A Hepatocyte detection kit and its preparation method and application

By designing a Hepatocyte detection kit with a dual-probe capture system and signal amplification system, the problems of insufficient sensitivity and accuracy in existing detection methods are solved, and high-sensitivity, high-specificity and high-stability Hepatocyte detection is achieved, which is suitable for the diagnosis, prognosis and treatment of HCC.

CN115992227BActive Publication Date: 2025-09-19SUREXAM BIO TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111222814.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-10-20
Publication Date
2025-09-19
Estimated Expiration
2041-10-20

AI Technical Summary

Technical Problem

Existing hepatocyte detection methods have deficiencies in sensitivity and accuracy. In particular, the detection process of immunohistochemistry and immunofluorescence staining does not involve signal amplification, which limits the sensitivity and accuracy of the detection. Real-time quantitative PCR has high requirements for the environment and operation, making it difficult to ensure the accuracy of the test results.

Method used

A Hepatocyte detection kit was designed, which adopts a dual-probe capture system and signal amplification system, including a capture probe and an amplification probe targeting CPS1 gene mRNA. The capture probe and the labeling probe modified with hexitol nucleic acid achieve high sensitivity, high specificity and high stability detection.

Benefits of technology

It improves the sensitivity and specificity of detection, reduces nonspecific fluorescence signals, shortens detection time, provides a higher signal-to-noise ratio and accuracy, and is suitable for the application of Hepatocyte in the diagnosis, prognosis and treatment of HCC.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115992227B_ABST
    Figure CN115992227B_ABST
Patent Text Reader

Abstract

The present invention relates to a Hepatocyte detection kit, characterized in that it comprises a capture probe for CPS1 gene mRNA and a signal amplification system. By designing the capture probe composition structure, the capture probe is designed as a dual-probe system and an HNA sequence modification is introduced, thereby ensuring high sensitivity, high specificity, high efficiency and high stability of capture probe hybridization, so that the capture probe in the kit of the present invention can be well applied to the probe detection system of the present invention, while improving the detection sensitivity, specificity and stability while shortening the detection time; by optimizing the introduction of multiple groups of P5 sequences at the 5' end and 3' end of the amplification probe in the signal amplification system and introducing PNA sequence modification into the labeling probe, the signal amplification system in the kit of the present invention has a more efficient signal amplification function, while improving the signal-to-noise ratio and accuracy of the detection, and further shortening the detection time.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a Hepatocyte detection kit and a preparation method and application thereof. Background Art

[0002] Hepatocyte, or hepatocyte-specific antigen, and its antibody, Hepatocyte paraffin 1 (HepPar 1), were obtained by Wennerberg et al. in 1993 from conventional formalin-fixed, paraffin-embedded liver tissue from failed liver transplants. This monoclonal antibody reacts with both normal and tumorous hepatocytes. In 2008, Butler et al. demonstrated that the antigen for HepPar 1 is carbamyl phosphate synthetase 1 (CPS1), a urea cycle rate-limiting enzyme in hepatocyte mitochondria. This suggests that hepatocytes are actually CPS1.

[0003] Hepatocytes are an important marker for the diagnosis and prognosis of hepatocellular carcinoma (HCC). Studies have found that HepPar 1 antibodies are positive in normal liver tissue cells and most HCCs, but are mostly negative in other normal adult tissues (such as skin, smooth muscle, skeletal muscle, mesothelium, lymph nodes, spleen, lung, breast, esophagus, stomach, intestine, pancreas, kidney, etc.) and various other adult malignant tumors (such as biliary tumors, breast cancer, colon cancer, esophageal cancer, lung cancer, ovarian cancer, etc.) (Wennerberg AE et al., Am J Pathol, 1993, 143, 1050-1054). This study shows that hepatocytes are expressed in normal liver tissue and most HCCs, but are not expressed or are expressed less in other normal adult tissues and malignant tumors, suggesting that hepatocytes may be used for the differential diagnosis of hepatocellular carcinomas. In the literature, the sensitivity of Hepatocytes in the differential diagnosis of HCC is 54.7% to 96%, and the specificity is 98.1% to 100%; among them, the sensitivity and specificity of Hepatocytes in distinguishing HCC from metastatic adenocarcinoma are 95.6% and 98.1%, respectively (Karabork A et al., Pathol Res Pract, 2010, 206: 572-577). In addition, studies have reported that HepPar 1 expression is negatively correlated with HCC TNM stage, and high HepPar 1 expression is associated with better overall survival and better recurrence-free survival in HCC patients (Jin Y et al., J Invest Surg. 2018, 31: 412-419). This study shows that high Hepatocyte expression indicates a better prognosis for HCC patients.

[0004] In the study of circulating tumor cells (CTCs), hepatocytes are often used as a marker for HCC CTCs and are used to identify HCC CTCs. Studies have found that immunofluorescence staining combined with HepPar 1 or CPS1 antibodies can improve the sensitivity and specificity of HCC CTC detection (Liu HY et al., World J Gastroenterol, 2015, 21:2918-2925). The positive rate and number of CTCs detected by this method are significantly correlated with HCC tumor size, portal vein tumor thrombus, degree of differentiation, and disease extent according to TNM staging and Milan grade (Xu W et al., Clin Cancer Res, 2011, 17:3783-3793).

[0005] Currently, the methods reported in the literature for hepatocyte detection mainly include immunohistochemistry and immunofluorescence staining. Both of these methods use HepPar 1 or CPS1 antibodies to detect hepatocyte expression at the protein level. However, these methods have certain shortcomings in practical applications. For example, the detection process does not involve signal amplification, which to a certain extent limits the sensitivity and accuracy of the detection; and the interpretation of the results is highly subjective. In addition, real-time quantitative PCR detects hepatocyte expression at the genetic level by detecting the expression level of the CPS1 gene mRNA. This method has the advantages of high sensitivity and strong sequence specificity. However, the real-time quantitative PCR process has high requirements for the environment and operation, and contamination must be strictly prevented, otherwise it is difficult to ensure the accuracy and reliability of the test results. Summary of the Invention

[0006] Based on this, one of the objects of the present invention is to provide a Hepatocyte detection kit with high detection specificity.

[0007] Including the following technical solutions:

[0008] A Hepatocyte detection kit includes a capture probe for CPS1 gene mRNA and a signal amplification system. The capture probe adopts a dual-probe capture system, including capture probe CP1 and capture probe CP2. The capture probe CP1 is composed of a P1 sequence, a spacer arm sequence, and a P2 sequence from the 5' end to the 3' end; the capture probe CP2 is composed of a P3 sequence, a spacer arm sequence, and a P4 sequence from the 5' end to the 3' end. The P1 and P4 sequences are 10 to 14 bp in length; the P2 and P3 sequences are 16 to 20 bp in length and specifically bind to the target mRNA.

