Use of trim29 in breast cancer immunotherapy
By using TRIM29 expression inhibitors in breast cancer to interfere with TRIM29 expression, the problem of immune resistance caused by PD-L1 upregulation was solved, thus enhancing the efficacy of breast cancer immunotherapy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-22
- Publication Date
- 2026-04-07
AI Technical Summary
In the existing technology, there are no reports on the regulatory role of TRIM29 in adaptive immunity in breast cancer immunotherapy, and the upregulation of PD-L1 expression in cancer cells leads to resistance to immune checkpoint therapy, affecting treatment sensitivity.
By applying TRIM29 expression inhibitors, such as targeted specific siRNA, shRNA, or antisense oligonucleotide chains, the expression of TRIM29 can be interfered with, the expression level of PD-L1 can be downregulated, and T cells can be activated to recognize and kill tumor cells.
By inhibiting TRIM29 expression, the PD-L1 level in breast cancer cells was significantly downregulated, enhancing the immune system's ability to recognize and kill tumor cells and improving the sensitivity to immunotherapy.
Smart Images

Figure CN115998886B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to the application of TRIM29 in breast cancer immunotherapy. Background Technology
[0002] Previous reports have shown that TRIM29 expression and function vary across different tumors and cell types. TRIM29 has been found to be highly expressed in esophageal, breast, gastric, lung, bladder, and colorectal cancers, but lowly expressed in prostate cancer. TRIM29 exerts its carcinogenic effect by promoting the degradation of TIP60, reducing TIP60's acetylation of p53, and regulating the function of the tumor suppressor gene p53. TRIM29 can promote tumor cell proliferation and inhibit apoptosis. Furthermore, TRIM29 also plays a role in DNA damage repair and epithelial-mesenchymal transition (EMT). Some reports suggest that TRIM29 regulates innate immunity; it inhibits IFN-I production and suppresses innate immunity by causing STING degradation through its E3 ubiquitin ligase action. However, no reports have been found regarding TRIM29's regulation of adaptive immunity or its impact on tumor immunotherapy sensitivity.
[0003] Adaptive immunity plays a crucial role in anti-tumor activity. Under normal circumstances, the immune system can recognize and eliminate tumor cells in the tumor microenvironment. However, to survive and grow, tumor cells can employ various strategies to suppress the body's immune system, resulting in immune escape. Currently, immunotherapy, a popular clinical approach, uses drugs to prevent this immune escape, allowing the immune system to properly recognize and kill tumor cells. Among these, anti-programmed death 1 (PD-1) antibodies are the most researched and fastest-developing immunotherapy in clinical practice. PD-1 acts in the effector phase of the immune response, expressed on activated T cells, B cells, and myeloid cells. It has two ligands: programmed death ligand 1 (PD-L1) and PD-L2. PD-L1 / L2 are expressed on antigen-presenting cells, and PD-L1 is also expressed in various tissues. The binding of PD-1 and PD-L1 mediates co-inhibitory signals for T cell activation, inhibiting the killing function of T cells and negatively regulating the human immune response. PD-L1 is highly expressed in tumor tissues and regulates the function of tumor-infiltrating CD8+ T cells. Therefore, immune checkpoint inhibitors targeting PD-1 / PD-L1 activate the patient's own immune system, significantly improving the prognosis of many cancer patients. Currently, PD-1 inhibitors Pembrolizumab and Nivolumab have been approved by the FDA for advanced melanoma, non-small cell lung cancer, Hodgkin's lymphoma, and head and neck squamous cell carcinoma, among others. Nivolumab has also been approved by the FDA for the treatment of renal cell carcinoma and urothelial carcinoma. In addition, monoclonal antibodies such as PD-L1 inhibitors Atezolizumab and Durvalumab have entered multiple phase III clinical trials, covering multiple tumor types including non-small cell lung cancer, melanoma, and bladder cancer.
[0004] However, most patients remain resistant to immune checkpoint therapy. Upregulation of PD-L1 expression in cancer cells is one of the main reasons for this resistance. Therefore, inhibiting PD-L1 expression is crucial for improving the sensitivity of patients to immune checkpoint therapy. Summary of the Invention
[0005] The purpose of this invention is to overcome at least one deficiency of the prior art and to provide the application of TRIM29 in breast cancer immunotherapy.
[0006] The technical solution adopted in this invention is:
[0007] Application of TRIM29 expression inhibitors in the preparation of immunotherapy enhancers for breast cancer.
[0008] In some applications, the immunotherapy is an immunotherapy targeting PD-L1 or PD-1.
[0009] In some application examples, the TRIM29 expression inhibitor is selected from at least one of a TRIM29-targeting specific siRNA, a shRNA that silences TRIM29 expression, or an antisense oligonucleotide chain that silences TRIM29 expression.
