A RAGE / DIAPH1 signaling pathway inhibitor and its application

Abstract

The present invention provides a RAGE / DIAPH1 signaling pathway inhibitor and its application, belonging to the technical field of hypercholesterolemia treatment. The present invention proposes for the first time the role of the RAGE / DIAPH1 signaling pathway in hypercholesterolemia and its complications, and provides a target for treating hypercholesterolemia and its complications by inhibiting the RAGE / DIAPH1 signaling pathway. The present invention reveals for the first time the mechanism of action of the RAGE / DIAPH1 signaling pathway in mediating the formation of atherosclerosis and liver damage caused by hypercholesterolemia, inhibits abnormal activation of the RAGE / DIAPH1 signaling pathway, promotes vasodilation and / or endothelial regeneration, reduces liver damage and the formation of pannus, plays an important role in liver protection, and provides a theoretical basis for the development of therapeutic drugs for hypercholesterolemia and its complications.

Description

Technical Field

[0001] The present invention belongs to the technical field of hypercholesterolemia treatment, and in particular relates to a RAGE / DIAPH1 signaling pathway inhibitor and application thereof. Background Art

[0002] Dyslipidemia is one of the key risk factors for many chronic diseases, and hypercholesterolemia is one of the key pathogenic factors that cause atherosclerosis and liver damage. AGE is a heterogeneous glycosylation product of proteins, lipids and nucleotides. The receptor for advanced glycation end products (RAGE) is the main receptor for AGE and belongs to the multi-ligand transmembrane receptor of the immunoglobulin superfamily. RAGE is expressed in various tissues such as lung, heart, kidney, brain and skeletal muscle, and exists on the surface of different types of cells such as lymphocytes, leukocytes, macrophages and endothelial cells, affecting cell survival, cell proliferation, oxidative stress and inflammatory response, and plays a core role in the occurrence of chronic inflammatory diseases and diabetic complications. Diaphanous 1 (DIAPH1) is a member of the formin family. It binds to the cytoplasmic domain of RAGE and is a key effector of RAGE signal transduction. It is essential for the activation of downstream signaling pathways. It has been reported that RAGE / DIAPH1 signaling can regulate oxidative stress, inflammation, apoptosis, autophagy, endothelial-mesenchymal transition, endothelial permeability and dysfunction. Studies have found that inhibiting the activation of the RAGE signaling pathway in mice induced by a high-fat diet can play an anti-inflammatory role, but there have been no reports on the role of the RAGE / DIAPH1 signaling pathway in mediating endothelial dysfunction and liver damage in the occurrence and development of hypercholesterolemia and its complications. At the same time, there have been no reports on the application of inhibiting the expression of the RAGE / DIAPH1 signaling pathway in hypercholesterolemia and its complications to promote vasodilation and / or endothelial regeneration and protect the liver. Summary of the invention

[0003] In view of this, the object of the present invention is to provide the use of a RAGE / DIAPH1 signaling pathway inhibitor in the preparation of a drug for treating hypercholesterolemia and its complications.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides the use of a RAGE / DIAPH1 signaling pathway inhibitor in the preparation of a drug for treating hypercholesterolemia.

[0006] The present invention also provides the use of the RAGE / DIAPH1 signaling pathway inhibitor in the preparation of a drug for treating complications of hypercholesterolemia.

[0007] Preferably, the complications of hypercholesterolemia include atherosclerosis and liver damage.

[0008] Preferably, the RAGE / DIAPH1 signaling pathway inhibitor comprises shRNA, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.1.

[0009] The present invention also provides a RAGE / DIAPH1 signaling pathway inhibitor shRNA, the nucleotide sequence of the shRNA is shown as SEQ ID NO.1.

[0010] The present invention also provides an expression vector, which comprises a DNA fragment encoding the shRNA operably linked to at least one expression control sequence.

[0011] Preferably, the expression vector comprises a viral, fungal or bacterial expression vector.

[0012] The present invention also provides a cell, wherein the cell comprises the above shRNA, or comprises the above expression vector.

[0013] The present invention also provides a use of the above expression vector or the above cell in preparing a drug for treating hypercholesterolemia or complications of hypercholesterolemia.