[0009] The signal amplification system includes an amplification probe and a labeling probe. The amplification probe connects the capture probe and the labeling probe, and its components from the 5' end to the 3' end are: P5' sequence, spacer arm sequence, P6 sequence, spacer arm sequence, P7 sequence, spacer arm sequence, P5" sequence; the P5' sequence is n1 groups of P5 sequences connected in sequence, n1 is an integer from 0 to 10, and the P5 sequence is 18 to 22 bp in length; the P5" sequence is n2 groups of P5 sequences connected in sequence, n2 is an integer from 0 to 10, and the P5 sequence is 18 to 22 bp in length; the P6 sequence is complementary to the P4 sequence; the P7 sequence is complementary to the P1 sequence; the labeling probe connects the amplification probe and the fluorescent group, and its components from the 5' end to the 3' end are: P8 sequence, fluorescent group; the P8 sequence is complementary to the P5 sequence;

[0010] The capture probe and / or labeling probe is modified with hexitol nucleic acid.

[0011] One of the purposes of the present invention is to provide the use of the above-mentioned Hepatocyte detection kit in the detection, classification, prediction, treatment monitoring, prognosis or other evaluation of hepatocellular carcinoma.

[0012] One of the purposes of the present invention is to provide a Hepatocyte detection method for non-disease diagnosis purposes.

[0013] Including the following technical solutions:

[0014] (1) Obtaining a biological sample;

[0015] (2) Enriching the cells to be tested;

[0016] (3) pre-treating the enriched cells to be tested to expose the mRNA of the cells to be tested;

[0017] (4) Use the above kit to detect whether CPS1 gene mRNA exists in the cells to be tested.

[0018] Based on in-depth research on fluorescence in situ hybridization technology and hepatocyte (hepatocyte-specific antigen), the inventors of the present invention have developed a kit for in situ detection of CPS1 gene mRNA, which includes multiple probes such as capture probes, amplification probes, and labeling probes specifically designed for the CPS1 gene. The inventors found that by designing the capture probe composition structure, designing the capture probe into a dual-probe system and introducing HNA sequence modification, the high sensitivity, high specificity, high efficiency, and high stability of capture probe hybridization are guaranteed, making the capture probe in the kit of the present invention well applicable to the probe detection system of the present invention, while improving detection sensitivity, specificity, and stability while shortening detection time. By optimizing the introduction of multiple groups of P5 sequences at the 5' and 3' ends of the amplification probe in the signal amplification system and introducing PNA sequence modification in the labeling probe, the signal amplification system in the kit of the present invention has a more efficient signal amplification function, while improving the signal-to-noise ratio and accuracy of detection, and further shortening detection time.

[0019] The various probes designed by the inventors in the present invention are capable of hybridization reactions under uniform reaction conditions, and there is essentially no nonspecific binding between the various probes. The designed probes exhibit high sensitivity, good specificity, and a high signal-to-noise ratio in detection. As a result, the detection kit and detection method comprising the probe combination of the present invention form a comprehensive detection system, thereby achieving sensitive, specific, and accurate detection of hepatocytes. This will facilitate in-depth research into the important role of hepatocyte expression in the development and progression of HCC and its clinical significance in the diagnosis, prognosis, and treatment of HCC, and will provide useful clinical auxiliary information for the diagnosis, prognosis, and treatment of HCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the kit for detecting Hepatocytes of the present invention, wherein A is a schematic diagram of the target mRNA-capture probe-amplification probe-labeling probe hybridization complex of the present invention, and B is a schematic diagram of the Hepatocyte-negative and Hepatocyte-positive detection results of the present invention;

[0021] Figure 2 Schematic diagram comparing the detection results of the capture probe of the present invention (dual-probe system) and capture probes of conventional composition structures (single-probe systems 1, 2, and a single-probe system combination) in Example 3;

[0022] Figure 3 The figure is a ROC curve diagram of the kit of the present invention for detecting hepatocellular carcinoma. DETAILED DESCRIPTION

[0023] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to manufacturer recommendations. All commonly used chemical reagents used in the examples were commercially available. All probes used in the examples were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0025] Throughout the specification and claims, the following terms have the meanings explicitly associated herein, unless the context clearly dictates otherwise. The phrase "in one embodiment" as used herein does not necessarily refer to the same embodiment, although it may be. Furthermore, the phrase "in another embodiment" as used herein does not necessarily refer to a different embodiment, although it may be. Thus, as described below, the various embodiments of the present invention can be readily combined without departing from the scope or spirit of the invention.

[0026] Furthermore, as used herein, the term "or" is inclusive and equivalent to the term "and / or," unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. Furthermore, throughout this specification, the meanings of "a," "an," and "the" include plural referents. The meaning of "in" includes "in" and "on."

[0027] To facilitate understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the present disclosure more thorough and comprehensive.

[0028] The present invention is further described in detail below with reference to specific embodiments.

[0029] Some embodiments of the present invention provide a Hepatocyte detection kit comprising a capture probe for CPS1 gene mRNA and a signal amplification system, wherein the capture probe adopts a dual-probe capture system, comprising a capture probe CP1 and a capture probe CP2, wherein the capture probe CP1 is composed of, from the 5' end to the 3' end, a P1 sequence, a spacer arm sequence, and a P2 sequence; and the capture probe CP2 is composed of, from the 5' end to the 3' end, a P3 sequence, a spacer arm sequence, and a P4 sequence.

[0030] The P1 sequence and the P4 sequence are both 10 to 14 bp in length, do not have a hairpin structure, do not form dimers within or between probes, do not have mismatches, and do not specifically bind to the P2 sequence, P3 sequence, and target mRNA; the P2 and P3 sequences are 16 to 20 bp in length and specifically bind to the target mRNA;

[0031] The signal amplification system includes an amplification probe and a labeling probe. The amplification probe is connected to the capture probe and the labeling probe, and its composition from the 5' end to the 3' end is: P5' sequence, spacer arm sequence, P6 sequence, spacer arm sequence, P7 sequence, spacer arm sequence, P5" sequence; the P5' sequence is n1 groups of P5 sequences connected in sequence, n1 is an integer from 0 to 10, the P5" sequence is n2 groups of P5 sequences connected in sequence, n2 is an integer from 0 to 10, the P5 sequence is 18 to 22 bp in length, and the P5 sequence is 18 The invention relates to a method for preparing a novel nanostructured ...

[0032] In some embodiments, when the capture probes undergo hybridization reactions, they can only specifically and stably bind to the signal amplification system when both the capture probe CP1-specific P2 sequence and the capture probe CP2-specific P3 sequence specifically bind to the target gene mRNA sequence, causing the target mRNA to emit fluorescence and achieve detection. If one of the capture probes CP1 and CP2 binds to a non-specific sequence, the amplification probe that subsequently binds to it will be easily washed away during the washing step because it cannot stably bind to the capture probe, and will subsequently be unable to bind to the labeled probe and form a fluorescent signal. Therefore, the design of the dual-probe system of the capture probe greatly reduces the generation of non-specific fluorescent signals, reduces background signals, and provides higher fluorescent signal specificity and a higher signal-to-noise ratio.

