A porcine parvovirus and its applications

Abstract

The present invention provides a Porcine parvovirus (PPV) and its application. The Porcine parvovirus of the present invention is isolated from diseased pig tissues, named PPV-ZM2021, and the preservation number in the General Microbiology Center of the China Microbial Culture Collection Management Committee is CGMCC No. 45271. This strain can stably proliferate on passage cells and produce typical cytopathic effects. The gene of the Porcine parvovirus strain of the present invention has special mutation sites and has excellent immunogenicity; it can reach a high titer through suspension culture; the vaccine prepared with this isolate can induce pigs to produce high levels of neutralizing antibodies and has good cross-protection; at the same time, the ELISA kit prepared with this isolate can better detect Porcine parvovirus antibodies in serum.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a separated and purified porcine parvovirus and application thereof. Background Art

[0002] Porcine parvovirus (PPV) belongs to the Parvoviridae family and the genus Parvovirus. It consists of single-stranded DNA, lacks an envelope, and has a genome size of approximately 5.2 kilobases. Mature PPV virions are hexagonal or round, with typical icosahedral symmetry. The virus has a single serotype and rarely mutates. The virus is highly resistant to heat and acid and alkali. The PPV genome encodes three structural proteins: VP1, VP2, and VP3, with molecular weights of 84 kDa, 64 kDa, and 60 kDa, respectively. These proteins are the primary immunogenic antigens of PPV.

[0003] Porcine parvovirus was isolated in 1967 and its pathogenicity was first demonstrated. PPV first appeared in Europe and was isolated in my country in 1982. PPV infection can cause reproductive disorders in pigs. PPV-infected sows give birth to stillbirths, deformed fetuses, mummified fetuses, miscarriages, and sick and weak piglets. Outbreaks of the disease in pig herds are often associated with clinical manifestations such as mummified fetuses and reduced litter size. Infected and sick pigs are the source of infection for this disease, which is transmitted through the digestive tract, respiratory tract, and semen. Domestic pigs and wild boars of all ages and sexes are susceptible. Current research results show that the effects of PPV on pigs are mainly divided into two aspects: one is the effect on the sow's fertilized egg cells, and the other is the effect on fetal development. Viruses are isolated and identified by collecting fresh tissues from aborted or stillborn fetuses. With the increasing intensification of the pig farming industry, the harm caused by this disease to the pig farming industry is becoming increasingly serious.

[0004] PPV is currently an epidemic in my country. With the continuous occurrence of various porcine viral diseases, the complexity of the external environment, and the decline in pig population resistance, PPV infection has been on the rise in recent years, with an increasing number of PPV outbreaks on pig farms, causing certain harm to the pig farming industry and causing huge economic losses. The timely development of effective vaccines and diagnostic kits is of great significance for the prevention and control of this disease. Summary of the invention

[0005] The purpose of the present invention is to provide a porcine parvovirus and its partial genome sequence, as well as the use of an inactivated vaccine prepared based on the isolated strain in the prevention and control of porcine parvovirus disease.

[0006] In order to achieve the purpose of the present invention, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides a Porcine parvovirus (PPV) strain and its VP2 genomic nucleotide sequence, which sequence has special mutation sites.

[0008] In the present invention, the tissue grinding fluid of diseased pigs from a certain pig farm was inoculated into ST cells, and after cell passage, purification and identification, a Porcine parvovirus strain was obtained, named PPV-ZM2021. On September 15, 2022, it was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), and the deposit number is CGMCC No. 45271. The present invention provides the VP2 genomic sequence of the Porcine parvovirus isolate, as shown in SEQ ID No. 1.

[0009] The above-mentioned Porcine parvovirus PPV-ZM2021 can reach a high titer through suspension culture, and its proliferation on cells is stable, with a titer as high as 10 9.0 TCID 50 / 0.1 mL.

