Method and kit for detecting replication-competent adenovirus

The adenovirus hexon and E1A genes were amplified using a dual-fluorescence real-time quantitative PCR method. By using specific primer and probe combinations, the sensitivity and specificity issues of RCA detection in adenovirus vectors in existing technologies were resolved, and rapid and accurate quantitative detection of RCA was achieved.

CN115976284BActive Publication Date: 2026-03-31BEIJING FIVEPLUS GENE TECH CO LTD +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing technologies suffer from low sensitivity, poor specificity, and high variability when detecting replicating adenovirus (RCA) in adenovirus vectors, making it difficult to accurately assess the RCA content.

Method used

A dual-fluorescence real-time quantitative PCR method was used to amplify the adenovirus hexon and E1A genes, and then use specific primer and probe combinations to achieve quantitative detection of RCA in adenovirus vector products.

Benefits of technology

It improves the sensitivity and specificity of detection, enabling accurate determination of RCA content in a short time, reducing experimental errors, and ensuring the stability and accuracy of detection results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115976284B_ABST
    Figure CN115976284B_ABST
Patent Text Reader

Abstract

The present application provides a method, primer pair and probe combination, and a corresponding kit for quantitatively detecting replication-competent adenovirus (RCA) in an adenoviral vector preparation. The present application also provides a method and a kit for evaluating the quality of an adenoviral vector preparation, and a corresponding adenoviral vector preparation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biological products and gene detection. Specifically, this invention provides a method, primer pairs and probe combinations, and corresponding kits for quantitative detection of replicating adenovirus (RCA) in adenovirus vector products. Background Technology

[0002] Recombinant adenovirus vectors have become widely used gene therapy vectors due to their high biocompatibility and non-pathogenicity in humans. Currently, commonly used adenovirus vectors have had genes related to adenovirus replication, such as E1 / E3, removed. Packaging cells, such as HEK293, provide genes like E1 to ensure the packaging and amplification of non-replicating adenoviruses, thus increasing safety.

[0003] Nevertheless, during the production of viral gene therapy vectors, unwanted replicative viruses (“RCAs”) may be formed due to random mutations or other events. For example, an E1a-deficient adenovirus vector can be produced in HEK293 cells, which contain a functional E1A region. Spontaneous recombination theoretically allows the functional E1A region to be reintroduced into the adenovirus, creating a replicative adenovirus (“RCA”). RCA stands for biohazard because, like wild-type Ad, it can replicate in the infected host and potentially cause disease.

[0004] Therefore, manufacturers of viral gene therapy vectors need to determine whether replication-defective viral vectors contain contaminating RCAs. Currently, most regulatory agencies require testing using the standard A549 cell culture method. This method is complex, requires continuous culture for 10 days to obtain results, and the evaluation method is to observe plaques, which is highly susceptible to human factors.

[0005] Numerous attempts have been made in the field to develop improved alternative methods, among which real-time quantitative PCR (qPCR) technology possesses the sensitivity required for detecting trace impurities. For example, see Yu Lei et al., Q-PCR Detection of Replicating Adenovirus in Adenovirus Gene Therapy Products, Biotechnology Communications, Vol. 28, No. 3 (May 2017). This literature establishes a probe-based qPCR system for the relative quantification of RCA copy number in adenovirus vector products. The limitation of the above method is that it only amplifies a single target gene, E1A, and cannot accurately assess the RCA content relative to the adenovirus vector product.

[0006] Therefore, there is an urgent need in this field to develop a reliable method for detecting RCA content in adenovirus vector products with high sensitivity, high specificity, and low variability. Invention Overview

[0007] This invention provides a method for quantitative detection of replicating adenovirus (RCA) in adenovirus vector products, and a corresponding kit.

[0008] In one aspect, the present invention provides a method for quantitative detection of RCA in an adenovirus vector product, the method comprising the steps of: (1) obtaining a sample containing an adenovirus vector product; (2) extracting total DNA from the sample; and (3) performing dual fluorescence real-time quantitative PCR using the adenovirus hexon and E1A genes as target genes to be amplified, thereby achieving relative quantitative detection of RCA in the adenovirus vector product. In a preferred embodiment, the adenovirus vector product cannot and / or should not replicate in normal human cells, and preferably the adenovirus vector product further comprises at least a portion of the wild-type adenovirus genome and exogenous genes.

[0009] In some specific embodiments, step (3) of the method includes a positive control that can be used to plot a standard curve. In some specific embodiments, the positive control is the plasmid construct pJET1.2-Hexon-E1A-E1B55K.

[0010] In some specific embodiments, step (3) of the method includes primers for amplifying and detecting the hexon target gene, wherein the primers comprise a primer pair of a hexon-specific forward primer and a hexon-specific reverse primer, wherein the forward primer contains at least 15 consecutive nucleotides identical to the nucleotide sequence of the hexon gene at its 3' end, and the reverse primer contains at least 15 consecutive nucleotides inversely complementary to the nucleotide sequence of the hexon gene at its 3' end. In another embodiment, the length of the forward primer is 15 to 100 nucleotides, or 16 to 35 nucleotides, preferably 17 to 25 nucleotides, more preferably 18 to 22 nucleotides, and most preferably 18 nucleotides; the length of the reverse primer is 15 to 100 nucleotides, or 16 to 35 nucleotides, preferably 17 to 25 nucleotides, and more preferably 18 to 23 nucleotides.

[0011] In some preferred embodiments, step (3) of the method includes primer pairs selected from the following for amplifying hexon target genes:

[0012] a)

[0013] CGCATGTACTCCTCTTTAGA(SEQ ID: 4)

[0014] CTGTTGGTAGTCCTTGTATTTAG (SEQ ID: 5)

[0015] b)

[0016] GACCGCATGTACTCCTTC(SEQ ID: 6)

[0017] GTTTGGTAGTCCTTGTATTTAGT (SEQ ID: 7)

[0018] c)

[0019] CCGCATGTACTCCTCTT(SEQ ID: 8)

[0020] CCTGTTGGTAGTCCTTGTATT(SEQ ID: 9)

[0021] In some specific embodiments, step (3) of the method includes primers for amplifying and detecting the E1A target gene, wherein the primers comprise a primer pair of an E1A-specific forward primer and an E1A-specific reverse primer, wherein the forward primer contains at least 15 consecutive nucleotides identical to the nucleotide sequence of the E1A gene at its 3' end, and the reverse primer contains at least 15 consecutive nucleotides inversely complementary to the nucleotide sequence of the E1A gene at its 3' end. In another embodiment, the length of the forward primer is 15 to 100 nucleotides, or 16 to 35 nucleotides, preferably 17 to 25 nucleotides, more preferably 18 to 22 nucleotides, and most preferably 18 nucleotides; the length of the reverse primer is 15 to 100 nucleotides, or 16 to 35 nucleotides, preferably 17 to 25 nucleotides, and more preferably 18 to 23 nucleotides.

[0022] In some preferred embodiments, step (3) of the method includes primer pairs selected from the following for amplifying the E1A target gene:

[0023] a)

[0024] 5'-ACACCTCCTGAGATACACCCG-3'(SEQ ID: 10)

[0025] 5'-GCAAGTCCTCGATACATTCCACA-3'(SEQ ID: 11)

[0026] b)

[0027] 5'-ATAGCTGTGACTCCGGTCCTTC-3'(SEQ ID: 13)

[0028] 5'-AGCAAGTCCTCGATACATTCCA-3'(SEQ ID: 14)

[0029] c)

[0030] 5'-CTTGGGTCCGGTTTCTATGC-3' (SEQ ID: 15)

[0031] 5'-TTCATCCTCGTCGTCACTGG-3' (SEQ ID: 16)

[0032] In some specific embodiments, step (3) of the method includes a probe for detecting the hexon gene and / or E1A gene in extracted DNA or extracts or amplification products of real-time quantitative PCR assays, wherein the probe is 16 to 35 nucleotides in length, preferably 18 to 27 nucleotides, and most preferably 20 to 25 nucleotides. In a preferred embodiment, the probe carries a fluorescent reporter group and / or a fluorescent quencher group. In a more preferred embodiment, the fluorescent reporter group is Hex or FAM, and the fluorescent quencher group is BHQ1 or TAMRA.

