Application of METTL5 as a tumor immunotherapy targeting site
By using METTL5 as a target site for tumor immunotherapy, inhibiting its expression or activity, and activating cytotoxic immune cells, the problem of poor efficacy in existing tumor immunotherapy technologies is solved, achieving more effective tumor treatment.
Patent Information
- Application Number
- CN202211633338.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-19
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2042-12-19
Smart Images

Figure CN115998875B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of oncology drug technology, and in particular relates to the application of METTL5 as a target site for tumor immunotherapy. Background Technology
[0002] A tumor is a new growth formed by the proliferation of local tissue cells under the influence of various carcinogenic factors. Because these new growths often present as space-occupying, mass-like protrusions, they are also called growths. Tumors are divided into two main categories: benign tumors and malignant tumors. Malignant tumors can be further divided into carcinomas and sarcomas. Carcinomas are malignant tumors originating from epithelial tissue. Sarcomas refer to mesenchymal tissue, including fibrous connective tissue, fat, muscle, blood vessels, bone, and cartilage.
[0003] The treatment of malignant tumors has always been a global challenge. In recent years, with the emergence of tumor immunotherapy, the prognosis of cancer patients has improved to some extent. Tumor immunotherapy utilizes the body's own immune system to fight and eliminate tumor cells, thereby achieving the goal of treating tumors. In particular, immune checkpoint inhibitors targeting PD-1 and PD-L1 have shown good results in cancer patients, and the survival time of some patients has been extended. However, tumor immunotherapy faces a long-standing unresolved challenge: currently, less than 30% of cancer patients respond to immunotherapy. For the vast majority of cancer patients, the effect of tumor immunotherapy is not ideal, indicating that developing new immunotherapeutic targets is of great significance for further improving the prognosis of cancer patients.
[0004] CD8 + T cells and NK cells are cytotoxic immune cells that exert their anti-tumor immune effects by directly killing tumor cells. Studies have shown that the infiltration of T cells and NK cells in solid tumors is not only positively correlated with patient prognosis but is also a key factor affecting the efficacy of tumor immunotherapy. Tumor cells, through endogenous regulatory mechanisms, enable the infiltration of CD8+ cells... + The reduction of T cells and NK cells, and the suppression of their activation, thereby disrupting CD8. + T cells and NK cells play an effective role in anti-tumor immune defense. Therefore, it is important to explore the regulation of CD8 in tumors. + New genes that activate T cells and NK cells will provide new targets for tumor immunotherapy, which will facilitate the development and use of tumor immunotherapy drugs. Summary of the Invention
[0005] The purpose of this application is to provide an application of METTL5 as a target site for tumor immunotherapy, aiming to solve the problem of the lack of new gene targets in the existing technology to improve the efficacy of tumor immunotherapy, which in turn affects the preparation and use of tumor immunotherapy drugs.
[0006] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows:
[0007] In the first aspect, this application provides the use of METTL5 as a target site for tumor immunotherapy, and the base sequence of METTL5 is shown in SEQ ID No. 1.
[0008] Further applications include using METTL5 as a target for tumor immunotherapy to prepare drugs for the prevention or treatment of tumors.
[0009] Furthermore, the drugs include promoters for tumor immunotherapy.
[0010] Further applications include using METTL5 as a target for tumor immunotherapy to activate cytotoxic immune cells during immunotherapy.
[0011] Furthermore, the mechanism by which METTL5 is used as a target for tumor immunotherapy is as follows: by inhibiting METTL5 expression, the translation of IL-27 is downregulated, thereby activating cytotoxic immune cells to exert their effects.
[0012] Furthermore, the drug also includes cytokines; among which, cytokines include at least one of FasL, TNFα, IFNγ, and IFNβ.
[0013] Secondly, this application provides the role of reagents that inhibit METTL5 expression or activity in the preparation of drugs for tumor immunotherapy.
[0014] Furthermore, the drug includes at least one of the following: drugs that inhibit tumor cell growth, drugs that enhance the killing power of tumor cells, drugs that prolong the survival time of tumor organisms, and drugs that increase the presentation of tumor cell surface antigens.
[0015] Thirdly, this application provides the use of tumor cells lacking METTL5 in the preparation of drugs for tumor immunotherapy.
[0016] Fourthly, this application provides a combination drug for tumor immunotherapy, the combination drug including drugs that inhibit the expression of the METTL5 gene, inhibit the expression of the METTL5 protein, or reduce the activity of the METTL5 protein, as well as cytokines.
[0017] Furthermore, drugs also include pharmaceutically acceptable excipients.
