Application of CLE42 small peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter

Abstract

The present invention discloses the application of CLE42 small peptide in controlling plant bud regeneration and as a plant tissue culture proliferation regulator, and belongs to the field of plant biotechnology. The present invention finds that CLE42 small peptide has the application of controlling plant bud regeneration or as a plant tissue culture proliferation regulator, and can improve the bud regeneration ability in plant tissue culture by overexpressing CLE42 gene through gene editing or transgenic, or improve the bud regeneration ability in plant tissue culture by adding artificially synthesized CLE42 small peptide to tissue culture medium.

Description

Technical Field

[0001] The invention belongs to the field of plant biotechnology, and specifically relates to a small peptide that can regulate plant reprogramming, bud regeneration, and promote plant explant bud proliferation ability, and its application as a plant tissue culture proliferation promoter. Background Art

[0002] Tissue culture is one of the commonly used plant biotechnology methods to achieve asexual reproduction and large-scale propagation of plants. Specifically, under sterile culture conditions, by adjusting the type, content and ratio of plant hormones in the culture medium, mainly including auxins and cytokinins, suitable explants are induced to form embryonic callus, and further undergo callus proliferation and differentiation processes to obtain high-quality regenerated buds. The regenerated buds take root under the action of suitable growth regulators, generally high-concentration cytokinins, and finally a large number of regenerated seedlings are obtained through seedling training and other steps. Obtaining high-quality regenerated buds is a key link that affects the success or failure of plant tissue culture.

[0003] The bud regeneration process commonly used in tissue culture needs to go through two stages: the first step is to form pluripotent embryonic callus under the induction of high concentrations of auxin, and the second step is to initiate bud regeneration under the induction of high concentrations of cytokinin. The bud regeneration process is related to the activity of plant stem cells, but it is different from the development of shoot apical meristem and root apical meristem. It is related to factors such as plant species, genotype, explant type, culture conditions and growth regulators, but the specific regulatory mechanism is still unclear. For tissue culture production, studying new plant regulators that affect bud regeneration has broad application value.

[0004] In addition, genotype is also an intrinsic factor that affects plant callus formation and bud regeneration. Discovering the main and functionally conserved genes that regulate plant bud regeneration and manipulating the expression activity of genes through genetic engineering is a feasible biotechnology means to improve plant bud regeneration ability.

[0005] Growth regulators generally refer to plant hormones. A class of CLAVATA3 / EMBRYO SURROUNDING REGION-RELATED (CLE) peptides with conserved sequences and functions are commonly found in higher plants, referred to as CLE peptides, which are considered to be a new type of polypeptide plant hormone. The known function of CLE peptides is to maintain the activity of stem cells in the meristem region of plants. Currently, CLV3 is the most clearly studied. Arabidopsis CLE42 is encoded by the CLE42 gene (AT2G34925), and is a mature peptide generated after translation and splicing. Its amino acid sequence is "HGVPSGPNPISN". Existing studies have shown that CLE42 controls the activity of procambium cells, inhibits xylem differentiation, and regulates the occurrence of lateral buds in plants. In addition, what other physiological functions they have have not been publicly reported.

[0006] Obtaining high-quality regenerated buds is a key link that affects the success or failure of plant tissue culture. Plant hormones act as growth regulators and play a vital role in the bud regeneration process. Even if factors such as the type, content, and ratio of plant hormones in the culture medium are adjusted, some plants still have difficulty regenerating buds. For tissue culture production, studying the regulatory mechanisms that affect bud regeneration, discovering regulatory genes, and developing new plant regulators have broad application value. Summary of the invention

[0007] The purpose of the present invention is to provide the use of CLE42 small peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter.

[0008] The present invention found that compared with the wild type, the number of bud regeneration in CLE42 overexpressing plants was significantly increased, indicating that CLE42 is a positive regulatory factor controlling Arabidopsis bud regeneration.

[0009] The present invention found that compared with the control (without exogenously applied small peptide), exogenously applied artificially synthesized CLE42 small peptide significantly promoted the number of regenerated buds formed by Arabidopsis hypocotyl explants on shoot induction medium (SIM), indicating that the new function of this type of conservative small peptide hormone in promoting plant bud regeneration is of universal significance in higher plants.

[0010] Based on the above findings, the present invention provides the use of CLE42 small peptide in promoting plant bud regeneration. The promotion of plant bud regeneration is to improve the bud regeneration ability of plants in tissue culture.

[0011] In some embodiments, the CLE42 encoding gene can be knocked in by gene editing or overexpressed by transgenics to achieve the purpose of enhancing gene expression activity and improving the plant's ability to regenerate shoots in tissue culture.

[0012] In some embodiments, the shoot regeneration ability of plants in tissue culture can be improved by adding CLE42 small peptides to the tissue culture medium.

[0013] The present invention also provides the use of CLE412 small peptide as a plant tissue culture proliferation regulator, which specifically improves the bud regeneration ability of plants in tissue culture by adding CLE412 small peptide into the tissue culture medium.