[0033] In some preferred embodiments, step (3) of the method includes a probe selected from the following for detecting hexon target genes:

[0034] Hex-CATCCACCACCTGACCGGCTC-BHQ1 (SEQ ID: 3)

[0035] In some preferred embodiments, step (3) of the method includes a probe selected from the following for detecting E1A target genes:

[0036] a)

[0037] 5'-FAM-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1 (SEQ ID: 12)

[0038] b)

[0039] FAM-5'-ACCTGCCACGAGGCTGGCTTTCC-3'TAMRA-3' (SEQ ID: 17).

[0040] In some embodiments, the dual-fluorescence real-time quantitative PCR method of the present invention for the quantitative detection of RCA in adenovirus vector products has one or more of the following characteristics:

[0041] (1) It has an amplification efficiency of approximately 90% to approximately 110%;

[0042] (2) Has a correlation coefficient R greater than 0.99 2The preferred values ​​are greater than 0.991, greater than 0.992, greater than 0.993, greater than 0.994, greater than 0.995, greater than 0.996, greater than 0.997, greater than 0.998, and greater than 0.999.

[0043] (3) It has good reproducibility, for example, the variability CV% is less than 40%, preferably less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, or less than 10%;

[0044] (4) It has a minimum detection limit of no more than 5 copies / μL.

[0045] Therefore, in another aspect, the present invention relates to primer pairs, probes, and / or combinations comprising primer pairs and probes, wherein the primer pairs and probes have the meaning and importance as described above. For example, in one embodiment, the invention provides primer pairs selected from any one of the following:

[0046] a)

[0047] CGCATGTACTCCTCTTTAGA(SEQ ID: 4)

[0048] CTGTTGGTAGTCCTTGTATTTAG (SEQ ID: 5)

[0049] c)

[0050] GACCGCATGTACTCCTTC(SEQ ID: 6)

[0051] GTTTGGTAGTCCTTGTATTTAGT (SEQ ID: 7)

[0052] d)

[0053] CCGCATGTACTCCTCTT(SEQ ID: 8)

[0054] CCTGTTGGTAGTCCTTGTATT(SEQ ID: 9)

[0055] Preferably, the primer pair is used to amplify the hexon gene of adenovirus or a fragment thereof in a PCR (e.g., real-time quantitative PCR) method.

[0056] In one embodiment, the present invention provides primer pairs selected from any one of the following:

[0057] a)

[0058] 5'-ACACCTCCTGAGATACACCCG (SEQ ID: 10)

[0059] 5'-GCAAGTCCTCGATACATTCCACA (SEQ ID: 11)

[0060] b)

[0061] 5'-ATAGCTGTGACTCCGGTCCTTC-3'(SEQ ID: 13)

[0062] 5'-AGCAAGTCCTCGATACATTCCA-3'(SEQ ID: 14)

[0063] c)

[0064] 5'-CTTGGGTCCGGTTTCTATGC-3' (SEQ ID: 15)

[0065] 5'-TTCATCCTCGTCGTCACTGG-3' (SEQ ID: 16)

[0066] Preferably, the primer pair is used to amplify the E1A gene or a fragment thereof of an adenovirus (e.g., a replicating adenovirus) in a PCR (e.g., real-time quantitative PCR) method.

[0067] In one embodiment, the present invention provides a probe having the sequence: Hex-CATCCACCACCTGACGGCTC-BHQ1 (SEQ ID: 3), preferably, said probe is used for detecting the hexon gene of adenovirus or a fragment thereof in a nucleic acid hybridization (e.g., real-time quantitative PCR) method.

[0068] In one embodiment, the present invention provides a probe having a sequence selected from:

[0069] a)

[0070] 5'-FAM-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1 (SEQ ID: 12)

[0071] b)

[0072] FAM-5'-ACCTGCCACGAGGCTGGCTTTCC-3'TAMRA-3' (SEQ ID: 17)

[0073] Preferably, the probe is used to detect the E1A gene or a fragment thereof of an adenovirus (e.g., a replicating adenovirus) in a nucleic acid hybridization (e.g., real-time quantitative PCR) method.

[0074] In one embodiment, the present invention provides a method for detecting RCA by PCR, the method comprising using a contaminated RCA genome in a sample as a template, and using a primer pair consisting of a reverse primer and a forward primer. In one embodiment, the method uses a combination comprising a primer pair and a probe. The primer pair (including a forward primer and a reverse primer) and the probe have the meanings described above. In some embodiments, the sample has an E1A gene content of not less than 5 copies / μL, thus being detectable by the method of the present invention. In some embodiments, the sample has an E1A gene content of not less than 50 copies / μL, thus being detectable by the method of the present invention. In one embodiment, the sample does not contain any contaminated RCA genome, and therefore no RCA genome is detected.

[0075] In one embodiment, the present invention provides a method for evaluating the quality of an adenovirus vector product, wherein the method is capable of detecting any contaminating RCA genome, if present.

[0076] In one embodiment, the present invention provides a composition and its use in evaluating the quality of an adenovirus vector product, wherein the composition comprises a primer pair of a forward primer and a reverse primer, and / or a probe, wherein the forward primer and the reverse primer and the probe have the meaning as described above.

[0077] In one embodiment, the present invention provides the use of primer pairs of forward and reverse primers, and / or probes, in the preparation of a detection reagent for evaluating the quality of adenovirus vector products, wherein the forward and reverse primers and probes have the meanings described above.

[0078] On the other hand, the present invention provides a kit for the quantitative detection of replicating adenovirus (RCA) in adenovirus vector products using a dual real-time quantitative PCR method. The kit comprises primers and probes for specifically amplifying and detecting hexon target genes, and primers and probes for specifically amplifying and detecting E1A target genes. Accordingly, the present invention provides a method for the quantitative detection of replicating adenovirus (RCA) in adenovirus vector products, comprising the steps of performing dual real-time quantitative PCR on the sample to be tested using the kit of the present invention.

[0079] In another embodiment, the present invention provides a kit for evaluating the quality of adenovirus vector products, the kit comprising primer pairs, or probes, consisting of forward and reverse primers, or combinations thereof, wherein the reverse primers, primer pairs, and combinations have the meanings described above. In a preferred embodiment, the kit further comprises a variety of commonly used reagents for real-time quantitative PCR. In a preferred embodiment, the kit further comprises quantitative control standards. In a preferred embodiment, the control standard is the plasmid construct pJET1.2-Hexon-E1A-E1B55K.

[0080] On the other hand, the present invention provides an adenovirus vector product characterized in that the RCA content therein, when detected using the method of the present invention, or using the primer-probe combination and / or kit of the present invention, confirms that the contaminating RCA content is less than 50 (copies / μL) / adenovirus genome concentration (copies / μL), that is, the RCA content is less than 50 copies / μL relative to the genome content of the non-replicating adenovirus product. In one embodiment, the genome concentration of the non-replicating adenovirus product is 1×10⁻⁶. 11 Therefore, the method of the present invention can detect a relative content of vg / mL. RCA, meaning the RCA content of the adenovirus vector product tested is below [a certain level]. Attached Figure Description

[0081] Figure 1 The results show the enzyme digestion identification of the plasmid construct pJET1.2-Hexon-E1A-E1B55K. Lane "M" is the DNA Ladder, lane "1" is the undigested circular vector, and lane "2" is the digestion product; all are within the expected size.