[0018] The first aspect of this application provides the application of METTL5 as a target site for tumor immunotherapy. METTL5 is a novel RNA m 6 A-methyltransferase, involved in catalyzing the m-transferase at position A1832 on 18S rRNA. 6The 18S A1832 site, located in the ribosome's compilation center, is closely related to the normal functioning of the ribosome. Proteomics analysis revealed that METTL5 can control the translation of IL-27, a key regulator of tumor immunity. Therefore, using METTL5 as a target site for tumor immunotherapy, by inhibiting the expression of METTL5-related genes or encoded proteins, can effectively stimulate the body's anti-tumor immunity, making METTL5 a target site that can enhance the response rate of tumor immunotherapy. Using METTL5 as a tumor therapeutic target has broad application prospects in anti-tumor immunotherapy.
[0019] The role of the reagents for inhibiting METTL5 expression or activity provided in the second aspect of this application in the preparation of drugs for tumor immunotherapy is promising because the reagents for inhibiting METTL5 expression or activity can effectively stimulate the body's anti-tumor immunity, making METTL5 a target site that can enhance the response rate of tumor immunotherapy.
[0020] The application of METTL5-deficient tumor cells in the preparation of drugs for tumor immunotherapy provided in the third aspect of this application is beneficial because METTL5-deficient tumor cells can inhibit the expression of METTL5-related genes or encoded proteins, and can effectively stimulate the body's anti-tumor immunity.
[0021] The fourth aspect of this application provides a combination drug for tumor immunotherapy, comprising drugs that inhibit the expression of the METTL5 gene, inhibit the expression of the METTL5 protein, or reduce the activity of the METTL5 protein, as well as cytokines; by inhibiting the expression of METTL5-related genes or encoded proteins, the combination drug effectively stimulates the body's anti-tumor immunity and improves the efficacy of tumor immunotherapy. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 This is a schematic diagram of the changes in nucleic acid modification caused by sgRNA targeting the Mettl5 gene locus in mice and the deletion of Mettl5, provided in the embodiments of this application;
[0024] Figure 2This is a graph showing the quantitative analysis of the whole proteome of wild-type and Mettl5 knockout cell lines using quantitative mass spectrometry, as provided in the embodiments of this application.
[0025] Figure 3 These are the growth curves and final tumor weight analysis diagrams of the tumors after subcutaneous injection of Mettl5-deficient and wild-type B16-F10 tumor cells in C57BL / 6N mice, as provided in the embodiments of this application.
[0026] Figure 4 The images provided in this application are the tumor growth curves and final tumor weight analysis diagrams after subcutaneous injection of Mettl5-deficient and wild-type B16-F10 tumor cells into C57BL / 6N mice in combination with PD-1 treatment.
[0027] Figure 5 The immunohistochemical analysis provided in this application describes the CD8+ levels in the tumor cells of C57BL / 6N mice 20 days after subcutaneous inoculation with Mettl5-deficient and wild-type B16-F10 tumor cells. + Analysis diagram of T cell infiltration;
[0028] Figure 6 This is a flow cytometry analysis of immune cell infiltration in C57BL / 6N mice 20 days after subcutaneous inoculation with Mettl5-deficient and wild-type B16-F10 tumor cells, provided in the embodiments of this application. Detailed Implementation
[0029] To make the technical problems, technical solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0030] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.
[0031] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c", can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.
[0032] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.
[0033] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms "a" and "the" as used in the embodiments of this application and the appended claims are also intended to include the plural forms, unless the context clearly indicates otherwise.
[0034] The weights of the relevant components mentioned in the embodiments of this application can refer not only to the specific content of each component, but also to the proportional relationship between the weights of the components. Therefore, any scaling up or down of the content of the relevant components according to the embodiments of this application is within the scope disclosed in the embodiments of this application. Specifically, the mass in the embodiments of this application can be a well-known unit of mass in the chemical industry, such as μg, mg, g, or kg.
[0035] The terms "first" and "second" are used for descriptive purposes only, to distinguish objects, such as substances, from one another, and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. For example, without departing from the scope of the embodiments of this application, "first XX" may also be referred to as "second XX," and similarly, "second XX" may also be referred to as "first XX." Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of that feature.
[0036] The first aspect of this application provides the application of METTL5 as a target site for tumor immunotherapy, and the base sequence of METTL5 is shown in SEQ ID No. 1.
[0037] The application of METTL5 as a target site for tumor immunotherapy provided in the first aspect of this application is as follows: METTL5 is a novel RNA m6A methyltransferase that participates in the catalysis of m6A formation at position A1832 on 18S rRNA. The 18S A1832 position is located in the ribosome's compilation center and is closely related to ribosomal translation function. Through proteomics analysis, it was found that METTL5 can control the translation of IL-27, a key regulator of tumor immunity. Therefore, using METTL5 as a target site for tumor immunotherapy, by targeting and inhibiting the expression of METTL5-related genes or encoded proteins, can effectively stimulate the body's anti-tumor immunity, making METTL5 a target site that can enhance the response rate of tumor immunotherapy. Using METTL5 as a tumor treatment target has broad application prospects in anti-tumor immunotherapy.