[0014] The present invention also provides a method for promoting plant shoot regeneration in tissue culture, which comprises using a tissue culture medium containing the CLE42 small peptide for tissue culture.

[0015] In some embodiments, the plant is a plant containing a gene encoding a CLE42 peptide or a homologous protein thereof.

[0016] In some embodiments, the plant is Arabidopsis thaliana.

[0017] In some embodiments, the amino acid sequence of the above-mentioned CLE42 small peptide is: HGVPSGPNPISN (SEQ ID NO.1).

[0018] In some embodiments, the nucleotide sequences of the genes encoding the above CLE42 small peptides are as follows:

[0019] CLE42 gene: ATGAGATCTCCTCACATCACCATTTCACTTGTTTTCTTGTTCTTTCTTTT TCTAATCATCCAAACCCATCAAAGAACCATTGATCAAACTCACCAGATTGGCTCCAATGTTCAACATGTCAGTGACATGGCGGTGACTTCGCCTGAAGGGAAAAGAAGAGAGAGGTTT AGAGTTCGGCGGCCGATGACGACATGGCTGAAGGGAAAGATGATCGGTGCCAATGAACATGGAGTCCCAAGTGGTCCAAATCCCATCTCCAATAGGTAG (SEQ ID NO. 2).

[0020] The advantages of the present invention are:

[0021] (1) The present invention discovered a new function of CLE42 in promoting plant bud regeneration.

[0022] (2) As plant gene editing technology matures, more and more plant genomes are sequenced, making it feasible to knock out, knock in, or overexpress genes in different plants. Knocking in or overexpressing the CLE42 peptide will significantly improve the ability of plant bud regeneration during tissue culture. This application is particularly important for plants that have difficulty regenerating buds from callus.

[0023] (3) The advantages of artificially synthesized CLE42 small peptide are: easy to obtain, easy to store, easy to prepare, and low cost. The above artificially synthesized small peptide is added to the tissue culture medium as a promoting growth regulator to obtain an appropriate amount of high-quality regenerated buds. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the gene expression detection of CLE42 overexpression material. Real-time fluorescence quantitative PCR (RT-qPCR) is used to detect the target gene expression level of overexpression transgenic material. WT and 35S:CLE42 are wild-type Arabidopsis and CLE42 overexpression transgenic materials respectively.

[0025] Figure 2 The figure shows the number of regenerated shoots of CLE42 overexpression materials and wild type. Col-0 is wild type Arabidopsis and is the control. 35S:CLE42 is the CLE42 overexpression transgenic material. (A) Phenotypic diagram. (B) Statistical diagram. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (****P<0.0001).

[0026] Figure 3 The figure shows the number of regenerated shoots after exogenous application of artificial synthetic CLE42 peptide. Asterisks represent significant differences. Statistical methods: Dunnett's multiple comparison test, one-way ANOVA (*P<0.05, **P<0.01, ****P<0.0001). DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0028] Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art; the experimental methods used are all conventional methods and can be carried out according to the described recombinant technology (see Molecular Cloning Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York); the materials, reagents, etc. used can all be obtained from commercial channels.

[0029] The culture medium and culture conditions used for tissue culture in the following examples are as follows: the CIM medium formula is: 4.4g MS basic salt (containing vitamins); basal medium with vitamins, 0.5g / L methylestersulfonate, 20g / L sucrose, 2.2mM 2,4-D, 0.2mM kinetin and 8g / L agar, pH 5.7; the SIM medium formula is: 4.4g MS basic salt (containing vitamins), 0.5g / L methylestersulfonate, 20g / L sucrose, 5mM kinetin, 0.9mM indole-3-acetic acid and 8g / L agar, pH 5.7; the culture temperature is 22°C, and the photoperiod is 16h light / 8h dark.

[0030] Example 1 Compared with the wild type, the shoot regeneration ability of CLE42 overexpressing plants was significantly enhanced.

[0031] The 35S strong promoter was used to drive CLE42 to obtain transgenic overexpression materials. The regenerated shoot phenotype of the overexpression materials was investigated.

[0032] The method for creating CLE42 overexpression plants involved in Example 1 is as follows: the genomic fragment containing the CLE42 5'-end and 3'-end regulatory elements is amplified by PCR, and then cloned into the pPLV26 vector containing the 35S promoter (De Rybel B, van den Berg W, Lokerse AS, et al. A versatile set of ligation-independent cloning vectors for functional studies in plants [J]. Plantphysiology, 2011, 156 (3): 1292-1299.) by Gibson homologous recombination method, and the sequence fidelity is confirmed by sequencing to obtain the 35S: CLE42 overexpression vector. After the vector is transformed into Agrobacterium, it is transformed into Arabidopsis by the inflorescence dip method, and the expression level of the target gene of the obtained transgenic family is detected by RT-qPCR, and finally a stable CLE42 overexpression transgenic family is obtained. The RT-qPCR detection results are shown in Figure 1 In the CLE42 overexpression transgenic materials, the expression level of the CLE42 gene was significantly increased.

