Chimeric primer-mediated nucleic acid detection method and detection kit
By combining reverse transcriptase and chain-displacing DNA polymerase through a chimeric primer-mediated method, nucleic acid amplification is achieved at a single temperature, which solves the problem of traditional PCR technology's dependence on temperature control and high cost, and realizes simple and efficient nucleic acid amplification and detection.
Patent Information
- Application Number
- CN202211031730.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-26
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2042-08-26
AI Technical Summary
Traditional PCR technology requires expensive amplification instruments and complex temperature control, and the amplification time is long, which is not suitable for field or simple laboratory environments. In addition, the existing constant temperature amplification technology is costly or the amplification system is complex.
A chimeric primer-mediated method is used, combining reverse transcriptase, ribonuclease and strand-displacing DNA polymerase to achieve nucleic acid amplification at a single temperature, and exponential amplification is carried out through partial degradation of the RNA of the chimeric primer and strand displacement reaction.
Nucleic acid amplification can be achieved without high-temperature denaturation, which simplifies operations and reduces costs. It is suitable for various environments and can amplify DNA and RNA, and the products can be directly detected.
Smart Images

Figure CN115976170B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and specifically provides a method and a detection kit for nucleic acid mediated by a chimeric primer. Background Art
[0002] The polymerase chain reaction (PCR) was founded by Kary Mullis of Cetus Corporation in the United States in 1983 and has a history of more than 30 years. Due to its advantages in sensitivity and specificity, PCR technology has been rapidly applied to various aspects of scientific research and clinical research. This PCR technology, which is similar to the natural replication process of DNA, relies on oligonucleotide primers that are complementary to the two ends of the target sequence for specificity and can amplify the number of target DNA fragments by more than one million times. Its principle is to use the parent chain DNA as a template and specific primers as the extension starting point under the catalysis of DNA polymerase, through denaturation, annealing, extension and other steps, to replicate the daughter chain DNA complementary to the parent chain template DNA in vitro. The PCR process is specifically divided into three steps: (1) Denaturation: Use high temperature to denature and separate the double-stranded DNA. The hydrogen bonds between the double-stranded DNA are broken at high temperatures (93-98°C). (2) Annealing: After the double-stranded DNA separates, the temperature is lowered to allow the primer to bind to the single-stranded DNA. (3) Extension: DNA polymerase begins to synthesize a complementary strand along the DNA strand from the primer bound during the cooling process. Once the extension is complete, one cycle is complete, and the number of DNA fragments doubles. Repeating these three steps 25-35 times will exponentially increase the number of DNA fragments.
[0003] After decades of development, PCR technology has evolved from the original ordinary PCR to include technologies such as touchdown PCR, hot start PCR, long fragment amplification PCR, nested PCR, multiplex PCR, and fluorescent quantitative PCR. Although these technologies have been used in microbial research, disease diagnosis, drug screening, and other fields, this technology based on ordinary PCR has some limitations in its application: (1) PCR technology requires expensive amplification instruments. At the same time, the instrument must have a sophisticated temperature control program and a heating template to achieve denaturation of the DNA template chain at high temperature and primer annealing and template extension at a lower temperature. In this way, after repeating the temperature change for dozens of cycles, the template amount can be exponentially amplified. Since each cycle time is short, the instrument must be able to quickly and accurately raise and lower the temperature, which places high demands on the instrument's heating module. (2) The DNA polymerase used in PCR amplification must be able to withstand high temperatures. Otherwise, new enzymes must be added in each cycle to achieve the next cycle of amplification, which is very easy to cause contamination and increases costs. (3) In the PCR cycle, the annealing time of the primers in each cycle is very short (a few seconds to more than ten seconds), which requires the primers to quickly find the homologous matching segments on the template to achieve extension. This requires that the PCR system must have excess PCR primers. Excess primers will mismatch with the template, incorrectly trigger amplification, primer dimers, etc., thereby inhibiting PCR amplification, especially when the template amount is low, which will aggravate this situation. (4) In practical applications, ordinary PCR technology or technologies based on its extension have a long amplification reaction time, usually 1.5 hours or more, which is not conducive to the application of rapid amplification.