[0033] In some embodiments thereof, the capture probe and the label probe are modified with hexitol nucleic acid, and the capture probe P1, P2, P3, P4 sequences and the label probe P8 sequence are all hexitol nucleic acid sequences. Each sequence of the capture probe is designed as an HNA sequence, so that the capture probe has higher hybridization affinity, hybridization stability and single base mismatch recognition ability. Therefore, during hybridization, not only can the affinity and stability of the capture probe specifically binding to the target mRNA and the amplification probe be improved, the hybridization efficiency and detection sensitivity can be improved, the time required for the capture probe to fully hybridize with the target mRNA and the amplification probe can be shortened, so that the capture probe can still ensure sufficient and accurate hybridization within a shorter hybridization time, but also the occurrence of single base mismatch can be reduced, the probability of non-specific binding can be reduced, and the detection specificity can be improved, thereby further improving the accuracy of detection. At the same time, the P8 sequence of the labeled probe is designed as an HNA sequence, thereby having nuclease resistance (for example, RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistance), and can have an improved binding affinity to its mRNA target relative to the equivalent unmodified P8 sequence, so that the labeled probe has higher hybridization affinity, hybridization stability and single-base mismatch recognition ability.

[0034] In some embodiments, the number n1 of P5 sequence groups in the P5' sequence of the amplification probe is an integer of 3 to 10; the number n1 of P5 sequence groups in the P5" sequence of the amplification probe is an integer of 3 to 10. As a result, the 5' end and 3' end of the amplification probe both contain multiple groups of P5 sequences. During colorimetric hybridization, both the 5' end and the 3' end of the amplification probe can specifically bind to multiple labeled probes with fluorescent groups, thereby increasing the probability of binding between the amplification probe and the labeled probe and improving the signal amplification capability.

[0035] In some embodiments, the number n1 of P5 sequence groups in the P5′ sequence in the amplification probe is an integer from 3 to 7, and more preferably, n1 is 5.

[0036] In some embodiments, the number n2 of P5 sequence groups in the P5" sequence in the amplification probe is an integer from 3 to 7, and more preferably, n2 is 5.

[0037] In some embodiments, in the capture probes CP1 and CP2, the P2 sequence and the P3 sequence respectively target two adjacent detection target regions of the CPS1 gene mRNA, and there is a gap of 2 to 5 bases between the two adjacent detection target regions.

[0038] In some embodiments, in the above-mentioned capture probe CP1, the P1 sequence is SEQ ID NO.1 or its fully complementary sequence, and the P2 sequence is selected from any at least three of SEQ ID NO.3 to SEQ ID NO.12 and the fully complementary sequences of SEQ ID NO.3 to SEQ ID NO.12; in the capture probe CP2, the P4 sequence is SEQ ID NO.43 or its fully complementary sequence, and the P3 sequence is selected from any at least three of SEQ ID NO.23 to SEQ ID NO.32 and the fully complementary sequences of SEQ ID NO.23 to SEQ ID NO.32.

[0039] In some embodiments, in the above-mentioned capture probe CP1, the P2 sequence is selected from any at least 5 of SEQ ID NO.3 to SEQ ID NO.12 and the completely complementary sequences of SEQ ID NO.3 to SEQ ID NO.12; in the capture probe CP2, the P3 sequence is selected from any at least 5 of SEQ ID NO.23 to SEQ ID NO.32 and the completely complementary sequences of SEQ ID NO.23 to SEQ ID NO.32.

[0040] In some embodiments, in the above-mentioned capture probe CP1, the P2 sequence is selected from any at least 7 of SEQ ID NO.3 to SEQ ID NO.12 and the completely complementary sequences of SEQ ID NO.3 to SEQ ID NO.12; in the capture probe CP2, the P3 sequence is selected from any at least 7 of SEQ ID NO.23 to SEQ ID NO.32 and the completely complementary sequences of SEQ ID NO.23 to SEQ ID NO.32.

[0041] In some embodiments, in the capture probe CP1, the P2 sequence is SEQ ID NO.3 to SEQ ID NO.12 or a completely complementary sequence of SEQ ID NO.3 to SEQ ID NO.12; in the capture probe CP2, the P3 sequence is SEQ ID NO.23 to SEQ ID NO.32 or a completely complementary sequence of SEQ ID NO.23 to SEQ ID NO.32.

[0042] In some embodiments, in the above-mentioned amplification probe, the P5 sequence is SEQ ID NO.45 or its completely complementary sequence, the P6 sequence is SEQ ID NO.47 or its completely complementary sequence, and the P7 sequence is SEQ ID NO.49 or its completely complementary sequence; in the labeling probe, the P8 sequence is SEQ ID NO.51 or its completely complementary sequence, and the fluorescent group is selected from: FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas, Red, LC RED640, Cy5, LC RED705, AlexaFluor488 and AlexaFluor 750.

[0043] In some embodiments, the spacer sequence has a base length of 5 to 10; preferably, the spacer sequence has a base length of 5 to 10 Ts, more preferably 5 Ts. By providing a spacer sequence of appropriate length within the probe, specifically by using the spacer sequence to separate the P1 sequence / P4 sequence from the target mRNA, steric hindrance can be reduced, thereby improving the efficiency and specificity of the hybridization reaction.

[0044] In some embodiments, the Hepatocyte detection kit further includes a capture probe for the internal reference gene mRNA and a signal amplification system.

[0045] In some embodiments, the internal reference gene is ACTB.

[0046] In some embodiments, in the capture probe CP1 for ACTB gene mRNA, the P1 sequence is SEQ ID NO.2 or its fully complementary sequence, and the P2 sequence is selected from any at least three of SEQ ID NO.13 to SEQ ID NO.22 and their fully complementary sequences; in the capture probe CP2 for ACTB gene mRNA, the P3 sequence is selected from any at least three of SEQ ID NO.33 to SEQ ID NO.42 and their fully complementary sequences, and the P4 sequence is SEQ ID NO.44 or its fully complementary sequence.

[0047] In some embodiments, in the above-mentioned capture probe CP1 for ACTB gene mRNA, the P2 sequence is selected from any at least 5 of SEQ ID NO.13 to SEQ ID NO.22 and the completely complementary sequences of SEQ ID NO.13 to SEQ ID NO.22; in the capture probe CP2 for ACTB gene mRNA, the P3 sequence is selected from any at least 5 of SEQ ID NO.33 to SEQ ID NO.42 and the completely complementary sequences of SEQ ID NO.33 to SEQ ID NO.42.

[0048] In some embodiments, in the capture probe CP1 targeting the ACTB gene mRNA, the P2 sequence is a completely complementary sequence of SEQ ID NO.13 to SEQ ID NO.22 or SEQ ID NO.13 to SEQ ID NO.22; in the capture probe CP2 targeting the ACTB gene mRNA, the P3 sequence is a completely complementary sequence of SEQ ID NO.33 to SEQ ID NO.42 or SEQ ID NO.33 to SEQ ID NO.42.

[0049] In some embodiments, in the amplification probe for ACTB gene mRNA, the P5 sequence is SEQ ID NO. 46 or its fully complementary sequence, the P6 sequence is SEQ ID NO. 48 or its fully complementary sequence, and the P7 sequence is SEQ ID NO. 50 or its fully complementary sequence.

[0050] In some embodiments, in the above-mentioned labeling probe for ACTB gene mRNA, the P8 sequence is SEQ ID NO. 52 or its completely complementary sequence, and the fluorescent group is selected from FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas, Red, LCRED640, Cy5, LC RED705, Alexa Fluor 488 and AlexaFluor 750, and is different from the fluorescent group carried by the CPS1 gene labeling probe.

