Gene variant of transcriptional regulator lysg, and method for producing l-citrulline or l-arginine using same

Mutating the LysG gene in Corynebacterium strains to modulate protein expression effectively increases L-citrulline and L-arginine production by up to 50% through optimized genetic engineering, addressing inefficiencies in existing production methods.

WO2026043346A1PCT designated stage Publication Date: 2026-02-26DAESANG CORP
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/095018
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-20
Filing Date
2025-03-20
Publication Date
2026-02-26

AI Technical Summary

Technical Problem

Existing methods for producing L-citrulline and L-arginine in microorganisms face challenges in efficiently increasing production levels due to the complex biosynthetic process involving various proteins such as enzymes, transcription factors, and transport proteins, with limited success in enhancing yields through genetic modifications.

Method used

Introduction of a transcription regulator LysG gene variant with specific base mutations (C78A and/or G138A) in Corynebacterium strains, integrated into a recombinant vector and transformant, to modulate the expression of proteins involved in L-citrulline and L-arginine synthesis.

Benefits of technology

The mutations in the LysG gene enhance the production of L-citrulline and L-arginine by up to 50% or more compared to parent strains, improving cell mass, fermentation yield, and carbon recovery rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTKR2025095018-APPB-IMG-000001
    Figure PCTKR2025095018-APPB-IMG-000001
  • Figure PCTKR2025095018-APPB-IMG-000002
    Figure PCTKR2025095018-APPB-IMG-000002
Patent Text Reader

Abstract

The present invention relates to a gene variant of the transcriptional regulator LysG and a method for producing L-citrulline or L-arginine using same. The gene variant of the transcriptional regulator LysG according to the present invention has protein activity that is altered due to the mutation of one or more bases in the base sequence of a gene encoding the transcriptional regulator LysG, and thus, it is possible to effectively produce L-citrulline or L-arginine from a recombinant microorganism comprising the variant.
Need to check novelty before this filing date? Find Prior Art

Description

Transcription regulator LysG gene mutant and method for producing L-citrulline or L-arginine using the same

[0001] The present invention relates to a transcription regulator LysG gene mutant and a method for producing L-citrulline or L-arginine using the same.

[0002] Citrulline is a non-essential amino acid that plays a vital role in the body, including promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, promoting neurotransmission, boosting immunity, and scavenging reactive oxygen species. In the kidneys, citrulline is metabolized into arginine, which then produces nitric oxide (NO). While not a component of proteins in the body, citrulline is an intermediate in the urea cycle. It is produced from arginine along with NO, a substance known to have vasodilating properties. Furthermore, it is regenerated into arginine through condensation with aspartic acid.

[0003] Arginine is a non-essential amino acid, but it is a semi-essential amino acid that must be supplied in growing children and under stressful conditions, trauma, cancer, and other special conditions. It is widely used as an ingredient in amino acid fortifiers, pharmaceuticals, and foods. For pharmaceutical purposes, it is used in liver function promoters, brain function promoters, male infertility treatments, and comprehensive amino acid preparations. For food, it is used as a fish cake additive, health drink additive, and salt substitute for hypertensive patients.

[0004] In the production of citrulline or arginine using microorganisms, L-citrulline or L-arginine can be produced from a wild-type strain obtained in a natural state or a mutant strain modified to enhance its citrulline or arginine production ability. Recently, in order to improve the production efficiency of L-citrulline or L-arginine, genetic recombination technology has been applied to microorganisms such as Escherichia coli and Corynebacterium, which are widely used in the production of L-amino acids and other useful substances, to develop various recombinant strains or mutants having excellent L-citrulline or L-arginine production ability and methods for producing L-citrulline or L-arginine using the same. In microorganisms, L-glutamate is synthesized from 2-oxoglutarate, an intermediate of the citric acid cycle, and using this as a starting material, L-citrulline and L-arginine are synthesized through N-acetylglutamate, N-acetylglutamyl-P, N-acetylglutamate 5-semialdehyde, N-acetylornithine, and L-ornithine.