[0004] Due to the limitations of traditional PCR technology, a variety of in vitro isothermal nucleic acid amplification technologies have been developed, such as CPA (cross-primer nucleic acid amplification), LAMP (loop-mediated isothermal amplification), NASBA (nucleic acid sequence-dependent amplification), SPIA (single primer isothermal nucleic acid amplification), and RPA (recombinase polymerase isothermal nucleic acid amplification). These technologies can achieve efficient nucleic acid amplification at a constant temperature (37°C to 65°C), eliminating the need for a PCR instrument with precise temperature control. However, technologies like CPA and LAMP require higher temperatures and temperature control equipment, which is not conducive to operation outside of laboratories, such as in the field, customs, and border control. Furthermore, technologies such as NABSA, RPA, and SPIA have complex amplification systems, require a large number of enzyme types, and are relatively expensive. These factors have limited the application of isothermal amplification technology. Summary of the Invention
[0005] Based on this, the purpose of the embodiments of the present application includes providing a chimeric primer-mediated nucleic acid detection method, which combines a chimeric primer with a reverse transcriptase, a ribonuclease, and a chain displacement DNA polymerase, etc. The reaction system is simple and nucleic acid amplification can be achieved at a single temperature.
[0006] The purpose of the embodiments of the present application can be achieved by the following technical solutions:
[0007] In a first aspect of the present application, a chimeric primer-mediated nucleic acid detection method is provided, the detection method comprising the following steps:
[0008] Providing a nucleic acid fragment to be tested;
[0009] Designing a chimeric primer pair for the target fragment in the nucleic acid fragment; in the chimeric primer pair, one chimeric primer specifically binds to the target fragment, and the other chimeric primer specifically binds to the complementary DNA fragment of the target fragment, each chimeric primer comprises an RNA fragment at the 5' end and a DNA fragment at the 3' end, and the length of the chimeric primer is 30 nt to 40 nt;
[0010] The nucleic acid fragment, the chimeric primer pair, reverse transcriptase, ribonuclease, strand displacement DNA polymerase, single-stranded DNA binding protein and amplification reaction buffer are mixed, amplified at a constant temperature, and detected.
[0011] In the present application, reverse transcriptase is an RNA-dependent DNA polymerase having 5'-3' RNA-guided DNA polymerase activity and DNA-guided polymerase activity, but no RNase H activity; strand-displacing DNA polymerase has strong strand-displacement activity and 5'→3' DNA polymerase activity, but no 5'→3' exonuclease activity and 3'→5' exonuclease activity.
[0012] In some embodiments of the present application, in the chimeric primer, the length of the RNA fragment at the 5' end is 10 nt-20 nt, and the length of the DNA fragment at the 3' end is 15 nt-20 nt.
[0013] In some embodiments of the present application, the reverse transcriptase is one or more of AMV reverse transcriptase and M-MLV reverse transcriptase.
[0014] In some embodiments of the present application, the ribonuclease is one or more of the nucleases ribonuclease A, ribonuclease T1, and ribonuclease H.
[0015] In some embodiments of the present application, the strand displacement DNA polymerase is Bst DNA polymerase I, One or more of DNA polymerase and Bsu DNA polymerase I.
[0016] In some embodiments of the present application, the amplification reaction buffer comprises KCl 10mM-100mM, MgCl2 2mM-20mM, dNTPs 0.1mM-1mM, dithiothreitol 1mM-10mM and BSA 50ng / μL-200ng / μL, and Tris-HCl buffer with a pH of 8.0-8.5, 10mM-200mM.