[0051] Some embodiments of the present invention provide uses of the above-mentioned Hepatocyte detection kit in the detection, classification, prediction, treatment monitoring, prognosis or other evaluation of hepatocellular carcinoma.

[0052] Some embodiments of the present invention also provide a Hepatocyte detection method for non-disease diagnosis purposes.

[0053] The steps include:

[0054] (1) Obtaining a biological sample;

[0055] (2) Enriching the cells to be tested;

[0056] (3) pre-treating the enriched cells to be tested to expose the mRNA of the cells to be tested;

[0057] (4) Use the above kit to detect whether CPS1 gene mRNA exists in the cells to be tested.

[0058] In some embodiments, the biological sample in step (1) above includes but is not limited to the following sources: peripheral circulating blood of humans or animals, umbilical cord blood, biopsy samples, bone marrow, cultured human or animal cells, etc.

[0059] In some embodiments, step (4) of the above detection method includes the following:

[0060] a) Capture probe hybridization, where the capture probe CP1-specific P2 sequence and the capture probe CP2-specific P3 sequence simultaneously specifically bind to the target gene mRNA sequence;

[0061] b) Amplification hybridization: the P1 sequence of the capture probe CP1 and the P4 sequence of the capture probe CP2 specifically bind to the P7 sequence and P6 sequence of the amplification probes, respectively, and the target mRNA sequence signal is amplified;

[0062] c) color development, where the P5 sequence of the amplification probe specifically binds to the P8 sequence of the labeled probe modified with a fluorescent group, fluorescently labeling the target signal;

[0063] d) Detection by fluorescence detector.

[0064] In some embodiments, the capture probe hybridization time in step (4) of the above detection method is 2 hours.

[0065] In some embodiments, the amplification hybridization time in step (4) of the above detection method is 15 minutes.

[0066] In some embodiments, the color development hybridization time in step (4) of the above detection method is 15 minutes.

[0067] Example 1 Composition of Hepatocyte Detection Kit

[0068] The Hepatocyte detection kit of the present invention includes a capture probe for detecting Hepatocyte target mRNA and a signal amplification system; wherein the Hepatocyte target mRNA is CPS1 gene mRNA, and the signal amplification system includes an amplification probe and a labeled probe with a fluorescent group modified at the end, specifically as follows:

[0069] 1. Capture probe

[0070] Ten capture probes CP1 and CP2 were designed for each mRNA, ensuring the stability of the entire detection system while improving the specificity of the detection (in specific use, for each target gene, three or more capture probes CP1 and CP2 were selected to complete the detection, with good specificity and stability). This embodiment preferably uses 10 capture probes to achieve the best specificity. The P1 sequence of the capture probe CP1 for the corresponding target mRNA is shown in Table 1, the specific P2 sequence and the specific P3 sequence of the corresponding capture probe CP2 are shown in Table 2, and the P4 sequence is shown in Table 3. The hepatocyte target mRNA is the CPS1 gene mRNA.

[0071] Table 1 P1 sequence of capture probe CP1

[0072] mRNA P1 sequence (5'-3') SEQ ID NO. CPS1 CTTAACTGATCG 1 ACTB ACGACTGGTCAA 2

[0073] Table 2 Capture probe CP1 specific P2 sequence and capture probe CP2 specific P3 sequence

[0074]

[0075]

[0076] Table 3 P4 sequence of capture probe CP2

[0077] mRNA P4 sequence (5'-3') SEQ ID NO. CPS1 GCTTAGCAAAGC 43 ACTB AACTGATCGTAC 44

[0078] 2. Amplification probe

[0079] The P5 sequence of the amplification probe for the corresponding target mRNA is shown in Table 4, the P6 sequence is shown in Table 5, and the P7 sequence is shown in Table 6.

[0080] Table 4 P5 sequence of amplification probe

[0081] mRNA P5 sequence (5'-3') SEQ ID NO. CPS1 CACTCAATGCAATCCTGCCT 45 ACTB GAAGTGTACAATTCTACGGC 46

[0082] Table 5 P6 sequence of amplification probe

[0083] mRNA P6 sequence (5'-3') SEQ ID NO. CPS1 GCTTTGCTAAGC 47 ACTB GTACGATCAGTT 48

[0084] Table 6 P7 sequence of amplification probe

[0085] mRNA P7 sequence (5'-3') SEQ ID NO. CPS1 CGATCAGTTAAG 49 ACTB TTGACCAGTCGT 50

[0086] 3. Labeling Probes

[0087] The P8 sequences of the labeled probes for the corresponding target mRNAs are shown in Table 7.

[0088] Table 7 P8 sequence of labeled probe

[0089] mRNA P8 sequence (5'-3') SEQ ID NO. Fluorophore CPS1 AGGATTGCATTGAGTG 51 Alexa Fluor 488 (green fluorescence signal) ACTB TAGAATTGTACACTTC 52 Cy3 (red fluorescence signal)

[0090] Example 2 Detection of Hepatocyte Detection Kit

[0091] The formulas of various solutions involved in the Hepatocyte detection kit of the present invention are shown in Table 8 below:

[0092] Table 8 Formulas of various solutions

[0093]

[0094]

[0095] This embodiment preferably uses blood samples from patients with hepatocellular carcinoma to detect circulating tumor cells (Hepatocytes) in the samples, wherein the capture mixture, amplification mixture, and color development mixture all use all the probes listed in the corresponding table in Example 1.

[0096] 1. Draw 5 ml of blood from the patient's vein into a vacuum blood collection tube to obtain a blood sample.

[0097] 2. Sample pretreatment: Filter the cells to be tested onto the filter membrane.

[0098] (1) Collect the cell suspension to be tested, centrifuge horizontally at 600×g for 5 minutes, and discard the supernatant; (2) Add 4ml PBS and 1ml fixative, vortex to mix, and let it stand at room temperature for 8 minutes; (3) Sample filtration: Transfer the liquid in the sample storage tube to the filter, turn on the vacuum filtration pump to extract all the liquid; add 4ml PBS to the storage tube, wash the tube wall, and then filter the liquid; (4) Transfer the filter membrane to a 24-well plate, add 400μl of 4% formaldehyde solution, and fix at room temperature for 1 hour; (5) Remove the liquid, add 1ml PBS to each well and wash three times, soaking for 2 minutes each time.

[0099] 3. Permeabilization treatment.

[0100] (1) Add 50 μl of permeabilization agent to each well of a new 24-well plate. Remove the filter from the PBS, place the edge of the filter on absorbent paper to remove excess liquid, and then invert the filter onto the permeabilization agent, with the side of the filter ring engraved with the code facing down and close to the liquid. Incubate at room temperature for 5 minutes. (2) Remove the liquid and wash twice with 1 ml of PBS added to each well, soaking for 2 minutes each time. Keep the filter in PBS until the next experimental step.

[0101] 4. Digest the cells to expose the mRNA and make it easier for the probe to hybridize.