[0082] Figure 2 The image shows the constructed pJET1.2-Hexon-E1A-E1B55K plasmid map. The plasmid contains one copy of the hexon gene and one copy of the E1A gene, which serve as a positive control standard for amplification and can be used to plot a standard curve. Invention Details

[0084] The inventors of this invention have unexpectedly demonstrated that by using primer and probe combinations to amplify the hexon and E1A genes of adenovirus in dual-fluorescence real-time quantitative PCR, the quantitative detection of replicating adenovirus (RCA) can be achieved. Compared to conventional single-fluorescence real-time quantitative PCR detection methods in the prior art, the detection method of this invention is faster, completing the detection objective in a single reaction; the results are accurate, simultaneously detecting the number of replicating and non-replicating adenovirus genomes, minimizing the influence of experimental system errors, and providing accurate RCA content in a single result; furthermore, by optimizing the selection of primers and probes, the detection accuracy and stability of the experimental system are improved.

[0085] Unless otherwise specified, all terms and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art related to this invention. While any methods and materials substantially similar to those described herein may be used for the implementation or testing of this invention, only exemplary methods and materials are described. For the purposes of this invention, the following terms are defined below.

[0086] Unless the context clearly indicates otherwise, the term "nucleotide" should be understood herein to mean, in addition to referring to naturally occurring ribonucleotide monomers or deoxyribonucleotide monomers, a functionally equivalent structural variant of its associated structure, including derivatives and analogs, relative to the specific context of the nucleotide being used (e.g., hybridization to complementary bases). The term "nucleic acid" or "nucleic acid sequence" refers to deoxyribonucleic acid or ribonucleic acid oligonucleotides in single or double strands. This term includes nucleic acids, such as oligonucleotides comprising known analogs of natural nucleotides. This term also includes nucleic acid-like structures having a synthetic backbone.

[0087] In the context of two or more nucleic acid or polypeptide sequences, the term "identity" refers to two or more identical sequences or subsequences. If, when compared and aligned within a comparison window or specified region for maximum correspondence, the sequences have a specified percentage of identical nucleotides (e.g., at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity within a specified region), they are "substantially identical" to each other. These definitions also include the reverse complementary sequence of the aligned sequence.

[0088] Unless otherwise specified, the terms “Ad” and “AdV” as used herein are abbreviations for adenovirus. The term “adenovirus” as used herein is intended to include all adenoviruses, including those of the genera *Atadenovirus*, *Mastadenovirus*, and *Aviadenovirus*. To date, more than 51 human serotypes of adenovirus have been identified, primarily classified into serogroups A, B, C, D, E, or F. The adenovirus vector of the present invention may belong to serotype 2 (Ad2), serotype 11 (Ad11), serotype 35 (Ad35), serotype 7 (Ad7), or preferably, serotype 5 (Ad5), or the chimeric serotype Ad5F35, but is not limited to these categories.

[0089] Adenoviruses are non-enveloped DNA viruses. Vectors derived from adenoviruses possess numerous characteristics that make them particularly useful for gene transfer. As used herein, a “recombinant adenovirus vector” is an adenovirus vector carrying one or more heterologous nucleotide sequences (e.g., 2, 3, 4, 5, or more heterologous nucleotide sequences). For example, the biology of adenoviruses is well-characterized, they rarely cause serious pathological changes in humans, and the virus is highly efficient in introducing its DNA into host cells. It can infect a wide variety of cells and has a broad host range. The virus can be produced relatively easily in large quantities and can be conferred replication defects by deleting the early region 1 (“E1”) of the viral genome.

[0090] The genome of adenovirus (“Ad”) is a linear double-stranded DNA molecule of approximately 36,000 base pairs (“bp”) with a 55-kDa terminal protein covalently bound to the 5' end of each strand. Ad DNA contains approximately 100 bp of identically terminal inverted repeat sequences (“ITRs”), the exact length of which depends on the serotype. The origin of viral replication is located within the ITRs, just at the ends of the genome. DNA synthesis occurs in two phases. First, replication occurs via strand substitution, resulting in progeny double-stranded molecules and a parental replacement strand. The replacement strand is single-stranded and can form a so-called “panhandle” intermediate, which allows replication initiation and the production of progeny double-stranded molecules. Replication can also occur simultaneously from both ends of the genome, in which case the panhandle structure is not required.

[0091] The E1 region of adenovirus is the first region of expression of adenovirus after infection of target cells. This region consists of two transcriptional units—E1A and E1B genes, both of which are required for carcinogenic transformation in primary (embryonic) rodent cultures.

[0092] Unlike retroviruses, adenoviruses do not integrate into the host cell genome, can infect non-dividing cells, and can effectively transfer recombinant genes in vivo. These characteristics make adenoviruses a powerful tool for transferring, for example, target heterologous nucleic acids into cells, tissues, or subjects in need.

[0093] The embodiments of the present invention using adenovirus recombinants preferably include E1 mutations, defects, or deletions, which improves the safety limits of the vector because E1-deficient adenovirus mutants are replication-deficient and highly attenuated.

[0094] The present invention utilizes adenovirus recombinants to rapidly generate recombinant Ad vectors in 293 cells. However, low levels of RCA may contaminate the Ad vectors generated in 293 cells. RCA generation is due to overlapping sequences between the Ad vector and the 293 cell genome.

[0095] Basic information and reviews of adenoviruses can be easily found in textbooks on virology.

[0096] The term Hexon refers to the Hexon gene in the adenovirus genome, which encodes the largest and most abundant capsid protein of adenovirus—the Hexon protein, accounting for more than 83% of the capsid protein. The Hexon gene sequence applicable to this invention can be found in the Hexon coding region annotated in GenBank ID: AC_000008.1 (Human adenovirus 5 genome).

[0097] The term E1A refers to the early region 1A gene in the adenovirus genome, located on the left side of the genome and involved in viral transformation. Currently, non-replicating adenovirus vectors used in this field typically have the E1 and E13 regions deleted, rendering them incapable of replication. Adv proliferation occurs in 293T cells. 293T cells and wild-type adenovirus share homologous sequences near the E1 region; therefore, during proliferation, Adv may undergo homologous recombination with 293T cells, regaining replication ability, thus producing replicating adenovirus RCA. The applicable E1A gene sequence for this invention can be found in the E1A coding region annotated in GenBank ID: AC_000008.1 (Human adenovirus 5 genome).

[0098] As used herein, the term "PCR" refers to polymerase chain reaction. The term "real-time quantitative PCR" generally refers to PCR techniques called real-time quantitative polymerase chain reaction, quantitative polymerase chain reaction, or kinetic polymerase chain reaction, and is also frequently referred to in the field as "quantitative real-time PCR," "real-time PCR," "quantitative PCR," or "qPCR," etc. This technique utilizes PCR to simultaneously amplify and quantitatively measure target nucleic acids, most often with the aid of intercalating fluorescent dyes or sequence-specific probes, wherein the sequence-specific probes contain fluorescent reporter molecules that are detectable only when hybridizing with the target nucleic acid. In this article, terms such as "dual real-time quantitative PCR" and "dual qPCR" refer to real-time quantitative PCR reactions that simultaneously amplify and detect two targets in the same reaction tube. Although its reaction principle, reagents, and procedures are the same as single qPCR, the use of more primer and probe combinations necessitates careful consideration of factors such as the annealing temperature and sequence complementarity of oligonucleotide molecules (primers and probes), as well as the combination of different fluorescent molecules. Therefore, the constraints on its reaction system and conditions are far greater than those of single qPCR. Real-time quantitative PCR should be understood to include any amplification technique that can track the progress of the amplification reaction in real time, that is, a detection method that is equivalent to real-time quantitative PCR in terms of efficacy.