[0038] In some embodiments, the base sequence of METTL5 is as shown in SEQ ID No. 1, which specifically consists of:
[0039] gtacttccggcactgcggggagggaccgcgaggaccagctagaggcatacgagtgctttcctggagcgtctgggttcc
[0040] acgggcggcgatccccgcgaggctcgtggggatcccctcgctgagtcctaaatagtctgtccccgaccctccaccccacc
[0041] cccaccctgcaccgctggggagtttcgggttaggtagacttccctgcagctcccgtgctgtgaagccccaggagcccaa
[0042] actttaaaatacagagaaaacgatgaagaagttaaagcttaaggaactagagagtcgcctgcaagaagtggatggattcg
[0043] aaaagcccaagttatacttctagaacagtatcccaccaggccgcacattgcagcatgcatgctttatacaatccataacacata
[0044] cgatgacattgaaaacaaagcggttgcagatctaggatgtggctgtggagtacttagcatcggagcggcaatgctagga
[0045] gcagggttgtgtgttggatttgacatagatgaagatgcactggaaatatttaataagaatgtggaagagtttgagctaacaa
[0046] atgttgatatgattcagtgtgatgtgtactcattatctaacagaatgtccaagttatttgatacagtaattatgaatcctccctttg
[0047] ggaccaaaaataataaagggacagatatggcttttctgaagactgctttgggaatggcaagaacagcagtatattctttaca
[0048] caagtcctcaactagggaacatattcaaaagaaagctgctgaatggaaagtcaagatagaaattattgcagagcttcgata
[0049] tgatctaccagcattatacaactttcataaaaagaaatctgtggacatcgaagtggacctaattcgcttttctttttaaaagcttctgaagacaaaaagcagcttaaaatctaactaaggaataaaaacactgcttactaaataaactacttgtctctagca.
[0050] In some embodiments, the application of METTL5 as a target site for tumor immunotherapy enhances the killing power against tumor cells by combining it with immune checkpoint therapy. This includes the killing power of cytokines or combinations of cytokines against tumor cells and the killing power of immune cells against tumor cells. Among these, immune cells include tumor-killing cells such as CTL, TH, and NK cells, and cytokines include FasL, TNFα, IFNγ, or IFNβ. The combination of cytokines includes two or more of FasL, TNFα, IFNγ, and IFNβ.
[0051] In some embodiments, the application of METTL5 as a target site for tumor immunotherapy can help inhibit tumor cell growth by targeting METTL5. Inhibition of tumor cell growth includes promoting tumor cell apoptosis, inhibiting tumorigenesis, and allowing tumor cells to be cleared by the immune system.
[0052] In some embodiments, the application includes: using METTL5 as a tumor immunotherapy target to prepare drugs for the prevention or treatment of tumors. Because using METTL5 as a tumor immunotherapy target can promote the development of tumor immunotherapy-related drugs, the developed drugs for the prevention or treatment of tumors can effectively stimulate the body's anti-tumor immunity by inhibiting METTL5 expression and affecting global mRNA translation. This makes METTL5 a target site that can enhance the response rate of tumor immunotherapy, and using METTL5 as a tumor therapeutic target has broad application prospects in anti-tumor immunotherapy.
[0053] In some embodiments, the drug includes a promoter for tumor immunotherapy. In practical use, a drug for the prevention or treatment of tumors prepared with METTL5 as a target for tumor immunotherapy can be used as a promoter in combination with other tumor immunotherapy drugs to enhance the efficacy of tumor immunotherapy.
[0054] In some embodiments, the application includes: using METTL5 as a tumor immunotherapy target to activate cytotoxic immune cells in immunotherapy.
[0055] In some embodiments, the mechanism by which METTL5 is used as a target for tumor immunotherapy is as follows: by inhibiting the expression of the METTL5 gene, downregulating the translation of IL-27 factor, and activating cytotoxic immune cells to exert their effects.
[0056] In some embodiments, cytotoxic immune cells include NK cells, CD8 cells, etc. + At least one of the following in T cells.
[0057] In some embodiments, the dosage form of the drug is selected from at least one of tablets, capsules, granules, pills, injections, suspensions, dispersants, and syrups. However, the dosage form of the drug of the present invention is not limited to this, and other achievable dosage forms are within the scope of protection of the present invention.