[0005] Since the biosynthetic process of L-citrulline or L-arginine in microorganisms involves various proteins such as enzymes, transcription factors, and transport proteins in a step-by-step manner, there have been attempts to increase the production of L-citrulline or L-arginine by inducing mutations in the genes encoding these proteins or in the promoters that control their expression. However, since there are various types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to the production of L-citrulline or L-arginine, much research is still needed on whether L-citrulline or L-arginine production increases according to changes in the activity of these proteins.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] Korean Patent No. 10-1053429

[0009] Korean Patent No. 10-1999454

[0010] The present invention aims to provide a genetic variant of the transcription regulator LysG.

[0011] In addition, the present invention aims to provide a recombinant vector comprising the genetic variant.

[0012] In addition, the present invention aims to provide a transformant transformed with the recombinant vector.

[0013] In addition, the present invention aims to provide a method for producing L-citrulline or L-arginine using the transformant.

[0014] One aspect of the present invention provides a variant for a gene encoding a transcription regulator LysG, specifically, a transcription regulator LysG gene variant comprising a base sequence of SEQ ID NO: 3, wherein the 78th base in the base sequence of SEQ ID NO: 1 is substituted from C to A; or a transcription regulator LysG gene variant comprising a base sequence of SEQ ID NO: 5, wherein the 78th base in the base sequence of SEQ ID NO: 1 is substituted from C to A and the 138th base is substituted from G to A.

[0015] The “transcriptional regulator LysG” used in the present invention is a protein that positively regulates the expression of LysE, a transporter involved in the export of not only lysine but also citrulline and arginine. The transcriptional regulator LysG may be encoded by the lysG gene, but is not limited thereto.

[0016] Nucleic acid and protein sequence information for the above transcription regulator LysG can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0017] According to one specific example of the present invention, the transcription regulator LysG gene may be derived from Corynebacterium glutamicum.

[0018] According to one specific example of the present invention, the transcription regulator LysG gene may include a base sequence of SEQ ID NO: 1 and encode an amino acid sequence of SEQ ID NO: 2.

[0019] As used herein, "mutation" refers to an alteration of a base, nucleotide, polynucleotide, or nucleic acid of a gene, and may include substitution, insertion, deletion, etc. of a base, nucleotide, polynucleotide, or nucleic acid. Here, a substitution refers to a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion refers to a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion refers to a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed. A gene having such a mutation is called a mutant gene or gene variant.

[0020] A base variation in the base sequence of the above gene refers to a change or mutation in the sequence that shows a difference in one or more bases or nucleotides (A, T, C, or G; nucleotide A means adenine, nucleotide T means thymine, nucleotide C means cytosine, and nucleotide G means guanine). A mutation in one base or nucleotide is called a single base sequence variation or single nucleotide variant. If such a base variation exists in a region that encodes a protein (coding sequence), it may affect the structure of the protein, changing the protein structure or function. If it exists in a non-coding region that does not encode a protein, such as a promoter, it may cause a difference in the expression level of the protein, increasing or decreasing the overall activity of the protein.

[0021] These base mutations may result in the translated polypeptide or protein having either the same or different amino acid sequence from the original.

[0022] The transcription regulator LysG gene variant according to the present invention is a silent mutation in which the 78th base and / or the 138th base are substituted in the base sequence of SEQ ID NO: 1, and has no change in the amino acid sequence. In the transcription regulator LysG gene variant, the codon sequence is changed from tcc to tca due to the substitution of the 78th base, and the codon sequence is changed from gtg to gta due to the substitution of the 138th base, so that a change in the expression rate or expression amount of the gene is expected (Wang, Y., et al. An Engineered Rare Codon Device for Optimization of Metabolic Pathways. Sci Rep 6, 20608 (2016)).

[0023] The above transcription regulator LysG gene variant comprises the base sequence of SEQ ID NO: 3 or 5, and may consist of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with respect to each base sequence, excluding the mutation position (78th and / or 138th base), and may include, without limitation, a sequence that maintains the function or characteristic of the variant. Here, “homology” or “identity” means the rate of identity (%) between two sequences when a reference sequence and any other sequence are aligned and analyzed to correspond as much as possible.

[0024]

[0025] In addition, another aspect of the present invention provides a recombinant vector comprising the genetic variant.