[0099] In this article, the term "quantitative" can refer to absolute quantification, that is, accurately or substantially accurately measuring the mass or mass concentration of the analyte; it can also refer to relative quantification, that is, a multiple or percentage relative to the mass or concentration of a certain control substance; or it can refer to semi-quantitative quantification, that is, although it is impossible to accurately or substantially accurately measure the mass or mass concentration of the analyte, its approximate numerical range or trend can be measured to a certain extent.

[0100] As used in this article, “primer” refers to oligonucleotide DNA that can act as an initiator of DNA replication in qPCR reactions, and can hybridize with template nucleic acid molecules under stringent conditions.

[0101] The term "probe" refers to an oligonucleotide with a specific sequence that can hybridize with a complementary sequence of a nucleotide. It can be used to detect and identify complementary or fully complementary sequences in nucleotides through specific hybridization. Probe molecules typically have a fluorescent reporter group and / or a fluorescence quencher group, which can alter fluorescence intensity, with the change in fluorescence intensity correlated with an increased level of DNA complementary to the probe present in the reaction. Probes suitable for real-time quantitative PCR come in various structural types, such as TaqMan probes, molecular beacons, and scorpion probes. For the purposes of this invention, any type of probe can be used. Under the ideal experimental conditions described herein, TaqMan probes are preferred. TaqMan probes hybridize in reverse complementarity to the amplification product in sequence and are hydrolyzed by the 5'-3' exonuclease activity of the Taq enzyme used in PCR after hybridization with the target molecule. The 3' end fluorescence quencher group is cleaved, causing the fluorescence resonance energy transfer (FRET) effect to disappear. The fluorescent reporter group emits fluorescence of a specific wavelength upon excitation by incident light, thereby being detected.

[0102] The length of the probes in this invention can vary within a fairly wide range, but due to practical factors, shorter probes are preferred in real-world applications. Typical probes consist of 15 to 30 bases, with 20 to 25 bases (e.g., 23) being most suitable. Using longer or shorter probes will not affect the sensitivity and specificity of this technique, but may require a series of modifications to the conditions for implementing the technique, such as changing the fusion temperature and GC content. Changes in GC content will fundamentally affect the hybridization temperature and time.

[0103] The term "FAM" refers to 6-carboxyfluorescein as a fluorescent dye. The spectroscopic parameters of the product are Ex = 494 nm / Em = 522 nm. Its fluorescence can be quenched by fluorescence quenching groups such as TAMRA upon approach.

[0104] The term "TAMRA" refers to 5-carboxy-tetramethylrhodamine N-succinimide ester as a dye. When it comes into contact with fluorescent molecules such as FAM, it can act as a fluorescence quencher, making the latter's fluorescence undetectable.

[0105] The term "Hex" refers to 6-carboxy-2',4,4',5',7,7'-hexachlorofluorescein, a fluorescent dye. The spectroscopic parameters of the product are Ex = 535 nm / Em = 556 nm. Its fluorescence can be quenched by fluorescence quenching groups such as TAMRA and BHQ1 when they are close together, so it is often used in combination with these two, especially BHQ1.

[0106] The term "BHQ1" refers to Black Hole Quencher 1, a fluorescent dye that can quench fluorescent groups such as FAM and Hex.

[0107] As used herein, “recombinant” means a polynucleotide synthesized in vitro or otherwise manipulated (e.g., a recombinant polynucleotide), a method for producing a gene product in a cell or other biological system using a recombinant polynucleotide, or a polypeptide encoded by a recombinant polynucleotide (“recombinant protein”). “Recombinant means” also include the excision and ligation of nucleic acids from various sources, having various coding regions or domains or promoter sequences, into an expression cassette or vector for expressing, for example, an inducible or constitutive expression of a polypeptide-coding sequence in the vector of the present invention.

[0108] The term "heterogeneous" when used with respect to nucleic acids refers to nucleic acids in cells or viruses that are not normally found in nature; or comprising two or more subsequences that are not found in the same relation to those normally found in nature, or that have been recombinantly engineered such that their expression levels, or their physical relation to other nucleic acids or other molecules in the cell, or their structure, are not normally found in nature. For example, heterologous nucleic acids are generally produced by recombination and have two or more sequences derived from unrelated genes arranged in a manner not found in nature; for example, a human gene operatively linked to a promoter sequence within the adenovirus-based vector of the present invention.

[0109] The “expression” of genes or nucleic acids includes not only cellular gene expression, but also the transcription and translation of nucleic acids in cloning systems and any other context.

[0110] The term "gene product" primarily refers to proteins and polypeptides encoded by other nucleic acids (e.g., non-coding and regulatory RNAs such as tRNA and sRNPs).

[0111] As used herein, a "vector" is a tool that allows or facilitates the transfer of an entity from one environment to another. For example, certain vectors used in recombinant DNA technology allow entities, such as DNA segments (e.g., heterologous DNA segments), to be transferred into target cells. This invention includes recombinant adenovirus vectors.

[0112] The term "plasmid" refers to a DNA transcription unit containing polynucleotides according to the invention and elements required for recombination, replication within the Ad, and expression of transgenes in the host. Circular plasmids are preferred, and they may be supercoiled or non-supercoiled. Linear forms are also included in the context of this invention.

[0113] Documentation concerning exogenous DNA expressed in a vector (e.g., encoding a target epitope and / or antigen and / or therapeutic agent) and providing such exogenous DNA, as well as the expression of transcription and / or translation factors for enhancing the expression of nucleic acid molecules, and terms such as “target epitope,” “therapeutic agent,” and other things, refer to their meanings as known in the art.

[0114] Hybridization occurs when two nucleic acid molecules renature each other under suitable conditions. Again, the term "hybridization" as used here refers to the formation of a double helix structure based on complementary base pairs between two nucleotides. Hybridization can occur between perfectly complementary nucleotide chains or between "well-complementary" nucleotide chains containing a small number of unpaired regions. The conditions for hybridization of perfectly complementary nucleotide chains are referred to as "strict hybridization conditions" or "sequence-specific hybridization conditions." Sometimes, well-complementary stable nucleotide duplexes can still be obtained under less stringent hybridization conditions, in which case the tolerance for mismatches can be adjusted by appropriately modifying the hybridization conditions. Nucleic acid hybridization is a well-known technique in the field of DNA manipulation. The hybridization properties of a given nucleic acid pair are an indicator of its similarity or identity. Another indicator that two nucleic acid sequences are substantially identical is that the two molecules hybridize with each other under stringent conditions. The phrase "specific hybridization" refers to a molecule binding to, forming a double helix, or hybridizing only with a specific nucleotide sequence under stringent conditions, when that sequence is present in a complex mixture of DNA or RNA (e.g., total cells). "Substantially binding" refers to complementary hybridization between the probe and target nucleic acids and includes a small number of mismatches that can be tolerated by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence. In nucleic acid hybridization experiments such as DNA blotting and RNA blotting, "stringent hybridization conditions" and "stringent hybridization washing conditions" are sequence-dependent and vary under different environmental parameters. An example of a highly stringent washing condition is washing with 0.15 M NaCl at 72°C for approximately 15 minutes. An example of a stringent washing condition is washing with 0.2X SSC at 65°C for 15 minutes. Often, a low-stringent wash precedes a high-stringent wash to remove background probe signal. An example of a moderately stringent wash for, for example, duplexes of more than 100 nucleotides is washing with 1X SSC at 45°C for 15 minutes. An example of a low-stringent wash for, for example, duplexes of more than 100 nucleotides is washing with 4X to 6X SSC at 40°C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve a salt concentration of less than about 1.5 M, more preferably about 0.01 to 1.0 M sodium ion concentration (or other salt), at pH 7.0 to 8.3, and a temperature generally of at least about 30 °C and for long probes (e.g., >50 nucleotides), at least about 60 °C. Stringent conditions can also be achieved by adding a destabilizing agent such as formamide. Typically, a signal-to-noise ratio of 2X (or higher) observed for unrelated probes in a specific hybridization assay indicates the detection of a specific hybridization. If nucleic acids that do not hybridize to each other under stringent conditions encode substantially identical proteins, then the nucleic acids are also substantially identical. This occurs, for example, when nucleic acid copies are generated using the maximum codon degeneracy allowed by the genetic code. For a specific probe, T is selected. mEquivalent to stringent conditions. An example of stringent hybridization conditions for hybridizing complementary nucleic acids with more than 100 complementary residues on a filter membrane in DNA blotting or RNA blotting is hybridization at 37°C in 50% formamide, for example in 1M NaCl, 1% SDS, followed by washing at 60°C to 65°C in 0.1X SSC. An exemplary low-stringency condition includes hybridization at 37°C in a buffer solution of 30% to 35% formamide, 1M NaCl, 1% SDS (sodium dodecyl sulfate), followed by washing at 50°C to 55°C in 1X to 2X SSC (20X SSC = 3.0M NaCl / 0.3M trisodium citrate). An exemplary medium-stringency condition includes hybridization at 37°C in 40% to 45% formamide, 1.0M NaCl, 1% SDS, followed by washing at 55°C to 60°C in 0.5X to 1X SSC. The following are examples of group hybridization / washing conditions that can be used to clone orthogonal homologous nucleotide sequences substantially identical to the reference nucleotide sequence of this invention: A reference nucleotide sequence is preferably hybridized with the reference nucleotide sequence at 50°C in 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, and washed at 50°C in 2X SSC and 0.1% SDS; more preferably, hybridization is performed at 50°C in 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, and washed at 50°C in 1X SSC and 0.1% SDS; still more preferably, hybridization is performed at 50°C in 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, while washing at 50°C in 0.5X SSC and 0.1% SDS; even more preferably, hybridization is performed at 50°C in 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA, while washing at 50°C in 0.5X SSC and 0.1% SDS; and even more preferably, hybridization is performed at 50°C in 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1mM EDTA. Hybridized in EDTA and washed at 50°C in 0.1X SSC and 0.1% SDS.