[0014] The present invention also provides a drug for treating hypercholesterolemia or complications of hypercholesterolemia, wherein the drug comprises the above-mentioned RAGE / DIAPH1 signaling pathway inhibitor shRNA.

[0015] Beneficial effects of the present invention:

[0016] The present invention proposes for the first time the role of the RAGE / DIAPH1 signaling pathway in hypercholesterolemia and its complications, and provides a target for treating hypercholesterolemia and its complications by inhibiting the RAGE / DIAPH1 signaling pathway. The present invention helps to further enrich and improve the research on the pathogenesis of hypercholesterolemia and its complications, and also provides an experimental basis for the development of new biomarkers for early diagnosis and targeted treatment of hypercholesterolemia and its complications.

[0017] The present invention reveals for the first time the mechanism of action of the RAGE / DIAPH1 signaling pathway in mediating the formation of atherosclerosis and liver damage caused by hypercholesterolemia. Inhibiting the abnormal activation of the RAGE / DIAPH1 signaling pathway can promote vasodilation and / or endothelial regeneration, reduce liver damage and the formation of vascular pannus, play an important role in liver protection, provide a theoretical basis for the development of therapeutic drugs for hypercholesterolemia and its complications, have important significance for people's health, and have broad social and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1:pAV[shRNA]-EGFP-U6>rDiaph1 vector map;

[0019] Figure 2 :The weight changes of rats in different experimental groups at different times, Control: healthy control group; Model: high-fat diet-induced rat model group; siRNA: pAV[shRNA]-EGFP-U6>rDiaph1-liposome injection group; Ator: positive control group;

[0020] Figure 3 : Expression of TC, TG and HDL-C in the serum of rats in different experimental groups. Figure 2 , compared with the Control group, **P<0.01; compared with the Model group, ##P<0.01;

[0021] Figure 4 :Expression of IL-1β, IL-6, IL-8 and TNF-α in the serum of rats in different experimental groups. Figure 2 , compared with the Control group, **P<0.01; compared with the Model group, ##P<0.01;

[0022] Figure 5 : HE staining results of rat liver tissues in different experimental groups (×40, scale bar 25 μm), the experimental groups in the figure are divided into the same Figure 2 ;

[0023] Figure 6 : Relative expression of RAGE and DIAPH1 mRNA levels in the liver of rats in different experimental groups. Figure 2 , Figure 6 In the figure, C represents the amplification curve formed when RAGE mRNA level expression is detected by RT-qPCR; D represents the melting curve formed when RAGE mRNA level expression is detected by RT-qPCR; E represents the amplification curve formed when DIAPH1 mRNA level expression is detected by RT-qPCR; F represents the melting curve formed when DIAPH1 mRNA level expression is detected by RT-qPCR;

[0024] Figure 7 : Expression of RAGE and DIAPH1 protein levels in the liver of rats in different experimental groups. Figure 2 ;

[0025] Figure 8 :Immunohistochemical analysis of RAGE and DIAPH1 in the liver of rats in different experimental groups (×20), the experimental groups in the figure are divided into the same Figure 2 . DETAILED DESCRIPTION

[0026] The present invention provides the use of a RAGE / DIAPH1 signaling pathway inhibitor in preparing a drug for treating hypercholesterolemia or in preparing a drug for treating complications of hypercholesterolemia.

[0027] In the present invention, the complications of hypercholesterolemia preferably include atherosclerosis and liver damage, and the RAGE / DIAPH1 signaling pathway inhibitor preferably includes shRNA, and the nucleotide sequence of the shRNA is CTGCTTTTCCTGCTGGCGGTTATTTATTATTAGTGCTGTGG (SEQ ID NO.1).

[0028] The present invention also provides a RAGE / DIAPH1 signaling pathway inhibitor shRNA, the nucleotide sequence of the shRNA is shown as SEQ ID NO.1.

[0029] The present invention also provides an expression vector, which comprises a DNA fragment encoding the shRNA operably linked to at least one expression control sequence.

[0030] In the present invention, the expression vector preferably includes a virus, fungus or bacteria expression vector, the virus expression vector is preferably an adenovirus expression vector, and more preferably a pAV[shRNA]-EGFP-U6>rDiaph1 vector.

