemia indica leaves: The fresh leaves are placed in the resuspended Agrobacterium solution, the leaves are completely immersed, shaken at 100 rpm for 15 minutes, and after blotting the Agrobacterium solution on the surface of the leaves with absorbent paper, the leaves are transferred to the co-culture medium and cultured in the dark at 25°C - 28°C for 48 hours; the co-culture medium is WPM + 6-BA 1.0 mg / L + NAA 0.1 mg / L + sucrose 30 g / L + gel 3 g / L; (3) Callus induction and regeneration of Lagerstroemia indica leaves: The co-cultured leaves are transferred to the callus induction medium for callus induction, transferred to the regeneration medium for regeneration after 18 - 20 days, and regenerated plants are obtained after 30 - 40 days. After the height of the regenerated plants reaches 1.5 - 3.0 cm, they are cut and placed in the rooting medium; the callus induction medium is WPM + 6-BA 0.8 mg / L + NAA 0.5 mg / L + Timentin 200 mg / L + sucrose 30 g / L + gel 3 g / L; the regeneration medium is WPM + 6-BA 1.0 mg / L + NAA 0.1 mg / L + Timentin 200 mg / L + sucrose 30 g / L + gel 3 g / L; (4) Detection of positive plants: For the leaves of the regenerated plant seedlings in step (3), DNA is extracted and PCR detection of the reporter gene is carried out, and fluorescence detection is carried out on the leaves of the regenerated plants; (5) Hardening off and transplanting of positive plants: Select transgenic positive seedlings with strong roots, loosen the caps of the tissue culture bottles, after 5 - 7 days, wash the medium on the roots, cut off the old leaves, leave 4 - 6 leaves at the top, transplant, transfer to the growth chamber, and move out after one week.

2. An efficient Lagerstroemia indica genetic transformation method according to claim 1, characterized in that: The pH values of all media are adjusted to 5.8 - 6.0.

Citation Information

Patent Citations

  • Method for establishing tissue culture regeneration system of Lagerstroemia fauriei Koehne

    CN109757370A