[0017] In some embodiments of the present application, the initial reaction system corresponding to the isothermal amplification contains 0.1 μM-0.5 μM of the chimeric primer, 0.1 U / μL-10 U / μL of the reverse transcriptase, 0.02 U / μL-2 U / μL of the ribonuclease, 30 ng / μL-300 ng / μL of the strand-displacing DNA polymerase, and 100 ng / μL-1000 ng / μL of the single-stranded DNA binding protein.
[0018] In some embodiments of the present application, the conditions for isothermal amplification include: a temperature of 25° C.-45° C., and a time of 30 min-120 min.
[0019] In some embodiments of the present application, the nucleic acid fragment to be detected is an RNA fragment.
[0020] In some embodiments of the present application, the nucleic acid fragment to be detected is a DNA fragment, and the detection method further includes first placing the DNA fragment under 55°C-95°C conditions for 2min-5min, and then mixing it with the chimeric primer pair, reverse transcriptase, ribonuclease, chain displacement DNA polymerase, single-stranded DNA binding protein and amplification reaction buffer for constant temperature amplification and detection.
[0021] In the second aspect of the present application, the present invention provides a chimeric primer-mediated nucleic acid detection kit, which includes the chimeric primer pair defined in the first aspect, and optionally, also includes reverse transcription, ribonuclease, strand displacement DNA polymerase, single-stranded DNA binding protein and amplification reaction buffer defined in the first aspect.
[0022] Compared with traditional technologies, this application has the following beneficial effects:
[0023] The detection method provided in this application and the detection mechanism refer to Figure 1 The main method is to introduce the chimeric primer into the constant temperature amplification system, and use ribonuclease to degrade the RNA part of the hybrid DNA double strand formed by amplification to highlight the RNA part binding site in the chimeric primer, and then rely on the protruding gap produced by ribonuclease degradation of RNA to achieve exponential amplification of the target gene under the action of the strong chain displacement activity of chain displacement DNA polymerase.
[0024] Traditional PCR technology requires high-temperature denaturation, medium-temperature annealing, and extension, and requires the use of expensive PCR amplification instruments. However, this application can achieve nucleic acid amplification at a single temperature without high-temperature denaturation of nucleic acids, and does not require expensive PCR amplification instruments, making it simple to operate and low-cost.
[0025] Compared to the helicase-dependent constant-temperature amplification technology that can only amplify DNA, the nucleic acid detection method provided by this application can achieve both RNA amplification and DNA amplification. At the same time, during the amplification process, unlike the traditional recombinase helicase constant-temperature amplification technology that requires a recombinase or helicase to open the double-stranded DNA before amplification, this application does not require the participation of a recombinase or helicase, does not rely on ATP to provide energy, and can achieve constant-temperature amplification of nucleic acids. In the product detection process, there is no need to purify the product in advance. The amplified product of this application can be directly detected by gel electrophoresis. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present application. Those skilled in the art can also derive other drawings based on these drawings without inventive effort.
[0027] Figure 1 This is a schematic diagram of the principle of nucleic acid isothermal amplification technology mediated by chimeric primers;
[0028] Figure 2 This is the result of novel coronavirus RNA amplification in Example 1;
[0029] Figure 3 This is the result of amplification of the SARS-CoV-2 N gene plasmid DNA in Example 2. DETAILED DESCRIPTION
[0030] Below in conjunction with accompanying drawing, embodiment and example, the application is described in further detail.It should be understood that these embodiment and example are only used to illustrate the application and are not used to limit the scope of the application, and the purpose of providing these embodiment and example is to make the understanding of the disclosure of the application more thorough and comprehensive.It should also be understood that the application can be implemented in many different forms and is not limited to the embodiment and example described herein. Those skilled in the art can make various changes or modifications without violating the connotation of the application, and the equivalent form obtained also falls within the protection scope of the application.In addition, in the description below, a large amount of specific details are given in order to provide a more complete understanding of the application.It should be understood that the application can be implemented without one or more of these details.
[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing embodiments and examples only and are not intended to limit this application.
[0032] the term
[0033] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:
[0034] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").
[0035] In this application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.