[0058] In some embodiments, the medicament further includes pharmaceutical excipients. The addition of pharmaceutically acceptable excipients to the medicament ensures the preparation and clinical application of the resulting medicament. In some specific embodiments, the pharmaceutical excipients are selected from at least one of diluents, wetting agents, binders, lubricants, colorants, and coating agents. In some embodiments, the addition of diluents is primarily for increasing the weight and volume of the medicament to facilitate shaping and dispensing. In a preferred embodiment of the invention, the diluent is selected from, but not limited to, at least one of starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol, and microcrystalline cellulose. In some embodiments, the addition of wetting agents wets the material to produce sufficient viscosity to facilitate granulation. In a preferred embodiment of the invention, the wetting agent is selected from, but not limited to, at least one of water, ethanol, and glycerol. In some embodiments, the addition of binders aggregates and binds non-viscous or less viscous materials into granules. In a preferred embodiment of the invention, the binder is selected from, but not limited to, at least one of hydroxypropyl methylcellulose (HPMC), povidone (PVP), starch paste, and syrup. In some embodiments, coating agents and colorants are added to improve tablet appearance, increase drug stability, mask unpleasant drug odor, and alter particle appearance. In a preferred embodiment of the invention, the coating agent is selected from, but is not limited to, at least one of acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; the colorant is selected from, but is not limited to, at least one of titanium dioxide, sunset yellow, and methylene blue.
[0059] In some embodiments, a tumor includes a primary tumor and a metastatic tumor.
[0060] In some embodiments, tumors include malignant cancers such as melanoma, breast cancer, liver cancer, colon cancer, and lung cancer.
[0061] The second aspect of this application provides the role of reagents that inhibit METTL5 expression or activity in the preparation of medicaments for tumor immunotherapy.
[0062] The role of the reagents for inhibiting METTL5 expression or activity provided in the second aspect of this application in the preparation of drugs for tumor immunotherapy is that, since the reagents for inhibiting METTL5 expression or activity can effectively stimulate the body's anti-tumor immunity, making METTL5 a target site that can enhance the response rate of tumor immunotherapy, the reagents for inhibiting METTL5 expression or activity have broad application prospects in the preparation of drugs for tumor immunotherapy.
[0063] In some embodiments, the drug includes at least one of the following: a drug that inhibits tumor cell growth, a drug that enhances the killing power of tumor cells, a drug that prolongs the survival time of the tumor organism, and a drug that increases the presentation of tumor cell surface antigens.
[0064] The third aspect of this application provides the use of tumor cells lacking METTL5 in the preparation of medicaments for tumor immunotherapy.
[0065] The application of tumor cells lacking METTL5 provided in the third aspect of this application in the preparation of drugs for tumor immunotherapy is beneficial because tumor cells lacking METTL5 can inhibit the expression of METTL5-related genes or encoded proteins, and can effectively stimulate the body's anti-tumor immunity.
[0066] The fourth aspect of this application provides a drug for tumor immunotherapy, wherein the drug is a drug that inhibits the expression of the METTL5 gene, inhibits the expression of the METTL5 protein, or reduces the activity of the METTL5 protein.
[0067] The fourth aspect of this application provides a combination drug for tumor immunotherapy, which includes drugs that inhibit the expression of the METTL5 gene, inhibit the expression of the METTL5 protein, or reduce the activity of the METTL5 protein, as well as cytokines; by inhibiting the expression of METTL5-related genes or encoded proteins, the combination drug effectively stimulates the body's anti-tumor immunity and improves the efficacy of tumor immunotherapy.
[0068] In some embodiments, suppressing the expression of the METTL5 gene is achieved by gene editing to induce base insertion mutations, base deletion mutations, non-synonymous base mutations, or complete gene loss in the METTL5 gene.
[0069] In some embodiments, the agents for inhibiting the expression of the METTL5 gene include RNA molecules that interfere with the METTL5 gene.
[0070] In some embodiments, reagents that inhibit the expression of METTL5 protein or eliminate the activity of METTL5 protein include METTL5 protein antibodies or METTL5 protein small molecule inhibitors.
[0071] In some embodiments, the cytokines include FasL, TNFα, IFNγ, or IFNβ; the combination of cytokines includes two or more of FasL, TNFα, IFNγ, and IFNβ.
[0072] In some embodiments, the medicament further includes pharmaceutically acceptable excipients. The addition of pharmaceutically acceptable excipients to the medicament ensures the preparation and clinical application of the resulting medicament. In some specific embodiments, the pharmaceutical excipients are selected from at least one of diluents, wetting agents, binders, lubricants, colorants, and coating agents. In some embodiments, the addition of diluents is primarily for increasing the weight and volume of the medicament to facilitate shaping and dispensing. In a preferred embodiment of the invention, the diluent is selected from, but not limited to, at least one of starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol, and microcrystalline cellulose. In some embodiments, the addition of wetting agents wets the material to produce sufficient viscosity to facilitate granulation. In a preferred embodiment of the invention, the wetting agent is selected from, but not limited to, at least one of water, ethanol, and glycerol. In some embodiments, the addition of binders aggregates and binds non-viscous or less viscous materials into granules. In a preferred embodiment of the invention, the binder is selected from, but not limited to, at least one of hydroxypropyl methylcellulose (HPMC), povidone (PVP), starch paste, and syrup. In some embodiments, coating agents and colorants are added to improve tablet appearance, increase drug stability, mask unpleasant drug odor, and alter particle appearance. In a preferred embodiment of the invention, the coating agent is selected from, but is not limited to, at least one of acrylic resin, hydroxypropyl methylcellulose, povidone, and cellulose acetate; the colorant is selected from, but is not limited to, at least one of titanium dioxide, sunset yellow, and methylene blue.