[0010] The vaccine prepared using the Porcine parvovirus isolate PPV-ZM2021 can induce pigs to produce high levels of neutralizing antibodies and has good cross-protection.

[0011] In a second aspect, the present invention provides a biological product containing the above-mentioned Porcine parvovirus strain, and the biological product is used for preventing and / or diagnosing Porcine parvovirus disease.

[0012] The biological product can be a vaccine or a diagnostic reagent.

[0013] Among them, the vaccine is a live vaccine or an inactivated vaccine.

[0014] The present invention provides an inactivated vaccine containing the isolated Porcine parvovirus. The inactivated vaccine is prepared by inoculating Porcine parvovirus PPV-ZM2021 into ST cells for passage culture, harvesting the virus solution, measuring the virus titer, inactivating, and then mixing it with an adjuvant in a weight ratio of 1:1.

[0015] The adjuvant can be any adjuvant available for animal vaccines, and the adjuvant can be made of the following components by weight percentage: 90% aqueous injection solution, 2% polyvinylpyrrolidone, 3% poly(lactic-co-glycolic acid) (PLGA), 1% polyethylene glycol 6000, 2% alkyl glycoside (decyl glucoside) (APG0816), 1% polyoxyethylene sorbitan monooleate, 1% cetyl alcohol.

[0016] The antigen content of the inactivated vaccine is not less than 10 8.0 TCID 50 / 0.1 mL, and the immunization route is intramuscular injection or nasal inoculation. Preferably, the intramuscular injection route.

[0017] The diagnostic reagent can be an ELISA kit, which includes an enzyme-labeled plate coated with the whole virus of the porcine parvovirus strain and an enzyme-labeled secondary antibody.

[0018] On this basis, other biological products containing the porcine parvovirus of the present invention for the prevention, control, and diagnosis of porcine parvovirus disease also fall within the protection scope of the present invention.

[0019] The beneficial effects of the present invention are as follows:

[0020] The inventor of the present invention isolated and passaged and purified from the diseased pig tissues of a certain pig farm in 2021 to obtain a porcine parvovirus strain, named PPV-ZM2021. This isolated strain has good proliferation on passage cells, has no obvious pathogenicity to piglets, and has excellent immunogenicity, and can induce piglets to produce high-level neutralizing antibodies, laying a solid foundation for the effective prevention and control of porcine parvovirus.

[0021] Using the porcine parvovirus PPV-ZM2021 obtained by the present invention has a fast proliferation rate and a high proliferation titer on the susceptible cell line ST, up to 10 9.0 TCID 50 / 0.1 mL; the porcine parvovirus strain PPV-ZM2021 of the present invention has low pathogenicity. The weaned piglets were challenged intranasally with 10 9.0 TCID 50 / 0.1 mL virus solution, and continuously observed for 10 days. The challenged weaned piglets had no clinical symptoms such as elevated body temperature and diarrhea, and all survived. The inactivated vaccine prepared with the strain of the present invention has good immunogenicity and can induce piglets to produce high-level neutralizing antibodies, providing important biological materials for the effective prevention and control of porcine parvovirus disease.

[0022] Establishing a serum antibody detection method is important for screening porcine parvovirus-negative pigs. ELISA has the characteristics of high sensitivity, good specificity, and batch operation, which is convenient for clinical promotion and application. The ELISA kit containing the isolated porcine parvovirus provided by the present invention can better detect the porcine parvovirus antibodies in serum, providing an important basis for the effective detection of this disease. Description of the Drawings

[0023] Figure 1 For the cultivation of the porcine parvovirus isolated strain on ST adherent cells, where A is the cytopathic effect (CPE) of the porcine parvovirus on ST cells, and B is the normal ST cell control.

[0024] Figure 2 For the amino acid variation map of the porcine parvovirus. Detailed Embodiments

[0025] The methods in the following examples are all conventional methods unless otherwise specified.

[0026] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art, and the reagents used are all commercially available products.