[0102] (1) Prepare digestive enzyme working solution of corresponding concentration: for each sample, the digestive enzyme working solution consists of 48.75 μl PBS and 1.25 μl digestive enzyme, with a total volume of 50 μl; (2) Prepare an appropriate amount of digestive enzyme working solution according to experimental needs, vortex mix, and dispense into a 24-well plate, 50 μl per well; (3) Remove the filter membrane and invert it onto the digestive enzyme working solution in the 24-well plate, ensuring that the lower side of the filter membrane is in full contact with the liquid and no bubbles are present. Let it stand at room temperature for 1 hour; (4) Remove the liquid and add 1 ml PBS to each well to wash three times, soaking for 2 minutes each time. Keep the filter membrane in PBS until the next experimental operation.

[0103] 5. The capture probe hybridizes, and the probe-specific P2 sequence and specific P3 sequence bind to the target mRNA sequence.

[0104] (1) The capture buffer needs to be preheated in a 40°C water bath for 20 minutes before use; (2) Prepare the capture working solution: for each sample, the capture working solution consists of 8 μl capture mixture and 42 μl capture buffer (preheated at 40°C), with a total volume of 50 μl. Prepare an appropriate amount of capture working solution according to experimental needs, vortex mix, and dispense into a 24-well plate, 50 μl per well; (3) Take out the filter membrane and invert it onto the capture working solution in the 24-well plate, ensuring that the lower side of the filter membrane is in full contact with the liquid and no bubbles are present; (4) Cover the 24-well plate and incubate at 40±1°C for 2 hours (the capture hybridization time in this embodiment is preferably 2 hours, refer to Example 4); (5) Remove the liquid, add 1 ml PBS to each well and wash three times, soaking for 2 minutes each time.

[0105] 6. Amplification hybridization, target mRNA sequence signal amplification.

[0106] (1) The amplification buffer needs to be preheated in a 40°C water bath for 20 minutes before use; (2) Prepare the amplification working solution: for each sample, the amplification working solution consists of 2 μl amplification mixture and 48 μl amplification buffer (preheated at 40°C), with a total volume of 50 μl. Prepare an appropriate amount of amplification working solution as needed, vortex mix, and dispense into a 24-well plate, 50 μl per well; (3) Remove the filter membrane and invert it onto the amplification working solution in the 24-well plate, ensuring that the lower side of the filter membrane is in full contact with the liquid and no bubbles are present; (4) Cover the 24-well plate and incubate at 40±1°C for 15 minutes (the amplification hybridization time in this embodiment is preferably 15 minutes, refer to Example 4); (5) Remove the liquid and add 1 ml PBS to each well for washing 3 times, soaking for 2 minutes each time.

[0107] 7. Color development and fluorescent labeling of target signals.

[0108] (1) The color development buffer needs to be preheated in a 40°C water bath for 20 minutes before use, and the entire color development process needs to be operated in the dark; (2) Prepare the color development working solution: for each sample, the color development working solution consists of 2μl color development mixture and 48μl color development buffer (preheated at 40°C), with a total volume of 50μl. Prepare a certain volume of color development working solution according to experimental needs, vortex mix in the dark, and dispense into 24-well plates, 50μl per well; (3) Take out the filter membrane and turn it upside down on the amplification working solution in the 24-well plate to ensure that the lower side of the filter membrane is in full contact with the liquid and no bubbles are present; (4) Cover the 24-well plate and incubate at 40±1°C in the dark for 15 minutes (the color development hybridization time in this embodiment is preferably 15 minutes, refer to Example 5); (5) Remove the liquid, add 1ml PBS to each well and wash three times, soaking for 2 minutes each time.

[0109] 8. Observe the expression of Hepatocytes under fluorescence microscopy.

[0110] The control substance of the present invention uses DAPI as a cell nucleus fluorescent group, which generates a blue fluorescent signal.

[0111] (1) Place the filter membrane with the cell surface facing up on a glass slide, cut the filter membrane along the inner ring of the iron ring, add 10 μl of antifade agent containing DAPI, cover with an 18 mm × 18 mm coverslip, and examine directly under a microscope or store at -20°C; (2) Count the number of heterosexual nuclei using a 20x objective lens; (3) Locate the position of the heterosexual nuclei using a 10x objective lens, drip oil, observe the experimental results using an oil immersion lens, and take photos to record the results; (4) Repeat the operation until all heterosexual nuclei have been photographed and the number is consistent with the result of the 20x objective lens count.

[0112] The microscope channels used are as follows:

[0113] Table 9 Excitation wavelength and emission wavelength of fluorescent groups

[0114] Fluorophore Excitation filter Emission filter DAPI 330~385nm 420nm Alexa Fluor 488 460~495nm 510~550nm Cy3 545~580nm 610nm

[0115] 9. Judgment and analysis of test results

[0116] (1) Hepatocyte expression determination criteria (i.e., the positive expression determination criteria of this kit, see Figure 1 B).

[0117] a) One or more cells in the sample express the Hepatocyte target mRNA. In this kit, one or more cells in the sample can show green fluorescent signals in the Alexa Fluor 488 channel.

[0118] b) All cells in the sample express the internal reference gene mRNA, which is manifested in this kit as red fluorescent signals in the Cy3 channel.

[0119] The kit of the present invention uses multiple capture probes targeting target mRNA, respectively targeting Hepatocyte target mRNA and internal reference gene mRNA, and determines whether the detected cells express Hepatocyte through the expression of fluorescent signals.

[0120] (2) Using the above detection method, 10 peripheral blood samples of patients with hepatocellular carcinoma (numbered 1 to 10, sample source: Guangzhou Yishan Medical Laboratory) were tested, and commercially available Hepatocyte-positive liver cancer cell line HepG2 and negative expression colon cancer cell line SW480 were selected as positive and negative controls, respectively. 1000 HepG2 and SW480 cells were taken respectively (determined by a cell counter), mixed evenly, and the samples were divided into 5 equal parts numbered 10 to 15 and 16 to 20. 50 cells with DAPI blue fluorescence signals in each cell line sample were read, and the number of cells expressing green / red fluorescence was counted. Cells expressing both fluorescence were listed in the number of green-positive and red-positive cells, respectively. The number of cells in the sample was selected by automatic scanning with a fluorescence microscope. Each specimen was tested three times. The specific results are shown in Table 10:

[0121] Table 10 Sample test results

[0122]

[0123] Note: To facilitate statistical analysis and subsequent processing and interpretation of the results, the average fluorescence value of each cell was rounded to the nearest integer, the same below.

[0124] The tests found that the clinical test results for different patient samples were consistent with those of the test kit of the present invention. The test results for different cell samples were identical each time. These results indicate that the hepatocyte detection kit of the present invention has good specificity and sensitivity, enabling clinical sample testing. The kit of the present invention had a 100% concordance rate with clinical test results, demonstrating that the detection system composed of probes designed in the kit of the present invention can accurately detect hepatocyte expression in circulating tumor cells of liver cancer patients with high accuracy.

[0125] Example 3 Effect of capture probe composition on the detection effect of the kit

[0126] 1. Design of kit preparation (design of capture probes with different composition structures)

[0127] To evaluate the detection efficacy of kits composed of capture probes with different compositions, experimental groups 1-4 were designed. The two groups had identical components except for the different capture probe compositions. The specific designs are shown in Table 11.