[0073] The following description is based on specific embodiments.
[0074] Example 1
[0075] We constructed B16-F10 (mouse melanoma cells) and 4T1 (mouse breast cancer cells) cell lines with Mettl5 knockout and detected changes in RNA epigenetic modifications in Mettl5-deficient and wild-type B16-F10 cells; and used proteomic methods to perform quantitative analysis of the whole proteome of wild-type and Mettl5 knockout cell lines.
[0076] The specific experimental steps are as follows:
[0077] 1. Using CRISPR-Cas9 technology, the target plasmids of Cas9 and Mettl5sgRNA were transiently loaded into B16-F10 and 4T1 cells, respectively.
[0078] 1.1. Design sgRNA sequences, with coding sequences sgRNA1 and sgRNA2. The sequence of sgRNA1 is shown in SEQ.ID No. 2, and the sequence of sgRNA2 is shown in SEQ.ID No. 3:
[0079] sgRNA1, as shown in SEQ ID No. 2, is: AGCATCGGAGCGGCAATGCT.
[0080] sgRNA2, as shown in SEQ ID No. 3, is: CCCTTGGGACCAAAAATAA.
[0081] 1.2. In vitro culture of B16-F10 and 4T1 cell lines, with cells pre-cultured at 4×10⁻⁶ cells / year. 5 Cells were seeded per well in 6-well cell culture plates and cultured overnight at 37°C in a 5% CO2 incubator. On the second day, when the cells were fully adhered and the confluence was about 70%, they were briefly transfected. The reaction system and steps are shown in Table 1 below:
[0082] Table 1
[0083]
[0084]
[0085] 1.3. Flow sorting
[0086] 1) Successful cell transfection was confirmed by fluorescence microscopy 48 hours later;
[0087] 2) Simultaneously digest the successfully transfected cells and untreated cells into a single-cell suspension, then centrifuge at 1000 rpm for 5 min at room temperature. After centrifugation, remove the trypsin in the supernatant, resuspend the cells in 300 μL of complete culture medium and transfer them to flow cytometry tubes.
[0088] 3) Spread the complete culture medium containing 2% double antibiotics into a 96-well plate, place the cells and the 96-well plate on ice and transfer to a flow cytometry chamber;
[0089] 4) Using FACS Aria (instrument model), sort individual cells into 96-well plates according to the instrument's instruction manual;
[0090] 5) After sorting, continue to incubate at 37°C in a 5% CO2 incubator until single clones are formed.
[0091] 1.4. Preliminary identification of gene editing in monoclonal cells
[0092] 1) Design identification primers Mettl5 F and Mettl5 R for the edited region, wherein the sequence of Mettl5 F is shown in SEQ ID No. 4, and the sequence of Mettl5 R is shown in SEQ ID No. 5:
[0093] Mettl5 F (SEQ. ID No. 4): ATGCATGCTTTATACAATC.
[0094] Mettl5 R (SEQ. ID No. 5):AAATGACAACCCAGATCAC.
[0095] 2) Lyse monoclonal cells to obtain the genome:
[0096] Add 40 μL of NaOH (50 mM)-EDTA solution, boil at 98 °C for 8 min, then add 40 μL of Tris-HC (50 mM) for neutralization, vortex to mix, centrifuge, and then use 1 μL of the lysis product for PCR amplification of specific sequences. The reaction system and conditions are shown in Table 2 below:
[0097] Table 2
[0098]
[0099] 3) Perform first-generation sequencing on PCR products.
[0100] 1.5. Select the successfully edited single clones identified by the first sequencing, and further refine the TA clones to confirm that all sister chromosomes have been edited. The reaction system and specific steps are as follows:
[0101] 1) The reaction system is shown in Table 3.
[0102] Table 3
[0103]
[0104]
[0105] 2) Add 5 μL (equal volume) of Solution I;
[0106] 3) React at 16℃ for 30 minutes;
[0107] 4) Add the total volume (10 μL) to 50 μL of Top10 competent cells and place on ice for 30 min;
[0108] 5) Heat at 42℃ for 45 seconds, then place in ice for 1 minute;
[0109] 6) Add 500 μL of antibiotic-free culture medium and incubate at 37°C with shaking for 60 min;
[0110] 7) Incubate on L-agar plates containing Amp to form single colonies;
[0111] 8) Select 20 single-clone colonies, amplify them using PCR (system, conditions as above) and sequence them.
[0112] 2. Changes in RNA epigenetic modifications in wild-type and Mettl5 knockout cells were detected by liquid chromatography-tandem mass spectrometry.