[0027] Example 1 Isolation of Porcine Parvovirus

[0028] 1. Collection and treatment of diseased pig tissues

[0029] Collect diseased pig tissues, cut them into small pieces, add 10 times the volume of DMEM medium containing 500 units of double antibiotics, grind them, centrifuge at 12,000 rpm for 5 min at 4°C, take the supernatant of the grinding solution, and store it at -80°C for later use.

[0030] 2. Detection of pathogens in diseased pig tissues

[0031] Take 200 μl of the supernatant of the above grinding solution, use the DNA / RNA extraction kit of Beijing TransGen Biotech Co., Ltd. to extract DNA and RNA according to the instructions; then, use the TransGen reverse transcription kit to reverse transcribe RNA into cDNA. Using the extracted DNA and reverse transcribed cDNA as templates, respectively use 9 pairs of detection primers for Porcine Parvovirus (PPV), Classical Swine Fever Virus (CSFV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Pseudorabies Virus (PRV), Porcine Circovirus Type 2 / 3 (PCV2 / PCV3), Transmissible Gastroenteritis Virus of Swine (TGEV), Porcine Epidemic Diarrhea Virus (PEDV), Porcine Deltacoronavirus (PDCoV) and TransGen 2×EasyTaq PCR SuperMix for PCR detection, and set positive and negative controls at the same time. The detection results show that the ground solution of the diseased material is positive for porcine parvovirus and negative for other pathogens.

[0032] 3. Isolation of porcine parvovirus

[0033] Make a suspension of ST cells with DMEM culture medium containing 8% fetal bovine serum (FBS), inoculate it into a 6-well cell culture plate, add the above grinding solution at a ratio of 1:10, 300 μl / well, and set a normal cell control at the same time, 2 ml / well, and place it in an incubator at 37°C and 5% CO2 for culture. Observe the cytopathic effect every day. After 5 days of culture, collect the culture and freeze-thaw it 3 times repeatedly, and centrifuge to take the supernatant. After blind passage to the 3rd generation, on the 2nd - 3rd day after inoculation, the cells showed lesions of aggregation, rounding, and detachment, as Figure 1, while the normal cells showed no lesions. At this time, the cell culture was collected. After repeated freezing and thawing 3 times, the supernatant was obtained by centrifugation, and the passage was continued to the 10th generation according to the above steps. The 10th generation product was identified by PCR. Nucleic acid was extracted according to the instructions of the Beijing Quanshijin DNA / RNA Extraction Kit. The detection primers used for PCR were: upstream primer PPV-F: TGGTCTCCTTCTGTGGTAGG; downstream primer PPV-R: CAGAATCAGCAACCTCAC. The product was electrophoresed on a 1% agarose gel, and a positive band of about 445 bp in size appeared. Thus, it was confirmed that porcine parvovirus was successfully isolated.

[0034] 4. Determination of the VP2 genome sequence of porcine parvovirus

[0035] (1) Extraction of the VP2 genome DNA of porcine parvovirus

[0036] The isolated virus was propagated and passaged in ST suspension cells. 200 μl of the 10th generation virus solution of porcine parvovirus was taken, and the viral genome was extracted using the Quanshijin EasyPure Viral DNA Kit. The specific operations were as follows:

[0037] First, add 20 μl of proteinase K to a 1.5 mL sterile centrifuge tube; add 200 μl of the virus solution to the centrifuge tube; then add 200 μl of BB5 (containing 5.6 μg of Carrier RNA), vortex for 15 s, and incubate at 56 °C for 15 min; add 250 μl of absolute ethanol, vortex for 15 s, and leave at room temperature for 5 minutes; add the solution and precipitate together into the centrifugal column, centrifuge at 12000 rpm for 1 min, and discard the effluent; add 500 μl of WB5, centrifuge at 12000 rpm for 1 min, and discard the effluent; repeat the step of adding 500 μl of WB5 for washing once; centrifuge at 12000 rpm at room temperature for 1 min to completely remove the residual ethanol; transfer the centrifugal column into a new 1.5 mL centrifuge tube, add 40 μl of water to the center of the centrifugal column, and leave at room temperature for 1 min; centrifuge at 12000 rpm at room temperature for 1 min to elute the DNA, and freeze at -80 °C for later use.