[0026] In addition, another aspect of the present invention provides a transformant transformed with the recombinant vector.

[0027] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0028] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0029] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0030] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0031] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0032] The recombinant vector according to the present invention may include a base sequence of SEQ ID NO: 3 or 5 as a transcription regulator LysG gene mutant.

[0033] A transformant can be created by inserting a recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0034] When transforming prokaryotic cells to produce recombinant microorganisms, various intestinal bacteria and strains such as E. coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis, Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus may be used as host cells, but are not limited thereto.

[0035] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0036] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0037] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0038] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0039] According to one specific example of the present invention, the transformant may be a strain of the genus Corynebacterium.

[0040] The above-mentioned strains of the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, and Corynebacterium. Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium Corynebacterium pollutisoli, Corynebacterium imitans,These may include, but are not limited to, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacaterium pseudopelargi, and Corynebacterium flavescens.

[0041] The transformant according to the present invention may be, but is not limited to, a strain comprising the above-described transcription regulator LysG gene variant or a vector comprising the same, a strain expressing the above-described transcription regulator LysG gene variant, or a strain having activity against a protein encoded by the above-described transcription regulator LysG gene variant.

[0042] The transformant of the present invention may include other gene mutants in addition to the transcription regulator LysG gene mutant.

[0043] According to one specific example of the present invention, the transformant may have the ability to produce L-citrulline or L-arginine.

[0044] The above transformant may have a natural ability to produce L-citrulline or L-arginine, or may be artificially endowed with the ability to produce L-citrulline or L-arginine.

[0045] According to one specific example of the present invention, the transformant may have an improved ability to produce L-citrulline or L-arginine by changing the expression level or activity of a protein encoded by a mutant of the transcriptional regulator LysG gene.

[0046] As used herein, "improved L-citrulline or L-arginine production ability" means increased productivity of L-citrulline / L-arginine compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a target that is directly the target of mutation or a target that is transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium strain that does not have L-citrulline / L-arginine production ability or has L-citrulline / L-arginine production ability, or may be a Corynebacterium strain that is mutated therefrom.

[0047] The transformant according to the present invention exhibits increased L-citrulline or L-arginine production ability compared to a strain (parent strain) containing the transcription regulator LysG gene before the mutation, by introducing a transcription regulator LysG gene mutant, and thereby changing the expression level or activity of the transcription regulator LysG gene or the protein encoded by the transcription regulator LysG gene. Specifically, the transformant has an increase in L-citrulline or L-arginine production by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 20-fold, 30-fold, It may be increased by 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or 100-fold, but is not limited thereto. For example, a transformant into which the transcription regulator LysG gene variant has been introduced may have an L-citrulline / L-arginine production increased by 5% or more, specifically 5 to 50% (preferably 7 to 30%) compared to the parent strain.

[0048] A composition comprising a transformant according to the present invention can be used as a composition for producing L-citrulline or L-arginine.

[0049]

[0050] In addition, another aspect of the present invention provides a method for producing L-citrulline or L-arginine, comprising the steps of culturing the transformant in a medium; and recovering L-citrulline or L-arginine from the transformant or the medium in which the transformant is cultured.

[0051] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0052] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0053] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0054] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0055] According to one specific example of the present invention, the step of recovering L-citrulline or L-arginine from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-citrulline or L-arginine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0056] According to one specific example of the present invention, the step of recovering the L-citrulline or L-arginine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0057] According to one specific example of the present invention, the step of recovering L-citrulline or L-arginine may include a process of purifying L-citrulline or L-arginine.

[0058] The transcription regulator LysG gene variant according to the present invention changes the protein activity of the transcription regulator LysG by mutating one or more bases in the base sequence of the gene encoding the transcription regulator LysG, thereby enabling efficient production of L-citrulline or L-arginine from a recombinant microorganism including the transcription regulator LysG gene variant.

[0059] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0060]

[0061] Example 1. Production of a strain expressing a mutant of the transcription regulator LysG gene.