[0113] 2.1. Total RNA extraction
[0114] 1) Adherent cells: Discard the culture medium, wash the cells once with PBS buffer, every 5-10 x 10^6 times. 6 Add 1 mL of Trizol reagent to each cell and incubate on ice for 5 min.
[0115] 2) Add 0.2 volume of chloroform (0.2 mL), mix thoroughly by inverting, incubate on ice for 1-5 min, the solution will begin to separate phases, centrifuge at 12,000 g, 4 degrees for 10 min, and take the upper aqueous phase (0.5 mL);
[0116] 3) Add an equal volume of isopropanol (0.5 mL) to the supernatant and mix thoroughly. Centrifuge at 12,000 g, 4 °C for 10 min. A small amount of RNA precipitate will be visible at the bottom of the tube. Discard the supernatant.
[0117] 4) Immediately add 1 mL of 75% ethanol, invert and mix several times to wash the precipitate, centrifuge at 12,000 g, 4 °C for 5 min, and discard the supernatant;
[0118] 5) Open the tube and air dry for 5-10 minutes to allow the residual liquid to evaporate. Dissolve the precipitate with 20 μL of DEPC.
[0119] 2.2. RNA restriction enzyme digestion
[0120] 1) RNA was cleaved into single bases using enzymes. The reaction system is shown in Table 4 below:
[0121] Table 4
[0122] nuclease P1 1μL phosphatase 1μL 10x Phosphatase Buffer 2μL RNA 200ng ddH2O up to 20μL
[0123] 2) Incubate overnight at 37°C;
[0124] 3) Dilute the sample to 100 μL and centrifuge at 12,000 g for 1 min, then transfer the supernatant to the sample loading tube;
[0125] 4) Load 5 μL of solution into a liquid chromatography-tandem mass spectrometer (LC-MS / MS, Agilent 6410 QQQ triple quadrupole mass spectrometer);
[0126] Nucleosides were quantified by using retention times at 282.1–150.1 (m6A) and 268–136 (A) and the mass transition from nucleoside to base ion.
[0127] Example 2
[0128] Female SPF-grade nude mice, C57BL / 6N mice, and Balb / c mice were used as experimental subjects. Tumor-bearing mouse models were constructed using Mettl5-deficient and wild-type B16-F10 and 4T1 tumor cells, respectively, and combined with PD-1 immunotherapy. Tumor growth, final tumor weight, and tumor anatomy were assessed. The specific experimental steps are as follows:
[0129] 1. Mettl5-deficient and wild-type B16-F10 tumor cells were subcutaneously injected into C57BL / 6N mice, with each mouse receiving a subcutaneous injection of 2.5 × 10⁻⁶ cells. 5 One cell;
[0130] 2. Starting from day 0 after subcutaneous inoculation, tumor volume is measured from day 11 onwards, and measured every 2 days.
[0131] 3. On day 20, tumor-bearing mice were euthanized (cervical dislocation), and the tumor was bluntly dissected using surgical scissors such as ophthalmic scissors (aseptic). The final tumor weight and size were measured and recorded.
[0132] 4. C57BL / 6N mice were subcutaneously inoculated with Mettl5-deficient and wild-type B16-F10 tumor cells, with each mouse receiving a subcutaneous injection of 2.5 × 10⁻⁶ cells. 5 One cell;
[0133] 5. PD-1 was administered subcutaneously at 100 μg / animal on days 4, 7, 10, 13, and 16. Tumor volume was measured starting on day 10, every two days. A tumor volume exceeding 2000 mm² was considered a threshold. 2 The survival status of mice in each group was recorded as the mortality standard.
[0134] 6. Balb / c mice were subcutaneously inoculated with Mettl5-deficient and wild-type 4T1 tumor cells. Each mouse was injected subcutaneously with 5 × 10⁶ cells. 5 One cell;
[0135] 7. PD-1 was administered subcutaneously at 100 μg / animal on days 4, 7, and 10. Tumor volume was measured starting on day 7, every two days. A tumor volume exceeding 2000 mm² was considered a threshold. 2 The survival status of mice in each group was recorded as the mortality standard.
[0136] Example 3
[0137] A mouse tumor-bearing model was constructed according to the method in Example 2. Immunohistochemistry and flow cytometry were used to detect the infiltration of immune cells in the spleen and tumor tissue of the experimental mice. The experimental steps are as follows:
[0138] 1. Obtain tumor tissue for immunohistochemistry. The specific steps are as follows:
[0139] 1.1. Euthanize the tumor-bearing mice (cervical dislocation) and bluntly dissect the tumors using surgical scissors such as ophthalmic scissors (aseptic);
[0140] 1.2. The isolated tumor was placed in HBSS solution (sterile), and the tumor was weighed and recorded; then it was placed in 4% paraformaldehyde solution;
[0141] 1.3. Rinsing: After fixing with 4% paraformaldehyde solution for 24 hours, remove the material from the fixative and rinse it several times in 70% alcohol, adding a few drops of ammonia to the alcohol until the yellow color is removed.