[0036] As used herein, "combination thereof", "any combination thereof", "any combination thereof" and the like include all suitable combinations of any two or more of the listed items.
[0037] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc. shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.
[0038] Herein, "preferred", "better", "more preferred" and "suitable" are merely used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of this application.
[0039] In this application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be understood as limiting the scope of protection of this application.
[0040] In this application, the terms "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If a technical solution contains multiple "optional" clauses, each "optional" clause is independent unless otherwise specified and there are no contradictions or constraints.
[0041] In this application, the terms "first," "second," "third," "fourth," etc. in "the first aspect," "the second aspect," "the third aspect," "the fourth aspect," etc. are used for descriptive purposes only and should not be understood as indicating or implying relative importance or quantity, nor should they be understood as implicitly indicating the importance or quantity of the indicated technical features. Furthermore, "first," "second," "third," "fourth," etc. serve only as non-exhaustive enumeration and description, and should be understood not to constitute a closed-ended limitation on quantity.
[0042] In this application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.
[0043] In this application, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval and includes the two numerical endpoints of the numerical range (i.e., the minimum and maximum values), as well as each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval refers only to integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.
[0044] Unless otherwise specified, the temperature parameters in this application allow for both constant temperature treatment and temperature fluctuations within a certain temperature range. It should be understood that the constant temperature treatment allows for temperature fluctuations within the accuracy range of instrument control. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are permitted.
[0045] In this application, % (w / w) and wt% both refer to weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.
[0046] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the application purpose and / or technical solution of this application, the cited documents involved in this application are cited in their entirety and for all purposes. When cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When cited documents are involved in this application, the examples and preferred embodiments of the cited relevant technical features may also be incorporated into this application as references, but are limited to the ability to implement this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be adaptively amended according to the description in this application.
[0047] The first aspect of the present application
[0048] The present invention provides a method for detecting nucleic acids mediated by chimeric primers, comprising the following steps:
[0049] Providing a nucleic acid fragment to be tested;
[0050] Designing a chimeric primer pair for the target fragment in the nucleic acid fragment; in the chimeric primer pair, one chimeric primer specifically binds to the target fragment, and the other chimeric primer specifically binds to the complementary DNA fragment of the target fragment, each chimeric primer comprises an RNA fragment at the 5' end and a DNA fragment at the 3' end, and the length of the chimeric primer is 30 nt to 40 nt;
[0051] The nucleic acid fragment, the chimeric primer pair, reverse transcriptase, ribonuclease, strand displacement DNA polymerase, single-stranded DNA binding protein and amplification reaction buffer are mixed, amplified at a constant temperature, and detected.
[0052] The detection mechanism of this application can be seen Figure 1: Under the action of reverse transcriptase, chimeric primer 1 anneals with the template RNA and synthesizes the first cDNA. The resulting cDNA is complementary to the RNA to form an RNA / DNA hybrid (steps A and B). Under the action of RNase, the RNA chain in the RNA / DNA hybrid is degraded to obtain a hybrid cDNA with an RNA sequence at the 5' end. Single-stranded DNA binding protein binds to the hybrid cDNA to maintain its stability (step C). Chimeric primer 2 anneals with the hybrid cDNA and, under the action of a strand-displacing DNA polymerase, extends to form a hybrid double-stranded DNA with RNA at the 5' end of both chains (step D). The RNA portion of the DNA / RNA hybrid chain is continuously degraded by RNase, revealing a binding site for the RNA portion of the hybrid primer (step E). This allows the RNA portion of the unbound chimeric primer to continuously obtain binding sites and then bind to the template DNA. The DNA polymerase with strand-displacing activity continuously exerts its effect, performing a DNA strand displacement reaction (step F), displacing the DNA single strand synthesized in the previous reaction while synthesizing a new hybrid DNA. The two single strands obtained by displacement can complement each other to form double-stranded DNA. The newly synthesized double-stranded DNA completes large-scale template amplification through a cyclic process of RNA degradation, new primer annealing, and strand displacement.