[0031] The present invention also provides a cell, wherein the cell comprises the above shRNA, or comprises the above expression vector. The present invention has no particular limitation on the specific type of the cell.

[0032] The present invention also provides a use of the above expression vector or the above cell in preparing a drug for treating hypercholesterolemia or complications of hypercholesterolemia.

[0033] The present invention also provides a medicine for treating hypercholesterolemia or complications of hypercholesterolemia, and the medicine comprises the above shRNA.

[0034] The present invention has no special limitation on other substances contained in the medicine, and the auxiliary materials commonly used in the preparation of medicines in the art can be used.

[0035] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0036] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0038] The data in the following examples were analyzed using SPSS 24.0 software, and the results are presented as mean ± standard deviation. The comparison between the groups at different time periods was performed with two-way analysis of variance for repeated measures, and the comparison between multiple groups was performed with one-way analysis of variance. If the variance was consistent, the LSD-t test was used, otherwise the Dunnett T3 test was used. P < 0.05 was considered statistically significant.

[0039] Example 1

[0040] Preparation of high-fat emulsion and establishment of rat model induced by high-fat diet

[0041] Formula of high-fat emulsion: Tween 60% + edible oil 15% + cholesterol 6% + sodium cholate 2% + propylthiouracil 0.2% + H2O 16.8% (the percentages in the formula are all mass percentages). Preparation method: ① Stir and heat the edible oil in an 80°C water bath; ② Add cholesterol and propylthiouracil to the heated edible oil and stir thoroughly to dissolve; ③ Add sodium cholate and an appropriate amount of distilled water and stir thoroughly to dissolve the sodium cholate; ④ Add an appropriate amount of Tween and stir thoroughly until emulsification occurs; ⑤ Dilute to 100mL with 37°C warm water and store at -20°C for later use. Before gavage, place the high-fat emulsion in a 60°C water bath to heat and melt.

[0042] A high-fat diet (HFD) rat model was established by gavage of a basal diet combined with a high-fat emulsion. The rats were gavaged with 10 mL / kg·d of high-fat emulsion. Each rat ate 30 g / d of basal diet, which was fed three times at regular intervals. The changes in body weight of rats in different experimental groups were recorded every week.

[0043] Construction of DIAPH1 shRNA adenoviral recombinant vector

[0044] Referring to the rat DIAPH1 CDS region in NCBI GenBank (https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001107393.3), a pair of DIAPH1-shRNA (DIAPH1-shRNA-Sequence: CTGCTTTTCCTGCTGGCGGTTATTTATTATT AGTGCTGTGG) was designed to construct the pAV[shRNA]-EGFP-U6>rDiaph1 vector (see Figure 1 ), the DIAPH1-shRNA plasmid host bacteria were expanded and the plasmid was extracted, and stored at -20℃ for later use.

[0045] Experimental animal grouping and sample collection

[0046] 48 6-week-old SPF male Wistar rats in good health and similar body weight (190±10g) were selected. Free drinking water was provided at room temperature. After being fed with a conventional basal diet for 1 week, the rats were randomly divided into 4 experimental groups (n=12) according to the principle of similar average body weight between groups. The experimental time was 6 weeks (adaptive feeding for 1 week and formal experiment for 5 weeks), as shown in Table 1:

[0047] Table 1 Test groups

[0048]

[0049] After the HFD rat model was successfully established, 4 μL of DIAPH1shRNA adenovirus recombinant vector-liposome (liposome and DIAPH1 shRNA adenovirus recombinant vector were mixed in equal volumes) was injected into the bilateral hind leg muscles to construct the siRNA rat group. Rats in each group were weighed once a week and the original data were recorded. Figure 2 As shown. Before the HFD rat model was successfully established (5 weeks), there was no significant difference in the changes in body weight of rats in different test groups; starting from the 6th week, compared with the Control group, the body weight of rats in the Model group was significantly reduced (P<0.01); compared with the Model group, the body weight of rats in the DIAPH1-siRNA group and the positive drug treatment group was significantly increased (P<0.05). Preliminary explanation, the present invention successfully established a high-fat diet-induced rat model, and the RAGE / DIAPH1 pathway mediated the formation of hypercholesterolemia and its complications.