[0115] The term "standard" refers to experimental methods and materials based on published references that are well-recognized in the field.

[0116] In the context of this invention, "subject" can be a vertebrate, such as a mammal, bird, reptile, amphibian, or fish; more advantageously, a human, or a companion or domesticated or used animal for food or feed production, or a livestock or animal for hunting, racing, or sporting, such as, but not limited to, cattle, dogs, cats, goats, sheep, pigs, horses, and poultry. Preferably, the vertebrate is a human. Because the immune systems of all vertebrates function similarly, the described application can be implemented in all vertebrate systems.

[0117] This invention relates to a method for quantitative detection of RCA in adenovirus vector products.

[0118] Advantageously, the sequences of the primers and / or probes have at least 80% identity with the target sequence or its reverse complementary sequence, preferably the target sequence being present in the hexon gene and E1A gene of the adenovirus.

[0119] Advantageously, the primer and / or probe oligonucleotide molecule contains at least 15 nucleotides, and preferably, the theoretical melting temperature Tm of the probe is about 10 °C ± 0.5 °C higher than the theoretical Tm of the primer.

[0120] Preferably, the enzyme used in this invention can be any enzyme with polymerase activity that can be used under PCR operating conditions, for example, preferably, Taq polymerase, more preferably, high-fidelity Taq polymerase.

[0121] The present invention also relates to a real-time quantitative PCR amplification reaction kit for detecting replicating adenovirus (RCA), characterized in that it comprises the aforementioned primer pairs and probes. The kit advantageously also includes a positive control. Therefore, the present invention also provides a method for detection using the kit.

[0122] The nucleotide sequences of the hexon and E1A genes in the genomes of different serotypes of adenovirus can be obtained from bioinformatics databases such as Genbank. Despite the differences, those skilled in the art can still detect the nucleotide sequences of the hexon and E1A genes of these serotypes in unexpected ways.

[0123] Compared with existing methods, one advantage of the method for detecting and / or quantifying replicating adenovirus (RCA) of the present invention is that it exhibits significant detection sensitivity with a detection limit of 50 copies / μL.

[0124] In a preferred embodiment of the present invention, real-time quantitative PCR is "hot-started," thereby avoiding non-specific amplification to a greater extent.

[0125] In one specific implementation plan, after real-time quantitative PCR is completed, a standard curve is fitted based on the concentration of standard DNA and the Ct value obtained from the detection, and then the content of RCA in the sample to be tested is calculated through the standard curve.

[0126] In some embodiments of the present invention, a kit is provided that contains all or some of the reagents used in the method of the present invention, excluding the sample to be tested, including primers and / or probes.

[0127] In a particularly specific embodiment of the present invention, a kit is provided comprising: a PCR amplification reaction solution, standards, a negative control, and a DNA dilution solution. The PCR amplification reaction solution includes Taq enzyme, dNTPs, and Mg²⁺. 2+PCR buffer, primer pairs, and Taqman probes; the standard is, for example, the construct pJET1.2-Hexon-E1A-E1B55K, with a concentration of 10-50 ng / μL. When using, the standard is diluted with DNA dilution buffer to seven concentration gradients, each 1×10⁻⁶. 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The standard curve concentration gradient includes seven dilutions: copies / μL and 5 copies / μL. The primer pairs include primer pairs specifically amplifying the Hexon gene and primer pairs specifically amplifying the E1A gene. The probe has at least 80% sequence identity with the amplification products of the aforementioned primer pairs, and the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group. Preferably, the fluorescent reporter group is FAM or Hex, and the fluorescent quencher group is TAMRA or BHQ1.

[0128] The primer pairs specifically amplifying the Hexon gene can be selected from any of the following groups:

[0129] a)

[0130] CGCATGTACTCCTCTTTAGA(SEQ ID: 4)

[0131] CTGTTGGTAGTCCTTGTATTTAG (SEQ ID: 5)

[0132] b)

[0133] GACCGCATGTACTCCTTC(SEQ ID: 6)

[0134] GTTTGGTAGTCCTTGTATTTAGT (SEQ ID: 7)

[0135] c)

[0136] CCGCATGTACTCCTCTT(SEQ ID: 8)

[0137] CCTGTTGGTAGTCCTTGTATT (SEQ ID: 9).

[0138] The primer pairs specifically amplifying the E1A gene can be selected from any of the following groups:

[0139] a)

[0140] 5'-ACACCTCCTGAGATACACCCG-3'(SEQ ID: 10)

[0141] 5'-GCAAGTCCTCGATACATTCCACA-3'(SEQ ID: 11)

[0142] b)

[0143] 5'-ATAGCTGTGACTCCGGTCCTTC-3'(SEQ ID: 13)

[0144] 5'-AGCAAGTCCTCGATACATTCCA-3'(SEQ ID: 14)

[0145] c)

[0146] 5'-CTTGGGTCCGGTTTCTATGC-3' (SEQ ID: 15)

[0147] 5'-TTCATCCTCGTCGTCACTGG-3' (SEQ ID: 16).

[0148] The probe sequence for specifically detecting Hexon gene amplification products is shown as Hex-CATCCACCACCTGACGGCTC-BHQ1 (SEQ ID: 3).

[0149] The probe for specifically detecting the E1A gene amplification product can be selected from any of the following groups:

[0150] a)

[0151] 5'-FAM-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1 (SEQ ID: 12)

[0152] b)

[0153] FAM-5'-ACCTGCCACGAGGCTGGCTTTCC-3'TAMRA-3' (SEQ ID: 17).

[0154] Another embodiment of the present invention is a method for evaluating the quality of an adenovirus vector product, wherein the method is capable of detecting the presence and content of any contaminating RCA, and the method includes using methods as defined above.