[0142] 1.4. Dehydration: 70% alcohol → 80% alcohol → 90% alcohol → 95% alcohol → anhydrous ethanol I → anhydrous ethanol II;
[0143] 1.5. Transparent: Anhydrous ethanol and xylene solution (1:1) → Xylene I → Xylene II;
[0144] 1.6. Paraffin Impregnation: The entire paraffin impregnation process should be carried out in a constant temperature device, with the temperature chamber set to 58℃. The paraffin impregnation process involves a 1:1 mixture of xylene and paraffin wax → paraffin I → paraffin II. The impregnation must be thorough; otherwise, residual clearing agent in the tissue will cause difficulties in the sectioning process and affect the quality of the sections.
[0145] 1.7. Embedding: Molten paraffin is injected into a container, and the paraffin-impregnated tissue block is placed inside. The paraffin block is then allowed to cool and harden rapidly, allowing the tissue block to be preserved for a long period of time within the paraffin.
[0146] 1.8. Sectioning: After correction, the embedded tissue block is sectioned into 5-7 μm paraffin strips using a microtome;
[0147] 1.9. Attaching the slide: Spread the paraffin tissue strip in warm water at 50°C, then pick up the slide with a glass slide that has been cleaned with 1% hydrogen chloride solution, and the tissue strip will adhere to the glass slide;
[0148] 1.10. Drying the slides: Place the glued glass slides in an oven at about 35℃ and dry them for 2-3 hours;
[0149] 1.11. Dewaxing: Paraffin sections were placed in an oven at 67°C and dried for 2 hours. The sections were dewaxed to water and rinsed three times with PBS at pH 7.4 for 3 minutes each time (3×3').
[0150] 1.12. Antigen retrieval: Take a certain amount of pH=6.0 citrate buffer, add it to a microwave box, microwave until boiling, place the dewaxed and hydrated tissue sections on a heat-resistant plastic slide holder, put them into the boiling buffer, microwave on medium speed for 10 min, remove the microwave box and let it cool naturally under running water, remove the slides from the buffer, rinse them twice with distilled water, and then rinse them 2×3' with PBS;
[0151] 1.13. Remove the PBS solution, add 1 drop of the corresponding primary antibody (at the appropriate dilution) to each slide, and incubate at room temperature for 2 hours;
[0152] 1.14. Rinse with PBS 3×5'. Remove the PBS solution, add 1 drop of polymer enhancer (reagent A) to each slide, and incubate at room temperature for 20 min. Rinse with PBS 3×3'.
[0153] 1.15. Remove the PBS solution, add 1 drop of enzyme-labeled anti-mouse / rabbit polymer (reagent B) to each slide, and incubate at room temperature for 30 min. Rinse with PBS 3×5'.
[0154] 1.16. Remove the PBS solution, add 1 drop of freshly prepared DAB solution to each slide, and observe under a microscope for 5 minutes;
[0155] 1.17. Hematoxylin counterstaining, differentiation with 0.1% HCl, rinsing with tap water, bluing, dehydrating and drying sections with gradient alcohols, clearing with xylene, mounting with neutral resin, and observing after drying.
[0156] 2. Flow cytometry analysis was performed on tumor tissue and spleen. The specific steps are as follows:
[0157] 2.1. Euthanize the tumor-bearing mice (cervical dislocation) and bluntly dissect the tumors using surgical scissors such as ophthalmic scissors (aseptic);
[0158] 2.2. Place the isolated tumor in HBSS solution (sterile), weigh the tumor and record the weight;
[0159] 2.3. Using sterile surgical scissors, cut the tumor tissue preserved in HBSS solution into tiny tissue particles (1mm to 3mm);
[0160] 2.4. Add the corresponding collagenase type IV solution and digest at 37°C for approximately 30 to 45 minutes.
[0161] 2.5. The digested tumor tissue was filtered and ground using a 100 μM cell sieve, and the collagenase type IV solution was terminated by adding 5 times the volume of PBS.
[0162] 2.6. Centrifuge the tumor suspension after digestion has been terminated at 4°C, 400g, for 5 minutes to obtain cell pellet;
[0163] 2.7. Lyse the cell pellet with red blood cell lysis buffer, resuspend in 4 mL ACK solution, lyse for 4 min, and then add 5 times the volume of PBS to terminate the lysis.
[0164] 2.8. Centrifuge the tumor suspension containing the terminated lysed red blood cells at 4°C, 400g, for 5 minutes to obtain cell pellet;
[0165] 2.9. Based on the tumor size (mass), add the corresponding volume of PBS (containing 0.5% BSA) to resuspend and count the tumors;
[0166] 2.10. Take 1×10⁶ to 1×10⁷ cells and transfer them to flow cytometry tubes. Centrifuge at 4°C, 400g, for 5 min to obtain cell pellet.