[0128] Table 11 Selection of capture probes in the kit

[0129]

[0130] 2. Sample testing

[0131] This example uses commercially available cell lines HepG2 and SW480 for the experiment. Take 4000 HepG2 and SW480 cells respectively (determined by a cell counter), mix them and divide the samples into 10 equal parts, numbered 1 to 20 and 21 to 40 in sequence. Using the kit designed and prepared as above, samples 1 to 40 were tested according to the detection process and method described in Example 2. Five samples of each cell line in each experimental group were tested, and 50 cells with DAPI blue fluorescence signals in each sample were read. The number of cells expressing green / red fluorescence and the average number of fluorescence points were counted, and the number of cells in the sample was selected by automatic scanning with a fluorescence microscope. See the specific results for details. Figure 2 and Table 12.

[0132] Table 12 Comparison of detection results of capture probes with different composition structures selected from the kit

[0133]

[0134]

[0135] The test results show that when the capture probe of the present invention with a dual-probe system is used, the hybridization efficiency is good, the fluorescence signal is bright and clear, and the abundance of signal points is high (see Figure 2 Experimental group 1), all positive cells can be detected, and the number of fluorescent signal points detected is large (see experimental group 1 in the table above), the signal is strong and stable, and its detection sensitivity and specificity are very good, which can achieve accurate detection; while the number of fluorescent signal points detected by the capture probe of the conventional composition structure of the single probe system 1 or 2 is reduced compared with the capture probe of the present invention (see Figure 2 and experimental groups 2 and 3 in the above table), and its specificity is not as good as the capture probe of the present invention, so there are some background signals and nonspecific fluorescence signals (see Figure 2 Experimental groups 2 and 3), and even lead to individual false positive results (such as samples 29 and 32); the capture probes of conventional composition structure composed of single probe systems 1 and 2 detected the same number of fluorescent signal points as the capture probes of the present invention, but their specificity was not as good as the capture probes of the present invention (see Figure 2 Experimental group 4), there were also some background signals and nonspecific fluorescence signals (see Figure 2 The above shows that the capture probe of the present invention can be better applied to the probe detection system of the present invention, has higher detection specificity, can effectively reduce nonspecific fluorescence signals, reduce background signals, have higher fluorescence signal specificity, and have a higher signal-to-noise ratio, which can better ensure the accuracy of the detection results.

[0136] Example 4 Effect of the Introduction of HNA Sequences on the Effectiveness of Capture Probes

[0137] 1. Design of kit preparation (design of capture probe sequence type and hybridization time)

[0138] To evaluate the effect of the introduction of HNA sequences on the performance of capture probes and the detection results of the kit, experimental groups 1-4 and control groups 1-4 were designed. Except for the capture probe sequence type and capture and / or amplification hybridization time, all other components, as well as the detection process and methods, were identical in each group. The specific design is shown in Table 13.

[0139] Table 13 Selection of capture probe sequence type and hybridization time

[0140]

[0141] 2. Sample testing

[0142] This embodiment uses commercially available cell lines HepG2 and SW480 for experiment. 8000 HepG2 and SW480 cells were taken respectively (determined by cell counter), and after mixing, the samples were divided into 40 parts, numbered 1 to 40 and 41 to 80 in sequence. The kit prepared by the above design and its capture, amplification and hybridization time were used, and samples 1 to 80 were detected according to the detection process and method described in Example 2. Each group of each cell line sample was tested for 5 parts, and 50 cells with DAPI blue fluorescence signal in each sample were read. The number of cells expressing green / red fluorescence and the average number of fluorescence points were counted, and the number of cells in the sample was selected by automatic scanning with a fluorescence microscope. The specific results are shown in Table 14.

[0143] Table 14 Comparison of detection results of different sequence types of capture probes at different hybridization times

[0144]

[0145] From the above test results, it can be seen that the capture probe of the present invention in the experimental group can achieve accurate detection under the conditions of capture hybridization for 2 hours or 3 hours and amplification hybridization for 15 minutes or 30 minutes. All positive cells can be detected, and the number of detected fluorescent signal points is large, the signal is strong and stable, its specificity and stability are very good, and the detection effect is very good. However, the conventional nucleic acid sequence capture probe of the control group that does not introduce the HNA sequence has some positive cells missed under the conditions of capture hybridization for 2 hours and / or amplification hybridization for 15 minutes. Accurate detection cannot be completed, and the number of detected fluorescent signal points is also significantly reduced. Only capture hybridization for 3 hours and then amplification hybridization for 30 minutes can accurate detection be achieved, and the number of cells detected and the number of fluorescent signal points are not much different from those of the experimental group; it shows that the introduction of the HNA sequence makes the capture probe of the present invention have better detection effect than the conventional nucleic acid sequence capture probe, which can improve hybridization efficiency and detection sensitivity while ensuring detection specificity and shorten hybridization time. Based on the above experimental results, the capture hybridization time of the kit of the present invention is preferably 2 hours, and the amplification hybridization time is preferably 15 minutes.

[0146] The experimental results of the selection of the HNA sequence introduction position of the capture probe for hepatocyte detection (such as: the capture probe of the present invention vs. only the P1 sequence is an HNA sequence, the capture probe of the present invention vs. only the P2 sequence is an HNA sequence, etc.) are consistent with the above experimental results, and the specific data are omitted.

[0147] Example 5 Effect of the Introduction of HNA Sequences on the Use of Labeled Probes

[0148] 1. Design of kit preparation (design of labeling probe sequence type and hybridization time)

[0149] To evaluate the effect of the introduction of HNA sequences on the effectiveness of labeled probes and the detection results of the kit, experimental groups 1-2 and control groups 1-2 were designed. Except for the type of labeled probe sequence and the color development and hybridization time, all other components, as well as the rest of the detection process and method, were identical in each group. The specific design is shown in Table 15.

[0150] Table 15 Selection of labeling probe sequence type and color development hybridization time

[0151]

[0152] 2. Sample testing

[0153] This embodiment uses commercially available cell lines HepG2 and SW480 for experiment. 4000 HepG2 and SW480 cells were taken respectively (determined by cell counter), and after mixing, the samples were divided into 20 parts, numbered 1 to 20 and 21 to 40 in sequence. The kit prepared by the above design and its color development hybridization time were used, and samples 1 to 40 were detected according to the detection process and method described in Example 2. Each group of each cell line sample was tested 5 times, and 50 cells with DAPI blue fluorescence signal in each sample were read. The number of cells expressing green / red fluorescence and the average number of fluorescence points were counted, and the number of cells in the sample was selected by automatic scanning with a fluorescence microscope. The specific results are shown in Table 16.

[0154] Table 16 Comparison of detection results of different sequence type labeled probes with different color development hybridization times

[0155]

[0156]

[0157] From the above test results, it can be seen that the experimental group of the present invention can achieve accurate detection by 15 minutes or 30 minutes of color hybridization of the labeled probe, all positive cells can be detected, the number of detected fluorescent signal points is large, the signal is strong and stable, its specificity and stability are very good, and the detection effect is very good. In the control group, the conventional nucleic acid sequence labeled probe without the introduction of the HNA sequence has the phenomenon of missing individual positive cells when chromogenic hybridization is 15 minutes, and accurate detection cannot be completed. The number of detected fluorescent signal points is also relatively low. Only 30 minutes of color hybridization can achieve accurate detection, and the number of cells detected and the number of fluorescent signal points are comparable to those of the experimental group; This shows that the introduction of the HNA sequence makes the labeled probe of the present invention have better detection effect than the conventional nucleic acid sequence labeled probe, can improve the color hybridization efficiency, and shorten the color hybridization time. Based on the above experimental results, the color hybridization time of the kit of the present invention is preferably 15 minutes.