[0062] To produce strains expressing a mutant of the transcriptional regulator LysG gene, the L-citrulline-producing strain Corynebacterium glutamicum CT19b3 (accession number KCCM13451P) and the L-arginine-producing strain Corynebacterium glutamicum 14GR (accession number KCCM13219P) were used.

[0063]

[0064] 1-1. C78A mutation

[0065] A mutant strain was created that includes a mutation (SEQ ID NO: 3) in which the 78th base in the base sequence of the gene encoding the transcription regulator LysG (SEQ ID NO: 1) is substituted from cytosine (c) to adenine (a).

[0066] The genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template and amplified by PCR using primers 1 and 3, primers 2 and 4, primers 5 and 7, and primers 6 and 8, respectively. Subsequently, the plasmid of the pCGI vector [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] was used as a template and PCR amplified using primers 9 and 15, and primers 14 and 16. Afterwards, each PCR product was purified and mixed, cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), and transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618). Afterwards, the vector was spread on LB agar plates containing 50 μg / ml of kanamycin and cultured at 37°C for 24 hours to obtain a recombinant vector with the C78A mutation introduced. The resulting colonies were isolated to confirm whether the insert was accurately present in the vector.

[0067] PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) with 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) added to a reaction solution. 1 pM of oligonucleotides and 10 ng of Corynebacterium glutamicum ATCC13032 chromosomal DNA or pCGI vector were used as templates, and 25 to 30 cycles were performed in the presence of 1 unit of Takara PrimeSTAR Max DNA polymerase. The PCR conditions were (i) denaturation step: 94°C for 10 s, (ii) annealing step: 60°C for 10 s, and (iii) extension step: 72°C for 30 s.

[0068] Colonies obtained through transformation were sequenced to select those with inserted DNA. Competent cells of Corynebacterium glutamicum CT19b3 and Corynebacterium glutamicum 14GR were electroporated, and homologous recombination was induced to introduce mutations. The mutant strains produced here were named DC-1 and DA-1, respectively.

[0069]

[0070] 1-2. G138A mutation

[0071] A mutant strain was created that includes a mutation (SEQ ID NO: 4) in which the 138th base in the base sequence (SEQ ID NO: 1) of the gene encoding the transcription regulator LysG is substituted from guanine (g) to adenine (a).

[0072] The genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template and amplified by PCR using primers 1 and 10, primers 2 and 11, primers 12 and 7, and primers 13 and 8, respectively. Subsequently, the plasmid of the pCGI vector [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] was used as a template and amplified by PCR using primers 9 and 15, and primers 14 and 16. Afterwards, each PCR product was purified and mixed, cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), and transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618). Afterwards, the vector was spread on LB agar plates containing 50 μg / ml of kanamycin and cultured at 37°C for 24 hours to obtain a recombinant vector with the G138A mutation introduced. The colonies formed were isolated to confirm whether the insert was exactly present in the vector.

[0073] PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) with 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) added to a reaction solution. 1 pM of oligonucleotides and 10 ng of Corynebacterium glutamicum ATCC13032 chromosomal DNA or pCGI vector were used as templates, and 25 to 30 cycles were performed in the presence of 1 unit of Takara PrimeSTAR Max DNA polymerase. The PCR conditions were (i) denaturation step: 94°C for 10 s, (ii) annealing step: 60°C for 10 s, and (iii) extension step: 72°C for 30 s.

[0074] Thereafter, the same method as Example 1-1 was used, and the mutant strains produced here were named DC-3 and DA-3, respectively.

[0075]

[0076] 1-3. C78A and G138A mutations

[0077] A mutant strain was produced that includes a mutation (SEQ ID NO: 5) in which the 78th base in the base sequence of the gene encoding the transcription regulator LysG (SEQ ID NO: 1) was substituted from cytosine (c) to adenine (a) and the 138th base was substituted from guanine (g) to adenine (a).