[0167] 2.11. Prepare 50 μL of antibody blocking solution (containing the inactivated / deactivated dye Zombie), resuspend each tumor sample, and block for 10-15 min;
[0168] 2.12. Add 50 μL of the prepared antibody-mixed staining solution to each blocked tumor sample, for a total staining volume of 100 μL. The staining time is 30 min-45 min.
[0169] 2.13. Add 2 mL of PBS (containing 0.5% BSA) to stop staining, centrifuge at 4°C, 400g, for 5 min to obtain cell pellet;
[0170] 2.14.2 mL of PBS (containing 0.5% BSA) was used to resuspend the cells, and the cells were centrifuged at 400 g for 5 min at 4 °C to obtain the cell pellet.
[0171] 2.15. The cell pellet was resuspended in 500 μL PBS (containing 0.5% BSA) solution for flow cytometry analysis.
[0172] Property Analysis and Results Explanation
[0173] Figure 1 The results of Example 1 show that RNA m in Mettl5 KO1 and KO2 cells 1 The reduction in A modification indicates that the B16-F10 (mouse melanoma cells) and 4T1 (mouse breast cancer cells) cell lines with Mettl5 knockout have been successfully constructed.
[0174] Figure 2 The results of Example 1 show that the IL-27 protein level changed significantly after Mettl5 knockout, indicating that Mettl5 may affect the tumor immune microenvironment by regulating the expression of IL-27.
[0175] Figure 3 The results of Example 2 show that, compared with wild-type B16-F10 tumor cells, B16-F10 tumor cells with Mettl5 deficiency grew more slowly under the skin of C57BL / 6N mice, suggesting that Mettl5 deficiency can delay tumor cell growth in vivo.
[0176] Figure 4 As shown in Example 2, in a tumor-bearing model, the combined effect of Mettl5-deficient B16-F10 tumor cells and PD-1 therapy was better than that of B16-F10 tumor cells alone, suggesting that inhibiting METTL5 can enhance the response rate of tumor immunotherapy; and this effect was verified in 4T1 tumors.
[0177] Figure 5 As shown in Example 3, immunohistochemical results indicated that 20 days after subcutaneous inoculation of C57BL / 6N mice with Mettl5-deficient and wild-type B16-F10 tumor cells, the CD8+ levels in the Mettl5-deficient tumor cells were significantly lower than those in the wild-type B16-F10 tumor cells. + Increased T cell infiltration suggests that inhibiting METTL5 can enhance CD8. + T-cell intratumoral infiltration enhances tumor killing; and this effect has been verified in 4T1 tumors.
[0178] Figure 6 As shown in the experimental results of Example 3, flow cytometry analysis revealed that 20 days after subcutaneous inoculation of Mettl5-deficient and wild-type B16-F10 tumor cells into C57BL / 6N mice, the CD8+ levels in the Mettl5-deficient tumor cells were significantly lower. + Increased T and NK cell infiltration suggests that inhibiting METTL5 can enhance the infiltration of cytotoxic immune cells into the tumor and enhance tumor killing.
[0179] In summary, this application provides the application of METTL5 as a target site for tumor immunotherapy. METTL5 is a novel RNAm... 6 A-methyltransferase, involved in catalyzing the m-transferase at position A1832 on 18S rRNA. 6 The 18S A1832 site, located in the ribosome's compilation center, is associated with ribosome function. Proteomics analysis revealed that METTL5 can regulate the translation of IL-27, a key regulator of tumor immunity. Therefore, using METTL5 as a target site for tumor immunotherapy, by inhibiting the expression of METTL5-related genes or encoded proteins, can effectively stimulate the body's anti-tumor immunity, making METTL5 a target site that can enhance the response rate of tumor immunotherapy. Using METTL5 as a tumor treatment target has broad application prospects in anti-tumor immunotherapy.
[0180] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. The use of a reagent for inhibiting METTL5 gene expression in the preparation of a drug for tumor immunotherapy, wherein the drug activates cytotoxic immune cells by inhibiting METTL5 gene expression and downregulating IL-27 translation, wherein the base sequence of METTL5 is shown in SEQ ID No. 1; wherein, The tumor is melanoma; the reagent is sgRNA, the sequence of which is selected from: sgRNA1: 5'- AGCATCGGAGCGGCAATGCT-3'; sgRNA2: 5'-CCCTTTGGGACCAAAAATAA-3'.
2. A combination drug for tumor immunotherapy, characterized in that, The combination drug comprises the sgRNA of claim 1, and cytokines selected from TNFα and IFNγ, and the combination drug treats melanoma by inhibiting METTL5 expression and enhancing the immune response.
3. The drug according to claim 2, characterized in that, The drug also includes pharmaceutically acceptable excipients.