[0158] Example 6 Selection of the number of amplification probe P5 sequence groups

[0159] 1. Design of kit preparation (selection of P5 sequence groups)

[0160] To investigate the effect of the number of P5 sequence groups in the amplification probe on the detection performance of the kit, experimental groups 1-6 were designed, taking the P5 sequence at the 5' end (5' sequence) of the amplification probe as an example. Except for the different number of P5 sequence groups at the 5' end (5' sequence) of the amplification probe, the number of P5 sequence groups at the 3' end (5" sequence) of the amplification probe was the same for each group, and all other components were the same. The specific design is shown in Table 17.

[0161] Table 17 Selection of the number of P5 sequence groups at the 5' end of the amplification probe

[0162] Experimental group Experimental Group 1 Experimental Group 2 Experimental Group 3 Experimental Group 4 Experimental Group 5 Experimental Group 6 Number of 5' end P5 sequence groups 0 1 3 5 7 10 Number of 3' end P5 sequence groups 5 5 5 5 5 5

[0163] 2. Sample testing

[0164] This embodiment uses commercially available cell lines HepG2 and SW480 for experiment. 6000 HepG2 and SW480 cells were taken respectively (determined by cell counter), and after mixing, the samples were divided into 30 parts, numbered 1 to 30 and 31 to 60 in sequence. The kit designed and prepared above was used to detect samples 1 to 60 according to the detection process and method described in Example 2. 5 samples of each cell line in each experimental group were tested, and 50 cells with DAPI blue fluorescence signals in each sample were read. The number of cells expressing green / red fluorescence and the average number of fluorescence points were counted, and the number of cells in the sample was selected by automatic scanning with a fluorescence microscope. The specific results are shown in Table 18.

[0165] Table 18 Comparison of detection results of amplification probes composed of different numbers of P5 sequences at the 5' end

[0166]

[0167] From the above test results, it can be seen that using amplification probes with 1 to 10 5'-end P5 sequence groups can achieve accurate detection, the number of detected fluorescent signal points is large, the signal is strong and stable, and the detection effect of the kit is very good. Among them, when using amplification probes with 3 to 7 5'-end (5' sequence) P5 sequence groups, the number of detected fluorescent signal points is even greater, the signal is stronger and more stable, and the detection effect of the kit is even better. When the number of 5'-end P5 sequence groups of the amplification probe is 0, because the amplification probe only contains the P5 sequence at the 3' end, its signal amplification ability is limited, resulting in a poor fluorescence signal amplification effect, making the detection effect of the kit unstable, and individual positive cells cannot be effectively detected. Therefore, the number of 5'-end P5 sequence groups in the amplification probe of the present invention is preferably 3 to 7 groups.

[0168] The experimental results of selecting the number of P5 sequence groups at the 3' end (5" sequence) of the amplification probe for Hepatocyte detection are consistent with the above experimental results, and the specific data are omitted.

[0169] In view of the above experimental results, the number of P5 sequence groups at the 5' end and 3' end in the amplification probe of the present invention is preferably 3 to 7 groups; in order to ensure the accuracy of the detection results of the kit while saving the cost of probe synthesis, the number of P5 sequence groups at the 5' end (5' sequence) and 3' end (5" sequence) in the amplification probe of the present invention is preferably 5 groups.

[0170] Example 7 Sensitivity and specificity of the kit of the present invention in detecting hepatocellular carcinoma

[0171] 1. Design of kit preparation

[0172] In order to investigate the sensitivity and specificity of the kit of the present invention in detecting hepatocellular carcinoma, the kit of the present invention was designed and prepared according to Example 1 for use in clinical sample detection.

[0173] 2. Sample testing

[0174] This example uses 100 peripheral blood clinical samples (source of samples: Guangzhou Yishan Medical Laboratory) for experiments, of which 5 were from healthy people, 7 were from lung cancer patients, 8 were from breast cancer patients, 9 were from colon cancer patients, 9 were from gastric cancer patients, 11 were from bile duct cancer patients (intrahepatic bile duct cancer), and 51 were from hepatocellular carcinoma patients. The above-designed and prepared kit was used to detect the above 100 samples according to the detection process and method described in Example 2. The sensitivity, specificity and coincidence rate of the kit of the present invention for detecting hepatocellular carcinoma were calculated with reference to the clinical pathological diagnosis results. Specific results are shown in Figure 3 and Table 19.

[0175] Table 19 Summary of test results of 100 peripheral blood clinical samples

[0176]

[0177] As can be seen from the test results in the table above, the kit of the present invention detected 48 hepatocyte-negative results and 1 hepatocyte-positive result in clinical samples from healthy individuals and non-hepatocellular carcinoma patients, and 8 hepatocyte-negative results and 43 hepatocyte-positive results in clinical samples from hepatocellular carcinoma patients. The sensitivity of the kit for detecting hepatocellular carcinoma was 84.3%, the specificity was 98.0%, and the coincidence rate was 91%. Figure 3 As can be seen, the area under the curve of the kit of the present invention for detecting hepatocellular carcinoma is 0.911. The above demonstrates that the kit of the present invention has certain diagnostic value in detecting hepatocellular carcinoma. Comparison of the test data of patients with cholangiocarcinoma and hepatocellular carcinoma among liver cancer patients shows that the kit of the present invention can further provide auxiliary information for distinguishing hepatocellular carcinoma from liver cancer.