[0010] In some application examples, the nucleotide sequence of the target-specific siRNA is as follows:
[0011] si1-F: 5'-GCGACCCAUCAUCCAGUUUGUTT-3', si1-R: 5'-ACAAACUGGAUGAUGGGUCGCTT-3'; or
[0012] si2-F: 5'-GAAGAGCUCCAUCGUCUUGCCATT-3', si2-R: 5'-UGGCAAGACGAUGGAGCUCUUCTT-3'.
[0013] In some application examples, the nucleotide sequence of the shRNA expressed by the silenced TRIM29 is: sh1:CGGCCATTCTACGTCAACAAA or sh2: GCAGGAATTTGGTGCATTGAT.
[0014] In some application examples, the TRIM29 expression inhibitor is a vector that expresses a TRIM29-targeting specific siRNA, a shRNA that silences TRIM29 expression, or an antisense oligonucleotide chain that silences TRIM29 expression.
[0015] In some application examples, the nucleotide sequence of the target-specific siRNA expressed by the vector is as follows:
[0016] si1-F: 5'-GCGACCCAUCAUCCAGUUUGUTT-3', si1-R: 5'-ACAAACUGGAUGAUGGGUCGCTT-3'; or
[0017] si2-F: 5'-GAAGAGCUCCAUCGUCUUGCCATT-3', si2-R: 5'-UGGCAAGACGAUGGAGCUCUUCTT-3'.
[0018] In some application examples, the nucleotide sequence of the shRNA expressed by the vector for silencing TRIM29 expression is: sh1: CGGCCATTCTACGTCAACAAA or sh2: GCAGGAATTTGGTGCATTGAT.
[0019] In some application instances, the carrier is the pLKO-Tet-On carrier.
[0020] In some application examples, the breast cancer is a breast cancer with high TRIM29 expression.
[0021] The beneficial effects of this invention are:
[0022] The inventors discovered that TRIM29 binds to the voltage-dependent anion channel protein VDAC1 in the outer mitochondrial membrane, regulating the opening of the mitochondrial permeability transition pore (mPTP), leading to mitochondrial calcium efflux, increased cytoplasmic calcium levels, and activation of the transcription factor NFAT, thereby upregulating PD-L1 expression. Interfering with TRIM29 expression downregulates PD-L1 expression. In breast cancer cells, knocking down TRIM29 significantly downregulates PD-L1 levels in tumor cells, activating T cells to recognize and kill tumor cells. Attached Figure Description
[0023] Figure 1 It is the effect of inhibiting TRIM29 on tumor cell survival.
[0024] Figure 2 It inhibits the effect of TRIM29 on PD-L1 levels. Detailed Implementation
[0025] Application of TRIM29 expression inhibitors in the preparation of immunotherapy enhancers for breast cancer.
[0026] In some applications, the immunotherapy is an immunotherapy targeting PD-L1 or PD-1.
[0027] In some application examples, the TRIM29 expression inhibitor is selected from at least one of a TRIM29-targeting specific siRNA, a shRNA that silences TRIM29 expression, or an antisense oligonucleotide chain that silences TRIM29 expression.
[0028] In some application examples, the nucleotide sequence of the target-specific siRNA is as follows:
[0029] si1-F: 5'-GCGACCCAUCAUCCAGUUUGUTT-3' (SEQ ID NO.1), si1-R: 5'-ACAAACUGGAUGAUGGGUCGCTT-3' (SEQ ID NO.2); or
[0030] si2-F: 5'-GAAGAGCUCCAUCGUCUUGCCATT-3' (SEQ ID NO.3), si2-R: 5'-UGGCAAGACGAUGGAGCUUCTT-3' (SEQ ID NO.4).
[0031] In some application examples, the nucleotide sequence of the shRNA expressing the silenced TRIM29 is: sh1:CGGCCATTCTACGTCAACAAA (SEQ ID NO.5) or sh2: GCAGGAATTTGGTGCATTGAT (SEQ ID NO.6).
[0032] In some application examples, the TRIM29 expression inhibitor is a vector that expresses a TRIM29-targeting specific siRNA, a shRNA that silences TRIM29 expression, or an antisense oligonucleotide chain that silences TRIM29 expression.
[0033] In some application examples, the nucleotide sequence of the target-specific siRNA expressed by the vector is as follows:
[0034] si1-F: 5'-GCGACCCAUCAUCCAGUUUGUTT-3', si1-R: 5'-ACAAACUGGAUGAUGGGUCGCTT-3'; or
[0035] si2-F: 5'-GAAGAGCUCCAUCGUCUUGCCATT-3', si2-R: 5'-UGGCAAGACGAUGGAGCUCUUCTT-3'.
[0036] In some application examples, the nucleotide sequence of the shRNA expressed by the vector for silencing TRIM29 expression is: sh1: CGGCCATTCTACGTCAACAAA or sh2: GCAGGAATTTGGTGCATTGAT.
[0037] In some application instances, the carrier is the pLKO-Tet-On carrier.
[0038] In some application examples, the breast cancer is a breast cancer with high TRIM29 expression.
[0039] English-Chinese bilingual edition:
[0040] Fetal bovine serum (FBS).