[0038] (2) The VP2 genome sequence of porcine parvovirus

[0039] Referring to the published VP2 gene sequence of porcine parvovirus on GeneBank, 2 pairs of primers were designed for the conserved region and synthesized by Beijing Sanbo Yuanzhi Biotechnology Co., Ltd. Using the above DNA as a template, the VP2 genome sequence was amplified.

[0040] The PCR reaction program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min 30 s, for 35 cycles. The amplified products were subjected to 1% agarose gel electrophoresis, and the target bands were excised, recovered, purified, and then sent to Beijing Boshang Biotechnology Co., Ltd. for sequencing. The porcine parvovirus VP2 genomic sequences were obtained by splicing of each fragment, as shown in SEQ ID No. 1.

[0041] The nucleic acid sequence of the porcine parvovirus VP2 genome obtained by splicing was aligned with the existing vaccine strain (GenBank accession number: AY583318.1), and the nucleotide homology was 98.1%, and there were special gene mutation sites; the deduced amino acid sequence of the porcine parvovirus VP2 genome obtained by splicing was aligned with the deduced amino acid sequence of the vaccine strain (GenBank accession number: AY583318.1) genome, and it was found that the deduced amino acid homology was 97.8%, and there were 5 special amino acid mutation sites ( Figure 2 ). Therefore, this strain was determined to be a new porcine parvovirus.

[0042] The isolated virus was propagated and passaged in ST suspension cells. The porcine parvovirus was continuously passaged to the 11th generation. After culturing for 24 hours, obvious cytopathic effects were observed. After being identified as positive, a porcine parvovirus strain was obtained by large-scale culture, named PPV-ZM2021, and on September 15, 2022, it was deposited in the China General Microbiological Culture Collection Center (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing), and the deposit number was CGMCC No. 45271.

[0043] The porcine parvovirus was inoculated into ST adherent cells for culture, and typical cytopathic effects appeared after 24 - 36 hours, such as Figure 1 . When the cytopathic effects reached about 80%, the culture was harvested and freeze-thawed 3 times. According to the Reed & Muench method, the virus titer was determined to be 10 9.0 TCID 50 / 0.1 mL.

[0044] Example 2 Cross-hemagglutination inhibition (HI) assay of porcine parvovirus PPV-ZM2021

[0045] Hemagglutinin: Antigens were prepared from the virus seeds used for the production of PPV-ZM2021 and the inactivated vaccine strain of porcine parvovirus disease PPV WH-1 strain (inactivated vaccine against porcine parvovirus disease WH-1 strain).

[0046] Guinea pig sera to be detected: Guinea pig sera on day 28 that were respectively inoculated with PPV-ZM2021, commercial inactivated porcine parvovirus vaccine A (strain WH-1, batch number: B20220202), commercial inactivated porcine parvovirus vaccine B (strain S-1, batch number: CK2112016), self-made inactivated vaccine C (PPV-ZM2021 strain, 9 g of colloidal water adjuvant self-made by China Animal Husbandry was weighed and mixed with the antigen in equal volume, and shaken well. See Example 4 for the specific self-making method), and PBS.

[0047] Two hemagglutinins for preparing 4 units of HA were respectively subjected to hemagglutination inhibition test with guinea pig sera after treatment at different dilutions to determine the HI titer.

[0048] The results showed that there were significant differences in the HI titers of the same immune sera against the two hemagglutinins (see Table 1 below in detail). Since there is a positive correlation between the HI titer and the challenge protection, there should be significant differences in the challenge protection effects of the vaccines against the two strains.