[0053] In the present application, reverse transcriptase is an RNA-dependent DNA polymerase having 5'-3' RNA-guided DNA polymerase activity and DNA-guided polymerase activity, but no RNase H activity; strand-displacing DNA polymerase has strong strand-displacement activity and 5'→3' DNA polymerase activity, but no 5'→3' exonuclease activity and 3'→5' exonuclease activity.
[0054] In the present application, the chimeric primer is a composition of RNA and DNA, including an RNA fragment at the 5' end and a DNA fragment at the 3' end. The RNA fragment is followed by the DNA fragment. The length of the chimeric primer is 30nt-40nt (for example, 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 36nt, 37nt, 38nt, 39nt, 40nt), wherein the RNA fragment optimal length is 10nt-20nt (for example, 10nt, 11nt, 12nt, 13nt, 14nt, 15nt, 16nt, 17nt, 18nt, 19nt, 20nt), and the DNA fragment optimal length is 15nt-20nt (for example, 15nt, 16nt, 16nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt).
[0055] In one example, the reverse transcriptase is one or more of AMV reverse transcriptase and M-MLV reverse transcriptase.
[0056] In one example, the ribonuclease is one or more of ribonuclease A, ribonuclease T1, and ribonuclease H.
[0057] In one example, the strand-displacing DNA polymerase is Bst DNA polymerase I, One or more of DNA polymerase and Bsu DNA polymerase I.
[0058] In one example, the amplification reaction buffer contains KCl 10mM-100mM, MgCl2 2mM-20mM, dNTPs 0.1mM-1mM, dithiothreitol 1mM-10mM and BSA 50ng / μL-200ng / μL, and Tris-HCl buffer with a pH of 8.0-8.5 and a concentration of 10mM-200mM. In the amplification reaction buffer of the present application, the concentration of KCl is, for example, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 mM, the concentration of MgCl2 is, for example, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 mM, the concentration of dNTPs is, for example, 0.1 mM, 0.2, 0.4, 0.6, 0.8, 1 mM, and the concentration of dithiothreitol is, for example, 1, 3, 5, 7, 9, 10 mM. M, the concentration of BSA is, for example, 50, 70, 90, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 ng / μL, the pH value of Tris-HCl buffer is, for example, 8, 8.1, 8.2, 8.3, 8.4, 8.5, and the concentration is, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 mM.
[0059] In one example, the initial reaction solution for isothermal amplification contains 0.1 μM-0.5 μM of the chimeric primer, 0.1 U / μL-10 U / μL of the reverse transcriptase, 0.02 U / μL-2 U / μL of the ribonuclease, 30 ng / μL-300 ng / μL of the strand-displacing DNA polymerase, and 100 ng / μL-1000 ng / μL of the single-stranded DNA binding protein. In the initial reaction solution of the amplification reaction, the concentration of the chimeric primer is, for example, 0.1, 0.2, 0.3, 0.4, and 0.5 μM, the concentration of the reverse transcriptase is, for example, 0.1, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, and 10 U / μL, and the concentration of the ribonuclease is, for example, 0.02, 0.05, 0.1, 0.3, 0.5, 0.7, 0.9, 1, 1.2, 1.4, 1.6, 1.8, and 2 U / μL. μL, the concentration of the strand-displacing DNA polymerase is, for example, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300 ng / μL, and the concentration of the single-stranded DNA binding protein is, for example, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 ng / μL.
[0060] In one example, the conditions for isothermal amplification include: a temperature of 25° C. to 45° C. and a time of 30 min to 120 min. The temperatures for isothermal amplification are, for example, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, and 45° C., and the times are, for example, 30, 40, 50, 60, 70, 80, 90, 100, 110, and 120 min.
[0061] In one example, the nucleic acid fragment to be tested is an RNA fragment. For example, the nucleic acid fragment to be tested is a novel coronavirus nucleic acid or a novel coronavirus pseudovirus RNA. Detection using novel coronavirus nucleic acid as a target is primarily performed for non-diagnostic purposes.