[0155] Another embodiment of the present invention is a composition, and the use of the composition in evaluating the quality of an adenovirus vector article, or in detecting the presence of RCA in any contamination of an adenovirus vector article, wherein the composition comprises a primer pair of a forward primer and a reverse primer, and / or a probe, wherein the forward primer and the reverse primer and the probe have the meaning as defined above.

[0156] Another embodiment of the invention is the use of primer pairs of forward and reverse primers, and / or probes, in the preparation of a detection reagent for evaluating the quality of adenovirus vector products, or for detecting the presence of RCA in any contamination of adenovirus vector products, wherein the forward and reverse primers and probes have the meanings as defined above.

[0157] In some embodiments of the present invention, samples are treated by conventional methods such as proteinase K method, phenol method, CTAB method, SDS lysis method, kit method (magnetic bead or non-magnetic bead), silica adsorption method, commercial adsorption membrane column extraction kit method, and alkaline lysis method to extract total DNA. These methods described herein have the same meaning, applicability, and effects as commonly used by those skilled in the art, and their specific steps can be found in, for example, textbooks commonly used in the art, such as J. Sambrook and DW Russell, *Molecular Cloning: A Laboratory Manual*, 3rd edition, Science Press; and Li Junmin, *Molecular Biology Experiments*, Zhejiang University Press, 1st edition, etc. In some specific embodiments, the method of the present invention selects the lysis method to lyse the virus to obtain DNA.

[0158] The technical solutions of the present invention are explained in detail below through some illustrative but non-limiting embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Those skilled in the art will understand that some conventional, simple or equivalent alternatives not described in the following embodiments also fall within the protection scope of the present invention. Detailed implementation method:

[0159] Example 1: Materials and Methods

[0160] The adenovirus product used as the test sample was the non-replicating adenovirus AdV5 (batch number 2022101701), which was prepared using the AdMAX adenovirus system (Microbix Biosystems Inc., Canada, containing pBHGlox(delta)E13Cre and pDC316 plasmids). First, the exogenous EGFP gene (EGFP: enhanced green fluorescent protein) was inserted into the shuttle plasmid pDC316 to obtain pDC316-EGFP. Then, HEK293 cells were co-infected with the adenovirus genomic backbone plasmid pBHGlox(delta)E13Cre and the shuttle plasmid pDC316-EGFP to obtain the AdV5-EGFP adenovirus seed. The seed was amplified in suspended HEK293 cells to obtain the AdV5-EGFP virus.

[0161] Using the gene to be amplified as a template, the upstream and downstream primers and probes for PCR were designed using Beancon Designer software. Based on the software scores and considering the amplification region and the compatibility between the primers and probes targeting the two targets, suitable candidates were selected and synthesized by Qingke Biotechnology Co., Ltd. Primer purity was measured using PAGE, and probe purity was measured using HPLC. The initially selected primer pairs and probe sequences are shown in Tables 1 and 2.

[0162] Table 1 Hexon primer and probe sequences

[0163]

[0164] Table 2 E1A Primer and Probe Sequences

[0165]

[0166] The reagents used in real-time quantitative PCR are as follows: Universal Master Mix II, with UNG, 2×, from applied biosystems by Thermo Fisher Scientific, catalog number: 4440038. Positive control standard: pJET1.2-Hexon-E1A-E1B55K plasmid construct, prepared in-house, see Example 2 for details. Proteinase K solution (20 mg / ml) from Solarbio, catalog number: P1121.

[0167] Example 2: Construction of control standard quality plasmid pJET1.2-Hexon-E1A-E1B55K

[0168] The basic plasmid pJET1.2-E1A-E1B55K was previously constructed by the inventors, and its sequence is shown in SEQ ID NO:20. Using the pBHGlox(delta)E13Cre adenovirus packaging plasmid as a template, PCR amplification was performed using In-Fusion primers (upstream primer: '-aatgcatctagatccgaattcATGGCTACCCCTTCGATGATG-3' (SEQ ID NO:18); downstream primer: 5'-atgtctcatggtggcgaattcTTATGTTGTGGCGTTGCCG-3' (SEQ ID NO:19)) to obtain the 2901b phexon gene target fragment. The pJET1.2-E1A-E1B55K plasmid was digested with EcoRI to obtain a 5425bp linearized vector. In-fusion cloning was then performed to insert the target fragment into the vector. After transformation and plating, restriction enzyme digestion and sequencing identification were performed. The results showed that the construct was consistent with the design, and the complete sequence is shown in SEQ ID NO:21. Restriction enzyme digestion identification results are as follows: Figure 1 As shown, the constructed plasmid map is as follows: Figure 2 As shown.

[0169] Example 3: Screening of Hexon and E1A primers and probes

[0170] The standard quality particle pJET1.2-Hexon-E1A-E1B55K was serially diluted 1×10⁻⁶ with RNase-free water containing 0.05% F68: 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1Seven dilutions were prepared, including copies / μL and 1 copy / μL. 5 μL of RNase-Free Water (0.05% F68) was used as the qPCR template for the reaction, serving as a negative control. Premixed solutions (excluding the template) were prepared according to the single-tube reagent volumes and the number of tubes to be tested, as shown in Table 3 below. The total amount of each reagent to be added to the premix tube was calculated as (single-tube reagent volume * (number of reaction tubes + 1-2)). The premixed solution was prepared in a 1.5 mL centrifuge tube, vortexed to mix, briefly centrifuged, and then divided into eight-tube aliquots, 15 μL per well. 5 μL of the prepared template was added to the template tube, and 5 μL of RNase-Free Water (0.05% F68) was added to the negative control tube. The aliquots were gently pipetted 3-5 times to mix, capped, and briefly centrifuged. The mixture was then transferred to the reaction chamber and analyzed according to the procedure in Table 4.

[0171] Table 3 qPCR reaction system

[0172]

[0173] Table 4 Reaction conditions (7500 Fast Real-Time PCR System)

[0174]

[0175] The results are shown in Tables 5 and 6. Among the four sets of Hexon primer-probe sequences, the second set of primer-probe sequences obtained the R-value of the standard curve. 2 =0.999, Eff%=97.684%, significantly better than the other primer and probe groups, therefore the second primer group was selected for subsequent experiments; although the third and fourth primer groups were slightly worse than the second group, they were considered to be able to achieve the detection purpose. All three E1A primer and probe sequences met the requirement of 90%≤Eff%≤110%, indicating relatively ideal results.

[0176] Table 5. Primer selection for the Hexon gene

[0177]

[0178]

[0179] Note: Und = Undetermined

[0180] Table 6. Primer selection for the E1A gene

[0181]

[0182] Note: Und = Undetermined

[0183] Example 4: Comparability detection of dual qPCR and conventional qPCR

[0184] Taking Hexon primer-probe combination 2 and E1A primer-probe combination 2 as examples, the standard quality plasmid was subjected to dual qPCR and ordinary qPCR detection. The ordinary qPCR detection method is as described in Example 3, the dual qPCR reaction system is shown in Table 7, and the other operation methods are as described in Example 3.

[0185] Table 7 Dual qPCR Reaction System

[0186]

[0187] The detection results are shown in Table 8. There was no significant difference in the CT values ​​of the standard plasmid obtained by dual qPCR and the corresponding concentration standard of ordinary single qPCR. The detection results of dual qPCR and ordinary single qPCR using the Hexon-2 / E1A-2 primer pair showed no significant difference. 2 Both Eff% and Eff% meet the requirements (R) 2 >0.99, 90%≤Eff%≤110%.

[0188] Table 8-1 Conventional qPCR Detection

[0189]

[0190]

[0191] Note: Und = Undetermined

[0192] Table 8-2 Dual qPCR Detection

[0193]

[0194] Note: Und = Undetermined

[0195] Example 5: Comparison of the effects of dual qPCR and conventional qPCR in detecting RCA in non-replicating adenovirus vector products

[0196] In this embodiment, the method of the present invention (method one) and the conventional single qPCR method for detecting the E1 gene described in the prior art (see Yu Lei et al., 2017) (method two) were used to detect the RCA content level in non-replicating adenovirus products.