[0049] Among the immune sera, the HI of the animal sera of the self-made inactivated vaccine C was the highest, and the HI titer against the PPV-ZM2021 strain was the highest, being 13 - 14 log2 and having good stability.

[0050] Table 1. Porcine parvovirus cross HI test

[0051]

[0052]

[0053] Example 3 Pathogenicity experiment of porcine parvovirus PPV-ZM2021

[0054] Nine 40-day-old piglets negative for porcine parvovirus pathogen and antibody were screened and randomly divided into 3 groups, with 3 piglets in each group. The experimental groups were challenged by nasal and intramuscular routes. Each pig was respectively inoculated nasally with 2 ml of 10 9.0 TCID 50 / 0.1 mL F11 passage virus solution, and intramuscularly injected with 1 ml of 10 9.0 TCID 50 / 0.1 mL F9 passage porcine parvovirus PPV-ZM2021 virus solution; each pig in the control group was respectively inoculated nasally with an equal volume of sterile PBS solution.

[0055] The pigs were continuously observed for 10 days. The status of the pigs was observed daily, the rectal temperature was measured and recorded. The body temperatures of both the experimental groups and the control group fluctuated within the normal range. The clinical symptoms were observed. The pigs in both the experimental groups and the control group had normal appetites, no diarrhea occurred, and no pigs died, and all survived. The above data indicated that the porcine parvovirus isolate PPV-ZM2021 had no obvious pathogenicity to piglets.

[0056] Before virus challenge (day 0) and on days 3, 5, 7, and 10 after virus challenge, blood samples and double rectal swabs were collected from each pig in the virus-challenged group and the control group. Serum was separated, and virusemia and virus shedding were detected by PCR. The results of virusemia detection are shown in Table 2. The results of virus shedding detection are shown in Table 3. The data showed that virusemia and virus shedding occurred in the virus-challenged pigs on day 3, and neither virusemia nor virus shedding occurred after day 10.

[0057] Table 2. Results of virusemia detection before and after virus challenge

[0058]

[0059]

[0060] Table 3. Results of fecal virus shedding detection before and after virus challenge

[0061]

[0062] The data from the virus challenge experiment showed that there were no obvious clinical symptoms in piglets infected with the isolated strain PPV-ZM2021 of the present invention.

[0063] Application of the isolated strain PPV-ZM2021 in the preparation of inactivated porcine parvovirus vaccine

[0064] 1. Preparation of inactivated porcine parvovirus vaccine

[0065] The isolated strain PPV-ZM2021 was inoculated into ST cells at 1% of the culture volume for continuous passage. The virus solution was harvested, repeatedly frozen and thawed 3 times, and then centrifuged to collect the supernatant. The virus titer was measured. The virus titer was 10 8.0 TCID 50 / 0.1 mL. After passing the sterility and exogenous virus tests, formaldehyde with a final concentration of 0.1% was added for inactivation. An adjuvant (there are two types of adjuvants, A and B: Adjuvant A is a colloidal water adjuvant self-produced by China Animal Husbandry Industry Co., Ltd. (formula (“%” refers to weight percentage): 90% aqueous injection solution, 2% polyvinylpyrrolidone, 3% poly (lactic-co-glycolic acid) (PLGA), 1% polyethylene glycol 6000, 2% alkyl glycoside (decyl glucoside) (APG0816), 1% polyoxyethylene sorbitan monooleate, 1% cetyl alcohol), and Adjuvant B is 201VG from SEPPIC) was added in a volume ratio of 1:1 to the virus solution and mixed well.

[0066] Vaccine preparation method:

[0067] Inactivated vaccine group A: Weigh 60 g of the colloidal water adjuvant self-produced by China Animal Husbandry Industry Co., Ltd., mix it with the antigen in equal volume, and shake well.

[0068] Inactivated Vaccine of Group B: Weigh 60 g of 201VG from SEPPIC, preheat it to 32 °C, and preheat the antigen to 32 °C as well. Mix an equal volume of water into 201VG and shake well.