[0062] In one example, the nucleic acid fragment to be detected is a DNA fragment, and the detection method further includes first placing the DNA fragment at 55°C-95°C for 2-5 minutes, then mixing it with the chimeric primer pair, reverse transcriptase, ribonuclease, strand-displacing DNA polymerase, single-stranded DNA binding protein, and amplification reaction buffer for isothermal amplification and detection. For example, the DNA fragment is first placed at 55, 60, 65, 70, 75, 80, 85, 90, or 95°C for 2, 2.5, 3, 3.5, 4, 4.5, or 5 minutes. For example, the DNA fragment is the novel coronavirus N gene plasmid DNA.
[0063] In one example, the chimeric primer pair is shown as SEQ ID No. 3 and SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, or SEQ ID No. 7 and SEQ ID No. 8.
[0064] In the second aspect of this application
[0065] The present application provides a kit for isothermal amplification of nucleic acids mediated by chimeric primers, the kit comprising the primer pair defined in the first aspect, reverse transcription, ribonuclease, strand-displacing DNA polymerase, single-stranded DNA binding protein and amplification reaction reagents. Specific embodiments
[0067] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manuals or conventional conditions in this area, or according to the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.
[0068] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.
[0069] Example 1
[0070] This embodiment provides a method for detecting novel coronavirus pseudovirus RNA nucleic acid, involving the following contents:
[0071] (1) Reagents: Virus quality control products containing the genome of the new coronavirus (SARS-CoV-2) (commissioned by Jingliang Gene Technology (Shenzhen) Co., Ltd.); Viral DNA / RNA Kit was purchased from Beijing Quanshijin; reverse transcriptase, RNaseH, Bsu strand-displacing DNA polymerase I, single-stranded DNA binding protein, etc. were purchased from Feipeng Bio.
[0072] (2) Chimeric primer pair: Based on the published SARS-CoV-2 novel coronavirus gene sequence, a chimeric primer pair specific for the N gene was designed. The chimeric primer pair was synthesized and purified by Sangon (Shanghai) Bioengineering Co., Ltd. The sequence of the chimeric primer pair is as follows:
[0073] Table 1
[0074]
[0075]
[0076] (3) RNA extraction: For detailed extraction process, please refer to the kit instructions.
[0077] A brief introduction is as follows: Take 200μL of virus quality control product, add BB5 buffer containing proteinase K, mix thoroughly for 15 seconds, and lyse at 56℃ for 15 minutes. Add 250μL of anhydrous ethanol, mix thoroughly for 15 seconds, and let it stand at room temperature for 5 minutes. Transfer the resulting mixed liquid into a centrifuge column and centrifuge at 12000g for 1 minute. Cut off the effluent and repeat the above steps until all the liquid has passed through the centrifuge column. Add 500μL of WB5 to wash once, centrifuge at 12000g for 1 minute; repeat this step once; after centrifugation at 12000g for 2 minutes, completely remove the residual ethanol. Add 30μL of RNase-free water and centrifuge at 12000g for 1 minute to elute.
[0078] (4) Amplification reaction solution (50 μL): 20 mM Tris-HCl buffer (pH 8.2); 80 mM KCl; 8 mM MgCl2; 0.2 mM dNTPs; 2 mM dithiothreitol (DTT); 100 ng / μL BSA; the final concentration of each chimeric primer is 0.2 μM; 7.5 U reverse transcriptase; 1 U RNase H; the final concentration of strand-displacing DNA polymerase is 240 ng / μL; the final concentration of single-stranded DNA binding protein is 300 ng / μL, and 1× SYBR Green I fluorescent dye.
[0079] (5) Add 5 μL of the novel coronavirus quality control nucleic acid RNA to the reaction system, mix well, and react at 42°C for 60 minutes.