[0033] The cloning primer sequences are:

[0034] CLE42-OE-F: 5'-AGGACACGGGGCCCCTCGAGATGAGATCTCCTCACATCACC-3',

[0035] CLE42-OE-R: 5'-TGAACGATCGGGGATCGGATCCCTACCTATTGGAGATGGGATTTG -3'.

[0036] The RT-qPCR primer sequences are as follows:

[0037] qRTCLE42-F:ACTTCGCCTGAAGGGAAAAG,

[0038] qRTCLE42-R:ATTGGCACCGATCATTCTTTC.

[0039] After 7 days of dark culture, 1 cm hypocotyls of CLE42 overexpressing transgenic materials were taken as explants. After the explants were transferred to CIM medium, culture was continued for 7 days until callus was formed. The callus was transferred to SIM medium and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph and count the number of regenerated buds of each explant callus. A regenerated bud was defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that overexpression of the CLE42 gene significantly promoted the formation of regenerated buds in Arabidopsis hypocotyl explants on SIM medium ( Figure 2 ).

[0040] Example 2 Exogenous application of artificially synthesized CLE42 small peptide promotes Arabidopsis thaliana shoot regeneration.

[0041] The amino acid sequence of the mature peptide of Arabidopsis CLE42 is "HGVPSGPNPISN", which can be obtained by artificial synthesis. The above genetic evidence shows that the accumulation level of CLE42 in Arabidopsis (plant) is positively correlated with the ability of bud regeneration. Therefore, in theory, the application of artificially synthesized small peptides in SIM medium will promote the bud regeneration ability of wild-type Arabidopsis.

[0042] Based on this, wild-type Arabidopsis seedlings were cultured in the dark for 7 days, and 1 cm hypocotyls were taken as explants. After the explants were transferred to CIM medium, they were cultured for another 7 days until callus was formed. The calli were transferred to SIM medium containing 10 μM CLE42 and cultured for another 21 days. A Nikon SMZ745T stereo microscope was used to observe, photograph, and count the number of regenerated buds in each explant callus. A regenerated bud is defined as a meristem-like structure surrounded by 3 leaves. All experimental data were collected with 3 biological replicates. The results showed that exogenous application of artificially synthesized CLE42 peptides significantly promoted Arabidopsis bud regeneration ( Figure 3 ). Therefore, the shoot regeneration ability of plants in tissue culture can be improved by adding artificially synthesized CLE42 small peptides to the tissue culture medium.

[0043] In summary, these in vivo genetic evidence, i.e., the results of the phenotypic analysis of the regenerated shoots of the overexpressing material and the exogenous application of the CLE42 peptide, indicate that the CLE42 peptide is a regulatory factor that promotes shoot regeneration. Their amino acid sequences are evolutionarily conserved in higher plants. From the perspective of plant phylogenetic analysis, the present invention provides an implementation method for improving the efficiency of regenerated shoots in tissue culture of different plants by genetic manipulation and exogenous application of artificially synthesized CLE42 peptides.

[0044] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. Sequence Listing <110> Shaanxi Normal University Hubei Medical College <120> Application of CLE42 small peptide in promoting plant bud regeneration and as a plant tissue culture proliferation promoter <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 12 <212> PRT <213> Arabidopsis thaliana <400> 1 His Gly Val Pro Ser Gly Pro Asn Pro Ile Ser Asn 1 5 10 <210> 2 <211> 267 <212> DNA <213> Arabidopsis thaliana <400> 2 atgagatctc ctcacatcac catttcactt gttttcttgt tctttctttt tctaatcatc 60 caaacccatc aaagaaccat tgatcaaact caccagattg gctccaatgt tcaacatgtc 120 agtgacatgg cggtgacttc gcctgaaggg aaaagaagag agaggtttag agttcggcgg 180 ccgatgacga catggctgaa gggaaagatg atcggtgcca atgaacatgg agtcccaagt 240 ggtccaaatc ccatctccaa taggtag 267

Claims

1. Application of CLE42 small peptide in promoting plant bud regeneration, characterized in that: The amino acid sequence of the CLE42 small peptide is: HGVPSGPNPISN; The application is: improving the bud regeneration ability of plants in tissue culture by enhancing the expression activity of the CLE42 small peptide; Or the application is: improving the bud regeneration ability of plants in tissue culture by adding CLE42 small peptide to the tissue culture medium.

2. The use of CLE42 small peptide as a plant tissue culture proliferation regulator, characterized in that: The amino acid sequence of the CLE small peptide is: HGVPSGPNPISN; The application is: improving the bud regeneration ability of plants in tissue culture by adding CLE42 small peptide to the tissue culture medium.

3. A method for promoting plant shoot regeneration in tissue culture, characterized in that: The invention uses a tissue culture medium containing a CLE42 small peptide for tissue culture; the amino acid sequence of the CLE42 small peptide is: HGVPSGPNPISN.

4. The use according to claim 1 or 2 or the method according to claim 3, characterized in that: The plant is a plant containing a gene encoding a CLE42 small peptide or a homologous protein thereof.

5. The use according to claim 1 or 2 or the method according to claim 3, characterized in that: The plant is Arabidopsis thaliana.

Images