[0069] 2. Vaccine Safety Test

[0070] Select 12 piglets about 30 days old that are negative for porcine parvovirus pathogen and antibody, and randomly divide them into 4 groups with 3 piglets in each group. In experimental group A, inject 2 doses (4 ml) of inactivated vaccine of group A by intramuscular multi-point injection, and give a second vaccination after 14 days; in control group A, inject an equal volume of sterile PBS solution by intramuscular multi-point injection, and give a second vaccination with PBS after 14 days; in experimental group B, inoculate 2 doses (4 ml) of inactivated vaccine of group B by intramuscular injection, and give a second vaccination after 14 days; in control group B, inoculate an equal volume of sterile PBS by intramuscular injection, and give a second vaccination with PBS after 14 days. Observe continuously for 21 days. The results show that there are no significant differences in the mental state, body temperature and daily weight gain of piglets in experimental groups A and B compared with the control group, and no adverse reactions occur.

[0071] 3. Vaccine Efficacy Test

[0072] Select 12 weaned piglets that are negative for porcine parvovirus pathogen and antibody, and randomly divide them into 4 groups with 3 piglets in each group. In experimental group A, inject 1 dose (2 ml) of inactivated vaccine of group A by intramuscular injection, and in control group A, inject an equal volume of sterile PBS solution by intramuscular injection; in experimental group B, inject 1 dose (2 ml) of inactivated vaccine of group B by intramuscular injection, and in control group B, inject an equal volume of sterile PBS solution by intramuscular injection. Observe continuously for 28 days. Collect blood at 7 days, 14 days, 21 days and 28 days, separate the serum, inactivate it at 56 °C for 30 min, and measure the porcine parvovirus neutralizing antibody. After 28 days, give a second immunization, observe continuously for 14 days, collect blood at 35 days and 42 days, separate the serum, inactivate it at 56 °C for 30 min, and measure the porcine parvovirus neutralizing antibody. The results of neutralizing antibody detection (as shown in Table 4) show that the inactivated vaccine prepared by passage of the strain PPV-ZM2021 of the present invention can produce high-level neutralizing antibodies 42 days after immunization, and has good immunogenicity. Among them, the neutralizing antibody level produced by group A is higher, and it is the preferred inactivated vaccine adjuvant.

[0073] Table 4. Results of Neutralizing Antibody Detection after Immunization with Inactivated Vaccine

[0074]

[0075]

[0076] Application of Isolate PPV-ZM2021 in the Preparation of Indirect ELISA Detection Kit in Example 5

[0077] 1. Propagate the PPV-ZM2021 virus isolate for standby.

[0078] The PPV-ZM2021 virus was amplified using ST cells. When obvious cytopathic effects appeared in the cells, the virus was harvested and stored at -80°C, and repeatedly frozen and thawed 3 times. Then, it was centrifuged at 6000 r / min for 5 min to remove cell debris. The virus was purified by sucrose density gradient centrifugation. The purified virus was diluted with PBS, and the protein concentration was measured.

[0079] 2. Specific steps of indirect ELISA.

[0080] (1) Coating with whole virus antigen: The purified whole virus was used as the coating antigen. The antigen and serum were serially diluted, and the optimal coating concentration of the virus and the optimal serum dilution were determined using the checkerboard titration method. The optimal coating concentration of the virus was 2.50 μg / ml, and the optimal serum dilution was 1:100.

[0081] The purified virus was diluted with the coating buffer, and 100 μL per well was used to coat the ELISA plate and incubated overnight at 4°C.

[0082] (2) Discard the coating buffer, wash 3 times with PBS, add 200 μL of 5% skim milk powder to each well, and incubate at 37°C for 2 hours. Discard the skim milk, and then wash 3 - 5 times with PBST, 3 - 5 minutes each time.

[0083] (3) Dilute the serum to be tested with PBS, then add 100 μL to each well, incubate at 37°C for 1 hour, and set negative and positive serum controls simultaneously. Discard the liquid, and wash 3 - 5 times with PBST, 3 - 5 minutes each time.