[0080] (6) Result analysis: Amplification results are as follows: Figure 2Except for the chimeric primer pair 1 with 10 bp of RNA sequence at the 5' end and 10 bp of DNA at the 3' end, which had no amplification signal, the other three pairs of chimeric primers all had amplification signals to varying degrees, especially the chimeric primer pair 4 with 20 bp of RNA fragment at the 5' end and 20 bp of DNA fragment at the 3' end, which had a strong fluorescence signal and high amplification efficiency.
[0081] The amplified target sequence of Example 1 is shown in SEQ ID No. 9:
[0082] 5'-AGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAAT-3'.
[0083] Example 2
[0084] This embodiment provides a method for detecting plasmid DNA containing the novel coronavirus N gene, including the following:
[0085] (1) Reagents: The novel coronavirus N gene plasmid was provided by the Protein Engineering Department of Yahuilong Biotechnology Co., Ltd.; reverse transcriptase, RNase H, Bsu strand-displacing DNA polymerase I, single-stranded DNA binding protein, etc. were purchased from Feipeng Biotechnology.
[0086] (2) Primers: The primers used in this example are the same as those used in Example 1.
[0087] (3) Amplification reaction solution (50 μL): 20 mM Tris-HCl buffer (pH 8.2); 80 mM KCl; 8 mM MgCl2; 0.2 mM dNTPs; 2 mM dithiothreitol (DTT); 100 ng / μL BSA; final concentration of chimeric primer 0.2 μM; 7.5 U reverse transcriptase; 1 U RNase H; final concentration of strand-displacing DNA polymerase 240 ng / μL, final concentration of single-stranded DNA binding protein 300 ng / μL.
[0088] (4) 100 ng / μL novel coronavirus N gene plasmid was preheated at 95°C for 5 min, then taken out and immediately placed on ice for later use.
[0089] (5) Add 1 μL of the treated novel coronavirus N gene plasmid to the constant temperature reaction solution, mix well, and react at 37°C for 60 minutes.
[0090] (6) Result analysis: The results are as follows Figure 3As shown, except for chimeric primer 1 with 10 bp of RNA fragment at the 5' end and 10 bp of DNA fragment at the 3' end, which had no amplification signal, the other three pairs of chimeric primers all had amplification signals to varying degrees, especially chimeric primer pair 4 with 20 bp of RNA fragment at the 5' end and 20 bp of DNA fragment at the 3' end, which had a strong fluorescence signal and high amplification efficiency.
[0091] The amplified target sequence in Example 2 is shown in SEQ ID No. 9:
[0092] 5'-AGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAAT-3'.
[0093] In combination with the above Examples 1 and 2, the present application uses chimeric primers with a length of 30nt-40nt containing a 5'-end RNA fragment and a 3'-end DNA fragment, and achieves the amplification of DNA nucleic acid and RNA nucleic acid at 37°C and 42°C, respectively, under the catalysis of reverse transcriptase, RNase-H, and strand-displacing DNA polymerase.
[0094] The various technical features of the above-mentioned implementation modes and examples can be combined in any appropriate manner. In order to make the description concise, not all possible combinations of the various technical features in the above-mentioned implementation modes and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of the description in this specification.
[0095] The above-described embodiments only express several implementation methods of the present application, which facilitate a specific and detailed understanding of the technical solutions of the present application, but cannot be understood as limiting the scope of protection of the patent application. It should be pointed out that, for ordinary technicians in this field, without departing from the concept of the present application, several variations and improvements can be made, which all fall within the scope of protection of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, those skilled in the art can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the scope of protection of the present application. It should also be understood that the technical solutions obtained by those skilled in the art through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the scope of protection of the claims attached to the present application. Therefore, the scope of protection of the patent application of the present application shall be based on the content of the attached claims, and the description and drawings can be used to interpret the content of the claims.