[0050] Example 2

[0051] Detection of lipid content in serum of rats in different experimental groups

[0052] After the model in Example 1 was successfully constructed, the rats were anesthetized with 10% chloral hydrate, and 2 mL of blood was collected from the medial canthal vein with a glass capillary. The whole blood sample was placed at room temperature for 1 hour, centrifuged at 3000 r / min for 10 minutes, and the supernatant was taken. The total cholesterol (TC), triglycerides (TG), and high-density lipoprotein (HDL-C) levels in the serum of rats in different test groups were detected by the enzyme marker colorimetric method. According to the test kit instructions, the serum to be tested was mixed with the reaction solution, incubated at 37°C (TC and TG were incubated for 10 minutes, and HDL-C was incubated for 5 minutes), and the wavelengths were 510 nm (TC, TG) and 546 nm (HDL-C), and the absorbance values ​​of each well were detected respectively. Using the formula:

[0053] TC / TG content (mmol / L) = [(sample OD value - blank OD value) / (calibrator OD value - blank OD value)] × calibration concentration (mmol / L);

[0054] HDL-C content (mmol / L) = {[(sample A2-sample A1)-(blank A2-blank A1)] / [(standard A2-standard A1)-(blank A2-blank A1)]}×calibrator concentration (mmol / L);

[0055] The TC, TG, and HDL-C levels in the serum of rats in different experimental groups were calculated respectively. The experiment was repeated 3 times. The results are shown in Figure 3 shown.

[0056] Compared with the Control group, the TC and TG levels in the serum of the rats in the Model group were significantly increased, and the HDL-C level was significantly decreased (P<0.01), indicating that the HFD rat model was successfully established. Compared with the Model group, the TC and TG levels in the serum of the rats in the DIAPH1-shRNA group and the Ator positive control group were significantly decreased (P<0.01), and the HDL-C level was significantly increased (P<0.01), indicating that the increase in blood lipids caused by hypercholesterolemia aggravated the risk of atherosclerosis; inhibiting the expression of DIAPH1 can improve the risk of atherosclerosis.

[0057] Example 3

[0058] Detection of inflammatory factor expression in the serum of rats in different experimental groups

[0059] After the model in Example 1 was successfully constructed, the rats were anesthetized with 10% chloral hydrate, and 2 mL of blood was collected from the medial canthal vein with a glass capillary. The whole blood sample was placed at room temperature for 1 hour, centrifuged at 3000 r / min for 10 minutes, and the supernatant was taken. ELISA detected the expression of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and IL-8 proteins in serum. The standard samples with concentrations of (320, 160, 80, 40, 20, 10, 5) pg / mL were prepared by the multiple dilution method, and standard wells, blank control wells, and serum sample wells were set. Standard samples of different concentrations were added to the standard wells, standard sample diluents were added to the blank control wells, and sera of rats from different test groups were added to the sample wells. Each sample was set up with 3 replicate wells. The enzyme-labeled solution was incubated at 37°C for 30 minutes, then washed and colored. The OD value was detected at a wavelength of 450 nm, a standard curve was drawn, and the sample concentration was calculated. The experiment was repeated 3 times. The results are as follows Figure 4 shown.

[0060] Compared with the Control group, the expression of IL-1β, IL-6, IL-8 and TNF-α in the serum of the rats in the Model group was significantly increased (P<0.01); compared with the Model group, the expression of IL-1β, IL-6, IL-8 and TNF-α in the serum of the rats in the DIAPH1-shRNA group and the Ator positive control group was significantly decreased (P<0.01). It was preliminarily confirmed that inhibiting the expression of DIAPH1 can reduce the content of inflammatory factors in serum, play a vascular protective role, and has a good inhibitory effect on the occurrence and development of hypercholesterolemia and atherosclerosis.

[0061] Example 4

[0062] Histopathological examination of liver tissues of rats in different experimental groups

[0063] After the model was successfully constructed in Example 1, 10% chloral hydrate solution (0.3 mL / 100 g) was injected intraperitoneally for anesthesia, and the rats were killed by dislocation of the neck. The liver tissues of rats in different test groups were collected and stored in liquid nitrogen. The liver tissues of the same part of each rat (0.5 cm × 0.5 cm × 0.2 cm) were taken, and the liver tissues of rats in different test groups were fixed with 4% paraformaldehyde, dehydrated with gradient ethanol, transparent with xylene, embedded in paraffin, sliced ​​with a thickness of 4 μm, developed in warm water at 40°C, scooped with a slide, baked at 60°C for 1-2 h, stained with hematoxylin-eosin (HE), and observed and photographed under a microscope.