[0084] (4) Determine the optimal conditions for the secondary antibody: The optimal dilution of the secondary antibody was 1:10000, and the optimal incubation time was 45 minutes.

[0085] Add the diluted horseradish peroxidase-labeled anti-pig IgG secondary antibody, 100 μL per well, and incubate at 37°C for 1 hour. Discard the secondary antibody, and wash 3 - 5 times with PBST, 3 - 5 minutes each time.

[0086] (5) Add 100 μL of TMB chromogenic solution to each well and develop color in the dark for 15 minutes.

[0087] (6) Add 50 μL of the termination solution 2M H2SO4 to each well and read the OD450 value. Negative and positive critical values: OD ≥ 0.575 is judged as positive, OD < 0.354 is judged as negative, and 0.354 ≤ OD < 0.575 is suspicious.

[0088] The results of the negative and positive serum controls were valid. Fifteen porcine sera were randomly tested. [[ID=3۳]]

[0089] Simultaneously, the neutralization test was used for synchronous detection, and the specific method was as follows:

[0090] Inactivate the serum to be tested at 56 °C for 30 minutes. Dilute the serum to be tested from 1:4 to 1:64, with 3 replicates for each dilution, add 50 μL to each well, and set up positive and negative controls. Add 50 μL of the virus solution with 100 TCID 50 per well to each well except the control wells. Incubate in a 37 °C incubator with 5% carbon dioxide for 1 h. Dilute to 2×10 5 / mL to 3×10 5 / mL of ST cell suspension, add 100 μL per well to each test well after neutralization, and incubate in a 37 °C incubator with 5% carbon dioxide for 48 h to 72 h, observing CPE every day. The results of the positive and negative controls are valid, and the antibody detection results of 15 porcine sera are shown in Table 5. Note: If lesions appear in the serum to be tested at 1:8, it is judged as positive; 1:4 is judged as suspicious; <1:4 is judged as negative.

[0091] 3. The antibody detection results of porcine sera are shown in Table 5.

[0092] 4. Conclusion: The results of detecting porcine serum antibodies with the indirect ELISA kit are consistent with those detected by the neutralization test simultaneously, indicating that the method of detecting porcine serum antibodies with the indirect ELISA kit is valid.

[0093] Table 5. Results of Detecting Porcine Serum Antibodies with the Indirect ELISA Kit

[0094]

[0095] Note: "+" represents positive; "-" represents negative.

[0096] Although the present invention has been described in detail with general descriptions and specific embodiments above, on the basis of the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. A porcine parvovirus ( Porcine parvovirus ) strain, characterized in that: The name of the porcine parvovirus strain is PPV-ZM2021, and the preservation number of the porcine parvovirus strain is CGMCC No. 45271.

2. A biological product containing the porcine parvovirus strain described in claim 1, the biological product being used for preventing or diagnosing porcine parvovirus disease; the biological product is a vaccine or a diagnostic reagent.

3. The biological product according to claim 2, characterized in that: The vaccine is a live vaccine or an inactivated vaccine, and the vaccine further includes a pharmaceutically acceptable adjuvant.

4. The biological product according to claim 2, wherein: The diagnostic reagent is an ELISA kit, which includes an enzyme-labeled plate coated with the whole virus of the porcine parvovirus strain described in claim 1 and an enzyme-labeled secondary antibody.

5. Use of the porcine parvovirus strain described in claim 1 in the preparation of a vaccine for preventing porcine parvovirus disease.

6. Use of the porcine parvovirus strain described in claim 1 in the preparation of a reagent for diagnosing porcine parvovirus disease.

7. The application according to claim 6, characterized in that: The reagent is an ELISA kit.

8. The application according to claim 7, wherein: The reagent is an ELISA kit for detecting porcine parvovirus antibodies in serum.

Images