Claims
1. A method for detecting nucleic acids mediated by chimeric primers for non-diagnostic purposes, characterized in that: The detection method comprises the following steps: Providing a nucleic acid fragment to be tested; Designing a chimeric primer pair for the target fragment in the nucleic acid fragment; in the chimeric primer pair, one chimeric primer specifically binds to the target fragment, and the other chimeric primer specifically binds to the complementary DNA fragment of the target fragment, each chimeric primer comprises an RNA fragment at the 5' end and a DNA fragment at the 3' end, and the length of the chimeric primer is 30 nt to 40 nt; mixing the nucleic acid fragment, the chimeric primer pair, reverse transcriptase, ribonuclease, strand-displacing DNA polymerase, single-stranded DNA binding protein, and amplification reaction buffer, performing constant temperature amplification, and detecting; In the chimeric primer, the length of the RNA fragment at the 5' end is 10nt-20nt, and the length of the DNA fragment at the 3' end is 15nt-20nt; The reverse transcriptase has 5'-3' end RNA-guided DNA polymerase activity and DNA-guided polymerase activity, but no RNase H activity; The strand displacement DNA polymerase has strong strand displacement activity and 5'→3' DNA polymerase activity, but no 5'→3' exonuclease activity and 3'→5' exonuclease activity; The ribonuclease is ribonuclease H.
2. The method for detecting nucleic acids mediated by chimeric primers for non-diagnostic purposes according to claim 1, characterized in that: The reverse transcriptase is one or more of AMV reverse transcriptase and M-MLV reverse transcriptase.
3. The method for detecting nucleic acids mediated by chimeric primers for non-diagnostic purposes according to claim 1, wherein: The strand displacement DNA polymerase is one or more of Bst DNA polymerase I, φ29 DNA polymerase and Bsu DNA polymerase I.
4. The method for detecting nucleic acids mediated by chimeric primers for non-diagnostic purposes according to claim 1, wherein: The amplification reaction buffer contains KCl 10mM-100mM, MgCl2 2mM-20mM, dNTPs 0.1mM-1mM, dithiothreitol 1mM-10mM and BSA 50ng / μL-200ng / μL, and a Tris-HCl buffer with a pH value of 8-8.5 and a concentration of 10mM-200mM.
5. The method for detecting nucleic acid mediated by a chimeric primer for non-diagnostic purposes according to claim 1, characterized in that: The conditions for isothermal amplification meet one or more of the following conditions: (1) The initial reaction solution for isothermal amplification comprises 0.1 μM-0.5 μM of the chimeric primer, 0.1 U / μL-10 U / μL of the reverse transcriptase, 0.02 U / μL-2 U / μL of the ribonuclease, 30 ng / μL-300 ng / μL of the strand-displacing DNA polymerase, and 100 ng / μL-1000 ng / μL of the single-stranded DNA binding protein; and, (2) The conditions for constant temperature amplification include: temperature of 25℃-45℃, time of 30min-120min.
6. The method for detecting nucleic acid for non-diagnostic purposes mediated by a chimeric primer according to any one of claims 1 to 5, characterized in that: The nucleic acid fragment to be detected is an RNA fragment.
7. The method for detecting nucleic acid for non-diagnostic purposes mediated by a chimeric primer according to any one of claims 1 to 5, characterized in that: The nucleic acid fragment to be detected is a DNA fragment, and the detection method further includes first placing the DNA fragment under 55°C-95°C conditions for 2 minutes to 5 minutes, then mixing it with the chimeric primer pair, reverse transcriptase, ribonuclease, strand displacement DNA polymerase, single-stranded DNA binding protein and amplification reaction buffer, and performing constant temperature amplification and detection.
8. A chimeric primer-mediated nucleic acid detection kit, characterized in that: The kit comprises the chimeric primer pair defined in any one of claims 1 to 7, reverse transcriptase, ribonuclease, strand-displacing DNA polymerase, single-stranded DNA binding protein and an amplification reaction buffer.
Citation Information
Patent Citations
Method for amplifying nucleic acid sequences by strand displacement using DNA / RNA chimeric primers
US5824517A