[0078] The genomic DNA of Corynebacterium glutamicum ATCC13032 was used as a template and amplified by PCR using primers 1 and 3, primers 2 and 4, primers 5 and 10, primers 6 and 11, primers 12 and 7, and primers 13 and 8, respectively. Afterwards, the plasmid of pCGI vector [Kim et al., Journal of Microbiological Methods 84 (2011) 128-130] was used as a template and amplified by PCR using primers 9 and 15, and primers 14 and 16. Afterwards, each PCR product was purified and mixed, cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), and transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618). Afterwards, the vector was spread on LB agar plates containing 50 μg / ml of kanamycin and cultured at 37°C for 24 hours to obtain a recombinant vector with C78A and G138A mutations. The resulting colonies were isolated to confirm whether the insert was accurately present in the vector.

[0079] PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc.) with 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) added to a reaction solution. 1 pM of oligonucleotides and 10 ng of Corynebacterium glutamicum ATCC13032 chromosomal DNA or pCGI vector were used as templates, and 25 to 30 cycles were performed in the presence of 1 unit of Takara PrimeSTAR Max DNA polymerase. The PCR conditions were (i) denaturation step: 94°C for 10 s, (ii) annealing step: 60°C for 10 s, and (iii) extension step: 72°C for 30 s.

[0080] Thereafter, the same method as Example 1-1 was used, and the mutant strains produced here were named DC-2 and DA-2, respectively.

[0081]

[0082] The primers used in Example 1 are shown in Table 1 below.

[0083] Primer namePrimer sequence (5'-3')Sequence numberPrimer 1tgattacgcc TCGGGTTCAACCAGGTCA6Primer 2TCGGGTTCAACCAGGTCA7Primer 3AAATTGAAAGGGCTAAGGAGGC8Primer 4GCCGAGGGGGAAATTGAAA9Primer 5CCCCCTCGGCGGTGAGTCAGCGCGTTAA10Primer 6GGTGAGTCAGCGCGTTAA11Primer 7ATCGAGGAGGATCACTTCTCC12Primer 8TGGGTATCTCATCGAGGAGG13Primer 9GAGATACCCA actggccgtcgttttacaac14Primer 10CTCGAGAGCTTTAACGCGC15Primer 11CCACGTGATGCTCGAGA16Primer 12CATCACGTGGGTCGAGTATTGGTATCGCGC17Primer 13GTCGAGTATTGGTATCGCGC18 Primer 14actggccgtcgttttacaac19 Primer 15tggtcatagctgtttcctgtgt20 Primer 16ggcgtaatcatggtcatagctg21

[0084]

[0085] Experimental Example 1. Evaluation of L-citrulline production capacity

[0086] The L-citrulline production ability of a mutant strain expressing a transcriptional regulator LysG gene mutant produced in Example 1 was evaluated compared to the parent strain, Corynebacterium glutamicum CT19b3.

[0087] Each strain (parent strain or mutant strain) was inoculated at 1% of the volume in a 100 mL flask containing 10 mL of the medium for L-citrulline production in Table 2 below and cultured at 32°C, 200 rpm, for 30 hours. After the culture was completed, the concentration of L-citrulline in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below. The yield (Yp / s) (%) in Table 3 represents the amount of L-citrulline produced relative to the sugar consumed, and C-recovery (%) is the interval carbon recovery rate, which is the recovery rate between unit times.

[0088] Medium for L-citrulline production 95% Glucose 105.3 g, MgSO4 1 g, YPA 4 g, KH2PO4 0.8 g, Na2HPO4 1.2 g, (NH4)2SO4 30 g, FeSO4 20 mg, MnSO4 20 mg, ZnSO4 10 mg, Arginine 100 mg, Biotin 100 μg and Thiamine 200 μg

[0089] Strain OD610L-citrulline (%)Total carbohydrate (%)Yield (Yp / S) (%)C-recovery (%)Mother strain 18.61.343.7535.952.0DC-122.91.523.7740.360.0DC-223.41.673.8543.263.0DC-323.81.153.8130.350.5

[0090] As shown in Table 3 above, when the 78th base in the base sequence of the gene encoding the transcription regulator LysG was substituted (DC-1) or when the 78th base and the 138th base were substituted (DC-2), L-citrulline productivity was improved by 13.4% and 24.6%, respectively, compared to the parent strain without base mutation, and cell mass, fermentation yield, and C-recovery were also confirmed to be improved. On the other hand, when the 138th base in the base sequence of the gene encoding the transcription regulator LysG was substituted alone (DC-3), no improvement in L-citrulline productivity was observed.