[0197] Method 1: Using the dual qPCR method described in Example 4, taking Hexon primer-probe combination 2 and E1A primer-probe combination 2 as an example, the copy number of E1A gene and the copy number of Hexon gene in the test sample AdV5 were detected, and the ratio of the two was the RCA residual level.

[0198] Method 2: Using the conventional qPCR method described in Example 4, the E1A copy number (copy / μL) in the test sample AdV5 was detected using E1A primer 3 as a primer probe, and the viral particle titer (vp / mL) of the test sample AdV5 was detected by HPLC. The E1A copy number (copy / mL) / viral particle titer (vp / mL) is the RCA residual level.

[0199] The test sample Adv5 (same as above, batch number 2022101701) was diluted 4, 8, 16 and 10 times respectively and then tested. The CV% value of the four test results was calculated to evaluate the accuracy of the test results of the two methods.

[0200] The results are shown in Tables 9 and 10. The CV% value among the four detection results for Method 1 was 23.38%. In Method 2, the viral particle titer of the original sample was detected by HPLC at 2.88E+10VP / mL. The HPLC detection range is 1.5E+10~1.0E+12VP / mL. Therefore, the viral particle titer detection results after 4, 8, 16, and 10-fold dilutions showed significant deviations and could not be accurately detected. Consequently, the RCA residue level in the product could not be accurately assessed; only the E1A gene copy number could be detected. Further calculations were made using the viral particle titers of the corresponding samples to determine the RCA residue level obtained from Method 2. The calculated CV% value among the four detection results was 82.02%, significantly higher than that of Method 1.

[0201] The results above show that the dual qPCR method has high accuracy in detecting residual RCA levels of non-replicating adeno-associated virus (AAV), can detect RCA residues in samples with lower viral particle titers, and is simple and quick to operate, which has significant advantages.

[0202] Table 9. Detection results of Method 1

[0203]

[0204] Table 10 Detection results of Method 2

[0205]

[0206]

[0207] Example 6: Dual qPCR repeatability detection

[0208] To evaluate the reproducibility of the experimental design, two duplex qPCR assays were performed using Hexon primer-probe combo 2 in combination with E1A primer-probe combos 2 and 3, respectively. The results are shown in Tables 11 and 12, and all met the R... 2 and Eff% requirements.

[0209] Table 11 Dual qPCR detection replicate 1

[0210]

[0211]

[0212] Note: Und = Undetermined

[0213] Table 12 Dual qPCR detection replicates 2

[0214]

[0215]

[0216] Note: Und = Undetermined

[0217] Example 7: Limit of Quantification

[0218] The dual qPCR method described in Example 4 used Hexon primer-probe combination 2 and E1A primer-probe combination 2 to perform three standard curve tests to determine the limit of quantitation (LOQ) for dual qPCR detection. The results are shown in Table 13. When the standard curve range was 1E+07–5 copies / μL, the CV% (CV% = measured value / theoretical value × 100%) for each concentration was within the range of 50%–150%. Therefore, this method can accurately quantify the standard curve range of 1E+07–5 copies / μL, with a minimum LOQ of 5 copies / μL, which is 10 times higher than existing literature (e.g., Yu Lei et al., 2017). Since dual qPCR samples are diluted at least 10-fold (see Examples 8, 9, and 10), this method can detect E1A gene levels as low as 50 copies / μL in samples. If the sample concentration is 1E+11 vg / mL, this method can detect RCA residual levels as low as 1 / 2E+09.

[0219] Table 13-1 Recovery rates of the standard curves for the E1A gene in three experiments

[0220]

[0221]

[0222] Note: Und = Undetermined

[0223] Table 13-2 Recovery rates of standard curves for three experiments using the Hexon gene

[0224]

[0225] Note: Und = Undetermined

[0226] Example 8: Linear

[0227] The linearity of an analytical method refers to the proportionality between the detection result and the analyte in the test sample within a given range. To test the linear range of this method for detecting non-replicating adenovirus samples (taking AdV5 batch number Ad2022101701 as an example), based on previous test results, the pretreated test sample (after completing the proteinase K digestion step) was diluted as follows using diluent:

[0228] Linearity test solution: 1:2 dilution of the test sample;

[0229] Linearity test solution: 2:4 dilution of the test sample;

[0230] Linearity test solution: 3:8 dilution of the test sample;

[0231] Linearity test solution: 4:16 times diluted with the test sample;

[0232] Linearity test solution: 5:10 dilution of the test sample;

[0233] Linearity test solution: 6:32 dilution of the test sample;

[0234] Linearity test solution: 7:100 dilution of the test sample;

[0235] Linearity test solution: 8:1000 dilution of the test sample

[0236] 5 μL of the above linear test solution was used as template for qPCR reaction, with two replicates. At least five suitable points were selected from the detection results of the eight linear dilutions for linear fitting, and the two genes were analyzed independently. The linear fitting curve of the test sample was obtained by fitting the logarithm of the CT value and the detection value. Three replicate experiments were performed to obtain the optimal linear range. The results are shown in Tables 14-16. All eight linear dilutions met the acceptance criteria: R... 2 >0.99%.

[0237] The CV% value at each dilution factor can be calculated using the formula (CV% = Quantity Mean of this linear dilution * dilution factor number / Quantity Mean * average dilution factor). This allows for a preliminary determination of the minimum dilution factor required for sample pretreatment. As shown in the table below, diluting the sample that has completed the proteinase K digestion step by at least 4 times can satisfy the CV% requirement of 60% to 140%.

[0238] Table 14 Linear 1

[0239]

[0240] Note: CV% = Quantity Mean * Dilution Factor of this Linear Diluent / Quantity Mean * Average Dilution Factor

[0241] Table 15 Linear 2

[0242]

[0243]

[0244] Note: CV% = Quantity Mean * Dilution Factor of this Linear Diluent / Quantity Mean * Average Dilution Factor

[0245] Table 16 Linear 3

[0246]

[0247] Example 9: Precision

[0248] The precision of an analytical method refers to the degree of similarity of results from multiple samplings of a homogeneous test sample under specified conditions. It is generally expressed as the coefficient of variation (CV%), which is the ratio of the standard deviation of the measured values ​​to the mean of the measured values. The precision of this method in detecting non-replicating adenovirus samples (taking AdV5 batch number Ad2022101701 as an example) was tested from two aspects: repeatability and intermediate precision.

[0249] 1. Repetitiveness

[0250] The test sample was diluted to three concentrations: high, medium, and low. The same inspector tested the three concentrations three times.

[0251] The results are shown in Tables 17-19. When the pretreatment sample was diluted at least 8 times, the results of three E1A gene and Hexon gene detections and the E1A / Hexon ratio CV% were all ≤40%, where CV% = STDE / AVERAGE × 100%.

[0252] Table 17 CV% values ​​of E1A gene detection results (3 times)

[0253]

[0254]

[0255] Table 18 CV% values ​​of Hexon gene assays (3 times)

[0256]

[0257] Table 19 CV% values ​​of E1A / Hexon 3 tests

[0258]

[0259] 2. Intermediate precision

[0260] The test sample was diluted to three concentrations: high, medium, and low. Different inspectors tested the samples at the three concentrations, repeating the tests two to three times at different time points. The CV% value of all test results was calculated. The intermediate precision results are shown in Example 9. As can be seen from the CV% values ​​of the five experimental results in Table 20 (CV% = AVERAGE / STDEV × 100%), the intermediate precision of the E1A / Hexson results is better than that of detecting E1A gene copy number or Hexson gene copy number alone, with CV% < 20%.