[0041] Main reagents
[0042] Fetal bovine serum was purchased from Invitrogen; DMEM basal culture medium was purchased from Invitrogen; human IFN-γ was purchased from PeproTech; and human PD-L1 flow cytometry antibody was purchased from Biolegend.
[0043] Cell line: HCC1806 cells (human breast cancer cell line)
[0044] Culture medium: DMEM supplemented with 10% fetal bovine serum (FBS).
[0045] Culture at 37℃ with 5% CO2, and subculture every 2-3 days.
[0046] The technical solution of the present invention will be further explained below with reference to experiments.
[0047] Construction of TRIM29-inducible tumor cell line
[0048] 1. Construction of shTRIM29 vector
[0049] Oligos of shTRIM29 (TRCN0000016348, target seq: CGGCCATTCTACGTCAACAAA) or shVDAC1 were ligated into the pLKO-Tet-On vector, respectively.
[0050] 2. Packaging viruses
[0051] 3 x 10 doses administered the day before transfection 6 293FT cells were cultured in a 10cm culture dish.
[0052] The specific steps are as follows:
[0053] Day 1: Change the culture medium to fresh medium 2-3 hours before transfection. Prepare two polystyrene tubes for each cell line to be transfected, labeled A and B, and prepare solutions A and B respectively. Solution A: psPAX2 15µg, pMD2.G 5µg, vector plasmid 20µg, 2MCaCl2 98.4µl, add sterile water to 800µl; Solution B: 800µl 2×HBS. While shaking solution B, slowly and evenly add solution A to solution B, and incubate at room temperature for 30-40 minutes. After 30-40 minutes, slowly and evenly add the mixture to the culture dish, gently shaking the dish to mix the solution thoroughly, and place the cells in a 37°C incubator.
[0054] Day 2: 16 hours after transfection, change the medium to 15 ml.
[0055] Day 3: Collect the supernatant and store it at 4 degrees Celsius, then replace it with 15 ml of fresh culture medium.
[0056] Day 5: Centrifuge at 2000 rpm for 5 minutes at 4℃, collect the supernatant and store at 4℃, transfer the supernatant to a new tube, dispense 2ml / tube and freeze at -80℃.
[0057] 3. Infected cells
[0058] Administer 1×10 doses the day before transfection 5 HCC1806 cells were placed in 6-well plates (density approximately 10%).
[0059] The specific steps are as follows:
[0060] 1) Mix 1000 μl of virus solution with 1000 μl of culture medium, and add 2 μl of 8 mg / ml gene transfection enhancer polybrene (final concentration 8 μg / ml), and mix well;
[0061] 2) Add to the cells and gently shake the well plate to mix;
[0062] 3) Incubate for 2-3 days.
[0063] 4. Cell screening
[0064] 1) Digest cells cultured for 2-3 days and passage them at a ratio of 1:10 or 1:20;
[0065] 2) After passage for 24 h, add 2 μg / ml of puromycin to select cells;
[0066] 3) Positive clones are identified one week after antibiotic screening.
[0067] Inhibiting TRIM29 expression increases the cytotoxic ability of PBMCs against tumor cells.
[0068] HCC1806-shTRIM29 cells were seeded in 6-well plates with or without DOX (100 ng / ml). The culture medium was changed every 2 days. After 3 days, the cells were co-cultured with peripheral blood mononuclear cells (PBMCs) isolated from healthy volunteers. Cell viability was assessed after 24 hours. The results showed that the survival rate of tumor cells in the TRIM29-interfered group was significantly decreased. Figure 1 This indicates that inhibiting TRIM29 expression in tumor cells can significantly enhance the killing ability of PBMCs against them.
[0069] Inhibiting TRIM29 expression reduces PD-L1 levels in tumor cells.
[0070] HCC1806-shTRIM29 cells were seeded in 6-well plates and treated with or without DOX (100 ng / ml). The culture medium was changed every 2 days. After 3 days, cells were treated with or without IFN-g (200 ng / ml). PD-L1 mRNA levels were detected by qPCR after 24-48 hours, and PD-L1 protein levels were detected by flow cytometry. The results showed that, compared to control cells (NC), PD-L1 levels were significantly decreased in TRIM29 cells with or without IFN-g treatment. Figure 2 This indicates that inhibiting TRIM29 expression reduces PD-L1 levels in tumor cells.
[0071] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.
Claims
1. Application of TRIM29 expression inhibitor in the preparation of a potentiator for breast cancer immunotherapy, wherein the immunotherapy is PD-L1 or PD-1 targeted immunotherapy, and the TRIM29 expression inhibitor is an shRNA that silences TRIM29 expression or a vector that expresses an shRNA that silences TRIM29 expression, wherein the nucleotide sequence of the shRNA that silences TRIM29 expression is: sh1:CGGCCATTCTACGTCAACAAA.
2. The application according to claim 1, characterized in that, The carrier is the pLKO-Tet-On carrier.
3. The application according to claim 1, characterized in that, The breast cancer in question is a breast cancer with high TRIM29 expression.