[0178] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims. Sequence Listing <110> Yishan Biotechnology Co., Ltd. <120> A Hepatocyte detection kit and its preparation method and application <160> 54 <170> SIPOSequenceListing 1.0 <210> 1 <211> 12 <212> DNA <213> Artificial Sequence <400> 1 cttaactgat cg 12 <210> 2 <211> 12 <212> DNA <213> Artificial Sequence <400> 2 acgactggtc aa 12 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 aggagcctga tgccaggt 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 tctgtccttt gtaggcag 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <400> 5 ctaagtgcac ttcagctc 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 ctgcacagcg aagaaggg 18 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 tagttccact ccacagtt 18 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <400> 8 actcggcatt ggagagtg 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 aacggtcaag atcccagc 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 tctggcctcc aactgata 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <400> 11 taccacattc atagcaga 18 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <400> 12 gccatctcac atctcaga 18 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <400> 13 gccggccttg cacatgcc 18 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <400> 14 tccttctgac ccatgccc 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <400> 15 ggtgtggtgc cagatttt 18 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <400> 16 ggtctcaaac atgatctg 18 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <400> 17 gctgtagccg cgctcggt 18 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <400> 18 gtccagggcg acgtagca 18 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <400> 19 ccgctcattg ccaatggt 18 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <400> 20 ggtagtttcg tggatgcc 18 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <400> 21 tgccagggta catggtgg 18 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <400> 22 ggtggacagc gaggccag 18 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <400> 23 gctgtctgtg ccttgaca 18 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <400> 24 tagggttggc cattgtga 18 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <400> 25 tgaaatcatg gttccagg 18 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <400> 26 cggggtgacc tctgggtg 18 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <400> 27 cttgagcaca cctctctt 18 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <400> 28 aagtacgtct caacatct 18 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <400> 29 ttcggctaga tgttccat 18 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <400> 30 gaactgccag gttgtttg 18 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <400> 31 tttcatctca tcctcaga 18 <210> 32 <211> 18 <212> DNA <213> Artificial Sequence <400> 32 caagccacct ctccagtg 18 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <400> 33 gggggcatcg tcgcccgc 18 <210> 34 <211> 18 <212> DNA <213> Artificial Sequence <400> 34 gcctcgtcgc ccacatag 18 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <400> 35 cacacgcagc tcattgta 18 <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <400> 36 gtacatggct ggggtgtt 18 <210> 37 <211> 18 <212> DNA <213> Artificial Sequence <400> 37 ccgctcggcc gtggtggt 18 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <400> 38 cgtggccatc tcttgctc 18 <210> 39 <211> 18 <212> DNA <213> Artificial Sequence <400> 39 gagtgcctca gggcagcg 18 <210> 40 <211> 18 <212> DNA <213> Artificial Sequence <400> 40 acacttcatg atggagtt 18 <210> 41 <211> 18 <212> DNA <213> Artificial Sequence <400> 41 ccttctgcat cctgtcgg 18 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <400> 42 gctgatccac atctgctg 18 <210> 43 <211> 12 <212> DNA <213> Artificial Sequence <400> 43 gcttagcaaa gc 12 <210> 44 <211> 12 <212> DNA <213> Artificial Sequence <400> 44 aactgatcgt ac 12 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <400> 45 cactcaatgc aatcctgcct 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <400> 46 gaagtgtaca attctacggc 20 <210> 47 <211> 12 <212> DNA <213> Artificial Sequence <400> 47 gctttgctaa gc 12 <210> 48 <211> 12 <212> DNA <213> Artificial Sequence <400> 48 gtacgatcag tt 12 <210> 49 <211> 12 <212> DNA <213> Artificial Sequence <400> 49 cgatcagtta ag 12 <210> 50 <211> 12 <212> DNA <213> Artificial Sequence <400> 50 ttgaccagtc gt 12 <210> 51 <211> 16 <212> DNA <213> Artificial Sequence <400> 51 aggattgcat tgagtg 16 <210> 52 <211> 16 <212> DNA <213> Artificial Sequence <400> 52 tagaattgta cacttc 16 <210> 53 <211> 29 <212> DNA <213> Artificial Sequence <400> 53 cttaactgat cgaaaaagct tagcaaagc 29 <210> 54 <211> 29 <212> DNA <213> Artificial Sequence <400> 54 acgactggtc aaaaaaaaac tgatcgtac 29

Claims

1. A Hepatocyte detection kit, characterized in that It includes a capture probe and a signal amplification system for CPS1 gene mRNA, wherein: The capture probe adopts a dual-probe capture system, including more than three capture probes CP1 and CP2. The capture probe CP1 is composed of the following sequence from the 5' end to the 3' end: P1 sequence, spacer arm sequence, and P2 sequence; The capture probe CP2 is composed of the following sequence from the 5' end to the 3' end: P3 sequence, spacer arm sequence, and P4 sequence; In the capture probe CP1, the P1 sequence is SEQ ID NO.1, and the P2 sequence is selected from SEQ ID NO.3 to SEQ ID NO.12; In the capture probe CP2, the P4 sequence is SEQ ID NO.43, and the P3 sequence is selected from SEQ ID NO.23 to SEQ ID NO.32; The signal amplification system includes an amplification probe and a labeling probe, The amplification probe connects the capture probe and the label probe, and its composition from the 5' end to the 3' end is: P5' sequence, spacer arm sequence, P6 sequence, spacer arm sequence, P7 sequence, spacer arm sequence, P5" sequence; The P5' sequence is n1 groups of P5 sequences connected in sequence, n1 is an integer from 3 to 10, and the P5 sequence is 18 to 22 bp in length; The P5" sequence is n2 groups of P5 sequences connected in sequence, n2 is an integer from 3 to 10, and the P5 sequence is 18 to 22 bp in length; The P6 sequence is complementary to the P4 sequence; the P7 sequence is complementary to the P1 sequence; In the amplification probe, the P5 sequence is SEQ ID NO.45, the P6 sequence is SEQ ID NO.47, and the P7 sequence is SEQ ID NO.49; The labeling probe connects the amplification probe and the fluorescent group, and its composition from the 5' end to the 3' end is: P8 sequence, fluorescent group; the P8 sequence is complementary to the P5 sequence; in the labeling probe, the P8 sequence is SEQ ID NO.51; The capture probe and / or labeling probe is modified with hexitol nucleic acid.

2. The Hepatocyte detection kit according to claim 1, wherein The capture probe and the labeling probe are modified with hexitol nucleic acid, and the capture probe P1, P2, P3, P4 sequences and the labeling probe P8 sequence are all hexitol nucleic acid sequences.

3. The Hepatocyte detection kit according to claim 1, wherein The number n1 of P5 sequence groups in the P5' sequence in the amplification probe is an integer from 3 to 7; The number n2 of P5 sequence groups in the P5" sequence is an integer from 3 to 7.

4. The Hepatocyte detection kit according to claim 1, wherein The number n1 of P5 sequence groups in the P5' sequence in the amplification probe is an integer of 5; The number n2 of P5 sequence groups in the P5" sequence is an integer of 5.

5. The Hepatocyte detection kit according to claim 1, wherein The fluorescent group is selected from the group consisting of: FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas, Red, LC RED640, Cy5, LC RED705, Alexa Fluor 488 and Alexa Fluor 750.

6. The Hepatocyte detection kit according to any one of claims 1 to 5, characterized in that It also includes a capture probe for the internal reference gene mRNA and a signal amplification system.

7. The Hepatocyte detection kit according to claim 6, characterized in that The internal reference gene is ACTB; In the capture probe CP1 targeting the mRNA of the ACTB gene, the P1 sequence is SEQ ID NO. 2, and the P2 sequence is selected from at least three of SEQ ID NO. 13 to SEQ ID NO. 22; In the capture probe CP2 targeting the mRNA of the ACTB gene, the P3 sequence is selected from at least three of SEQ ID NO.33 to SEQ ID NO.42, and the P4 sequence is SEQ ID NO.44; In the amplification probe targeting the ACTB gene mRNA, the P5 sequence is SEQ ID NO.46, the P6 sequence is SEQ ID NO.48, and the P7 sequence is SEQ ID NO.50; In the labeling probe for ACTB gene mRNA, the P8 sequence is SEQ ID NO.52, and the fluorescent group is selected from FAM, TET, JOE, HEX, Cy3, TAMRA, ROX, Texas, Red, LC RED640, Cy5, LC RED705, Alexa Fluor 488 and Alexa Fluor 750, and is different from the fluorescent group carried by the CPS1 gene labeling probe.

Citation Information

Patent Citations

  • Nucleic acid signal amplifying detection kit

    CN106636318A

  • Cytokeratin 19 gene expression detection kit

    CN113234797A