[0261] Example 10: Accuracy

[0262] The accuracy of an analytical method refers to the degree of consistency or closeness between the measured value and the true value or an accepted reference value. Based on the linearity results (Example 7), three concentrations of RCA—high, medium, and low—were determined. The medium concentration was the median value of the linearly defined range, while the high and low concentrations were the highest and lowest values ​​of the linearly defined range. If the results did not meet the acceptance criteria, the second highest and second lowest values ​​of the linearly defined range were used as the high and low concentrations, and so on.

[0263] The test sample (as before, AdV5 batch number Ad2022101701) was diluted with diluent to three concentrations (high, medium, and low, i.e., 10-fold, 32-fold, and 100-fold dilutions), and each sample was tested three times. The recovery rate was calculated. Recovery rate % = detected value / standard value × 100%. Three intermediate values ​​with relatively good data accuracy (16-fold, 32-fold, and 100-fold dilutions) were selected, and two laboratory technicians conducted tests on each sample. The average of the five test results was determined as the standard value of the test sample.

[0264] The test results are shown in the table below. Table 20 shows the results of 5 tests conducted by 2 lab technicians. The mean of all results for each lab technician at 16x, 32x, and 100x dilution of the test sample (back-calculated concentration = test concentration × dilution factor) was calculated (see Table 21). The average of the two lab technicians' mean values ​​was further calculated as the standard value. The results are shown in Table 21. Hexon was 1.35E+08 vg / μL, E1A was 346.62 vg / μL, and E1A / Hexon was 2.5818E-06.

[0265] The test sample was diluted 10-fold, 32-fold, and 100-fold to obtain samples that were tested three times each, and the recovery rate was calculated. The results are shown in Table 22. The recovery rate of Hexon gene was 25%–175%, the recovery rate of E1A was 25%–175%, and the recovery rate of E1A / Hexon was 70%–130%. When the sample was diluted 10-fold, the accuracy met the acceptable standard.

[0266] The results above show that the E1A / Hexon detection results have good accuracy, with recoveries meeting the acceptance criteria ranging from 70% to 130%. Furthermore, the CV% values ​​(CV% = AVERAGE / STDEV × 100%) of the five experiments in Table 20 indicate that the E1A / Hexson results have better intermediate precision compared to detecting E1A or Hexson gene copy numbers alone, with CV% < 20%.

[0267] The data above show that the accuracy and repeatability of the dual qPCR detection results for E1A / Hexson in this invention are far superior to those of detecting the E1A gene copy number or the Hexson gene copy number alone.

[0268] Table 20 Results of 5 tests conducted by two lab technicians

[0269]

[0270]

[0271] Table 21 Mean values ​​of test results from two lab technicians

[0272] Gene Experimenter 1 mean Experimenter 2 mean Mean SD CV% Hexon 8.24E+07 1.88E+08 1.35E+08 7.46E+07 55.23 E1A 211.40 481.85 346.62 191.23 55.17 Hexon / E1A 2.5847E-06 2.5789E-06 2.5818E-06 4.0604E-09 0.16

[0273] Table 22 Recovery rates of samples with high, medium, and low concentrations after three tests.

[0274]

[0275] Example 11: Limit of Quantification

[0276] As can be seen from the data in Example 10, the minimum dilution factor for samples that meet the repeatability and accuracy acceptance criteria is 10-fold. As can be seen from Example 6, the limit of quantitation for the qPCR method is 5 copies / μL. Therefore, the lowest RCA content that this method can detect is 50 copies / sample concentration.

[0277] Example 12: Specificity

[0278] The specificity of an analytical method refers to its ability to accurately and reliably determine the test sample when other components, such as impurities, degradation products, and additives (e.g., buffer solutions, excipients, stabilizers), are present in the product. In this assay, the diluent, CX buffer, and host cell lysis buffer are most likely to affect the test results. In a single test, the diluent, CX buffer, host cell lysis buffer, and test sample are measured separately, and the results for each sample are statistically analyzed. The diluent and CX buffer should not detect E1A and Hexon. The host cell lysis buffer should show detectable E1A but not Hexon. The test sample should show detectable E1A and Hexon.

[0279] The results are shown in Table 23 and meet the acceptance criteria.

[0280] Table 23 Specificity Detection of Test Samples

[0281]

[0282] Note: Und = Undetermined

[0283] Based on the disclosure of this invention, those skilled in the art can readily modify it. For example, although we have actually tested our RCA detection method using the recombinant adenovirus vector in the examples, the method can also identify contaminating viruses with replication capabilities in other adenovirus vectors (e.g., vectors containing other transgenes).

Claims

1. A method for quantitatively detecting RCA in an adenovirus AdV5 vector preparation, the method comprising the steps of: (1) obtaining a sample comprising an adenovirus AdV5 vector preparation; (2) extracting total DNA from the sample; (3) performing duplex fluorescent real-time quantitative PCR with adenovirus hexon and E1A genes as target genes to be amplified, wherein, the primer probe combination for detecting the hexon target gene is as follows: upstream primer: 5'- CGCATGTACTCCTTCTTTAGA -3', downstream primer: 5'- CTGTTGGTAGTCCTTGTATTTAG -3', probe: Hex-5'- CATCCACCACCTGACGGCTC -3'-BHQ1, and the primer probe combination for detecting the E1A target gene is selected from any one of the following a) - c): a) upstream primer: 5'-ACACCTCCTGAGATACACCCG-3', downstream primer: 5'-GCAAGTCCTCGATACATTCCACA-3', probe: FAM-5'-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1, b) upstream primer: 5'-ATAGCTGTGACTCCGGTCCTTC-3', downstream primer: 5'-AGCAAGTCCTCGATACATTCCA-3', probe: FAM-5'-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1, c) upstream primer: 5'-CTTGGGTCCGGTTTCTATGC-3', downstream primer: 5'-TTCATCCTCGTCGTCACTGG-3', probe: FAM-5'-ACCTGCCACGAGGCTGGCTTTCC-3'-TAMRA, 2. A kit for fluorescent real-time quantitative PCR detection of RCA in adenovirus AdV5 vector preparation, comprising a primer pair and a probe for specifically amplifying and detecting the adenovirus hexon gene and the E1A gene, and a positive control for drawing a standard curve, and comprising one or more of a DNA extraction reagent, a PCR reaction buffer containing Mg 2+ , a taq enzyme, a dNTP mixture, wherein, wherein the step (3) comprises drawing a standard curve using a positive control, which is a construct comprising a sequence as shown in SEQ ID NO:

21. the primer probe combination for detecting the hexon target gene is as follows: upstream primer: 5'- CGCATGTACTCCTTCTTTAGA -3', downstream primer: 5'- CTGTTGGTAGTCCTTGTATTTAG -3', probe: Hex-5'- CATCCACCACCTGACGGCTC -3'-BHQ1, a) and the primer probe combination for detecting the E1A target gene is selected from any one of the following a) - c): upstream primer: 5'-ACACCTCCTGAGATACACCCG-3', downstream primer: 5'-GCAAGTCCTCGATACATTCCACA-3', b) probe: FAM-5'-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1, upstream primer: 5'-ATAGCTGTGACTCCGGTCCTTC-3', downstream primer: 5'-AGCAAGTCCTCGATACATTCCA-3', Downstream primer: 5'-AGCAAGTCCTCGATACATTCCA-3', Probe: FAM-5'-CTGTGCCCCATTAAACCAGTTGCCG-3'-BHQ1, c) Upstream primer: 5'-CTTGGGTCCGGTTTCTATGC-3', Downstream primer: 5'-TTCATCCTCGTCGTCACTGG-3', Probe: FAM-5'-ACCTGCCACGAGGCTGGCTTTCC-3'-TAMRA, wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein the positive control is a sequence construct comprising SEQ ID NO:

21. wherein

Citation Information

Patent Citations

  • Addition of transgenes into adenoviral vectors

    CN101035901A