[0064] HE staining results Figure 5 As shown in the figure, the liver lobule structure of the Control group was intact, the central vein and hepatic cord were clear, and the cell cords were neatly arranged. A large number of fat vacuoles and inflammatory cell infiltrations appeared in the liver tissue of the Model group, and the fat vacuoles and inflammatory cell infiltrations in the liver of rats in the DIAPH1-shRNA group and the Ator positive control group were significantly improved. Compared with the Control group, the lipid droplets in the HFD-induced model increased significantly, and the DIAPH1-shRNA group and the Ator positive control group significantly improved lipid accumulation, indicating that hypercholesterolemia and its complications caused liver damage and pannus formation during the occurrence and development, and inhibiting the expression of DIAPH1 could reduce liver damage and pannus formation.

[0065] Example 5

[0066] Detection of RAGE and DIAPH1 mRNA levels in the liver of rats in different experimental groups

[0067] According to the cDNA sequences of rat RAGE, DIAPH1 and GAPDH in the NCBI database, three pairs of specific primers were designed using Primer Premier 5.0 and synthesized by Shanghai Bioengineering Technology Co., Ltd., as shown in Table 2.

[0068] Table 2 Primer sequence information

[0069]

[0070]

[0071] Trizol was used to extract total RNA from rat livers in different experimental groups, and the RNA concentration and purity were detected by Nanodrop 2000. Reverse transcription system 20 μL: 5×Sprint gDNA Remover Mix 2 μL, RNA 800 ng, RNase free water to 10 μL, centrifuged after mixing, incubated at 42°C for 2 min, and cooled on ice. 5×M5 Sprint RT Mix 4 μL, RNase free water 6 μL were added to the reaction solution, and the mixture was incubated at 50°C for 5 min and 85°C for 5 s.

[0072] RT-qPCR was used to detect the expression of RAGE and DIAPH1 mRNA. The reaction system of 20 μL was as follows: 10 μL of 2×Dual SYBR green Realtime PCR Super Mix, 0.5 μL of upstream and downstream primers (10 μmol / L), 1 μL of cDNA template, and 8 μL of RNase-free water. The amplification conditions were 95°C pre-denaturation for 30 s, 95°C denaturation for 15 s, 60°C annealing for 30 s, and 72°C extension for 30 s, for 50 cycles; 2 -ΔΔCt The relative expression levels of RAGE and DIAPH1 mRNA were calculated.

[0073] RT-qPCR was used to detect the expression of RAGE and DIAPH1 mRNA levels in the liver of rats in different experimental groups in Example 4. The results are as follows Figure 6 As shown. The amplification curves of RAGE, DIAPH1 and GAPDH are S-shaped, with clear inflection points and good parallelism. The inclination of the amplification curves of the target gene and the internal reference gene are similar, indicating that the amplification efficiencies of RAGE, DIAPH1 and GAPDH are basically the same and the amplification is good. The melting curve shows a single peak, and no waveform appears at other positions, indicating that the product has good specificity and no contamination ( Figure 6 C, D, E and F).

[0074] Compared with the Control group, the expression of RAGE and DIAPH1 mRNA in the liver of rats in the Model group was extremely significantly increased (P<0.01); compared with the Model group, the expression of RAGE and DIAPH1 mRNA in the liver of rats in the DIAPH1-shRNA group and the Ator positive control group was extremely significantly decreased (P<0.01), indicating that the formation of hypercholesterolemia and its complications can be alleviated by inhibiting the abnormal activation of the RAGE / DIAPH1 signaling pathway.