[0091] Therefore, it was found that the C78A mutation or the C78A and G138A mutations in the transcriptional regulator LysG gene are effective mutations that contribute to improving L-citrulline production.

[0092]

[0093] Experimental Example 2. Evaluation of L-arginine production capacity

[0094] The L-arginine production ability of a mutant strain expressing a transcriptional regulator LysG gene mutant produced in Example 1 was evaluated compared to the parent strain, Corynebacterium glutamicum 14GR.

[0095] Each strain (parent strain or mutant strain) was inoculated at 1% of the volume in a 100 mL flask containing 10 mL of the medium for L-arginine production in Table 4 below and cultured at 32°C, 200 rpm, for 30 hours. After the culture was completed, the concentration of L-arginine in the medium was measured using HPLC (Agilent), and the results are shown in Table 5 below. The yield (Yp / s) (%) in Table 5 represents the amount of L-arginine produced relative to the sugar consumed, and C-recovery (%) is the interval carbon recovery rate, which is the recovery rate between unit times.

[0096] Medium for L-arginine production 98% Glucose 120 g, MgSO4 1 g, KH2PO4 2 g, (NH4)2SO4 45 g, FeSO4 20 mg, MnSO4 20 mg, Biotin 100 μg, Thiamine 100 μg, YSP 4 g and Urea 2 g

[0097] Strain OD610 L-arginine (%) Total carbohydrate (%) Yield (Yp / S) (%) C-recovery (%) Parent strain 34.12.2 96.57 34.86 51.72 DA-137.52.4 76.62 37.31 55.72 DA-238.62.60 6.67 38.98 57.79 DA-338.22.2 16.59 33.54 52.37

[0098] As shown in Table 5 above, when the 78th base in the base sequence of the gene encoding the transcription regulator LysG was substituted (DA-1) or when the 78th base and the 138th base were substituted (DA-2), L-arginine productivity was improved by 7.8% and 13.5%, respectively, compared to the parent strain without base mutation, and cell mass, fermentation yield, and C-recovery were also confirmed to be improved. On the other hand, when the 138th base in the base sequence of the gene encoding the transcription regulator LysG was substituted alone (DC-3), no improvement in L-arginine productivity was observed.

[0099] Therefore, it was found that the C78A mutation or the C78A and G138A mutations in the transcriptional regulator LysG gene are effective mutations that contribute to improving L-arginine production.

[0100]

[0101] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0102] [Accession number]

[0103] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0104] Accession number: KCCM13451P

[0105] Date of acceptance: 20240104

[0106]

[0107] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0108] Accession number: KCCM13219P

[0109] Date of acceptance: 20220629

[0110]

[0111]

Claims

1. A transcription regulator LysG gene variant comprising the base sequence of SEQ ID NO: 3, in which the 78th base in the base sequence of SEQ ID NO: 1 is substituted from C to A; or A transcription regulator LysG gene mutant comprising the base sequence of SEQ ID NO: 5, in which the 78th base in the base sequence of SEQ ID NO: 1 is substituted from C to A and the 138th base is substituted from G to A.

2. A recombinant vector comprising the genetic variant of claim 1.

3. A transformant transformed with the recombinant vector of claim 2.

4. In claim 3, The transformant is a transformant that is a strain of the genus Corynebacterium.

5. In claim 3, The above transformant is a transformant having the ability to produce L-citrulline or L-arginine.

6. A step of culturing the transformant of claim 3 on a medium; and A method for producing L-citrulline or L-arginine, comprising a step of recovering L-citrulline or L-arginine from the transformant or the medium in which the transformant is cultured.

Citation Information

Patent Citations

  • Processes and recombinant microorganisms for the production of cadaverine

    KR1020140012099A

  • Method for evaluating the adequacy of design changes of developed military equipment

    KR1020220003428A

  • Ammonia treatment system

    KR1020230144366A

  • Auxiliary base material for roads using recycled concrete aggregate

    KR1020250118890A

  • Apparatus and method for representing feature and retrieving using time series data

    KR102715444B1