[0075] Example 6

[0076] Detection of RAGE and DIAPH1 protein levels in the liver of rats in different experimental groups

[0077] The total protein of rat liver tissue in different test groups of Example 4 was extracted with RIPA lysis buffer, and the protein concentration was detected by BCA method. 40 μg protein was loaded, SDS-PAGE electrophoresis, 5% concentrated gel 80V 30min and 10% separation gel 120V 90min, constant voltage 16V 40min semi-dry transfer method was used to transfer the protein to PVDF membrane, 5% BSA was blocked at room temperature for 1h, TBST dilution source was rabbit anti-RAGE (1:1000), DIAPH1 (1:1000), GAPDH (1:5000), incubated at 4°C for 12-16h, goat anti-rabbit IgG (1:5000) was added, incubated at 20°C for 2h, TBST was washed 3 times × 10min / time, eECL was developed in the dark, and the gray value of protein bands was analyzed by ImageJ software.

[0078] The expression results of RAGE and DIAPH1 protein levels in the liver of rats in different experimental groups are as follows Figure 7 As shown in the figure, compared with the Control group, the expression of RAGE and DIAPH1 protein levels in the liver of rats in the Model group was extremely significantly increased (P<0.01); compared with the Model group, the expression of RAGE and DIAPH1 protein levels in the liver of rats in the DIAPH1-shRNA group and the Ator positive control group was extremely significantly decreased (P<0.01), which was basically consistent with the expression of RAGE and DIAPH1 mRNA levels. It further shows that by inhibiting the abnormal activation of the RAGE / DIAPH1 signaling pathway, vasodilation and / or endothelial regeneration can be promoted, liver damage and pannus formation can be reduced, and it plays an important role in liver protection, thereby reducing the occurrence and development of hypercholesterolemia and its complications.

[0079] Example 7

[0080] Analysis of the localization of RAGE and DIAPH1 in the liver of rats in different experimental groups

[0081] Immunohistochemical tests were performed on the livers of rats in different test groups in Example 4. The results are as follows: Figure 8 As shown in the figure, RAGE and DIAPH1 positive signals were expressed in the livers of rats in different experimental groups. The positive signals of RAGE and DIAPH1 in the livers of rats in the Model group were significantly enhanced compared with those in the Control group; compared with the Model group, the positive signals of RAGE and DIAPH1 in the livers of rats in the DIAPH1-shRNA group and the Ator treatment group were weakened. Targeted inhibition of the abnormal activation of the RAGE / DIAPH1 signaling pathway can reduce liver damage and the formation of pannus, and plays an important role in liver protection.

[0082] As can be seen from the above examples, the method of the present invention successfully constructed a high-fat diet-induced rat model, and for the first time revealed the mechanism of action of the RAGE / DIAPH1 signaling pathway in mediating the formation of atherosclerosis and liver damage caused by hypercholesterolemia. Targeted inhibition of abnormal activation of the RAGE / DIAPH1 signaling pathway can promote vasodilation and / or endothelial regeneration, reduce liver damage and pannus formation, and play an important role in liver protection.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a RAGE / DIAPH1 signaling pathway inhibitor in the preparation of a drug for treating hypercholesterolemia, characterized in that: The RAGE / DIAPH1 signaling pathway inhibitor includes shRNA, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.

1.

2. Use of a RAGE / DIAPH1 signaling pathway inhibitor in the preparation of a drug for treating atherosclerosis and liver damage caused by hypercholesterolemia, characterized in that: The RAGE / DIAPH1 signaling pathway inhibitor includes shRNA, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.

1.

3. A RAGE / DIAPH1 signaling pathway inhibitor shRNA, characterized in that The nucleotide sequence of the shRNA is shown in SEQ ID NO.

1.

4. An expression vector, characterized in that: The expression vector comprises a DNA fragment encoding the shRNA of claim 3 operably linked to at least one expression control sequence.

5. The expression vector according to claim 4, characterized in that The expression vector includes a virus, fungus or bacteria expression vector.

6. A cell, characterized in that The cell comprises the shRNA according to claim 3, or comprises the expression vector according to claim 4 or 5.

7. Use of the expression vector according to any one of claims 4 to 5 or the cell according to claim 6 in the preparation of a drug for treating hypercholesterolemia or atherosclerosis and liver damage caused by hypercholesterolemia.

8. A drug for treating hypercholesterolemia, characterized in that: The drug comprises the RAGE / DIAPH1 signaling pathway inhibitor shRNA according to claim 3.

Images