A recombinant yeast strain and its application in the biotransformation of ginsenoside of the panaxadiol type

By efficiently expressing Aspergillus tabino β-glucosidase in Pichia yeast, the problems of low conversion selectivity and high energy consumption in the prior art were solved, and the rare ginsenoside CK was achieved efficiently, and it was used in the fields of food, medicine and bioenergy.

CN116004406BActive Publication Date: 2025-07-18JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210841209.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-18
Publication Date
2025-07-18
Estimated Expiration
2042-07-18

AI Technical Summary

Technical Problem

In the prior art, when converting the main ginsenoside into the secondary ginsenoside, especially CK, there is a problem of low selectivity and high energy consumption, resulting in environmental pollution.

Method used

Recombinant Pichia saccharin was constructed, and β-glucosidase β-GC from Aspergillus tabin was overexpressed. It was expressed in Pichia saccharin by efficient secretion. This enzyme was used to convert ginsaccharin Rb1, Rc, Rb2, and Rb3 into Rd, and combined with lactase, ginsaccharin F2 into CK.

Benefits of technology

It has achieved efficient and selective preparation of rare ginseng saponin CK, which reduces energy consumption and reduces environmental pollution, and the enzyme activity reaches 235.73U/mL and 59.41U/mL, which is widely used in the fields of food, medicine and bioenergy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004406B_ABST
    Figure CN116004406B_ABST
Patent Text Reader

Abstract

The present invention discloses a recombinant yeast strain and its application in the biotransformation of ginsenoside of panaxadiol type, belonging to the field of genetic engineering. The constructed recombinant Pichia pastoris of the present invention overexpresses β-glucosidase β-GC derived from Aspergillus tubingensis, and the amino acid sequence of the β-glucosidase is shown as SEQ ID NO.1 or SEQ ID NO.3; the β-glucosidase has the ability to specifically hydrolyze ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2 and ginsenoside Rb3 into ginsenoside Rd, and can hydrolyze ginsenoside F2 into ginsenoside CK. The β-glucosidase prepared by the present invention can be widely applied in the fields of food, medicine, bioenergy and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a recombinant yeast strain and its application in the biotransformation of ginsenoside diol type, belonging to the technical field of genetic engineering. Background Art

[0002] For a long time, ginseng has been a highly regarded herb around the world, which can maintain physical vitality and prolong life. It is widely reported that the main active ingredients in ginseng are ginsenosides, which have great applications in anti-cancer, anti-inflammatory and antioxidant research, etc. Ginsenosides can be roughly divided into oleanane-type ginsenosides (Ro, etc.), protopanaxadiol-type ginsenosides (Rb1, Rb2, Rb3, Rc, Rd, F2, CK, etc.) and protopanaxatriol-type ginsenosides (Re and Rf). In addition, according to the degree of deglycosylation, ginsenosides can be divided into major ginsenosides and minor ginsenosides. Minor ginsenosides are obtained by deglycosylation of major ginsenosides, and do not exist or are very low in natural ginseng plants. In addition, minor ginsenosides (F2 and CK, etc.) have higher bioavailability because they have smaller molecular weights and better membrane permeability than major ginsenosides. Currently, tablets containing CK can be used as candidate drugs for rheumatoid arthritis.

[0003] Many previous studies have focused on using heat treatment, acid-base treatment or enzymatic catalysis to convert major ginsenosides into minor ginsenosides. Among them, the heat or acid-base treatment method hydrolyzes glycosidic bonds randomly, resulting in products that do not reach the expected pharmacological activity. And excessive energy consumption and waste also cause serious pollution to the environment. The highly selective enzymatic catalysis strategy has significant advantages over physical or chemical preparation methods in the green production of rare ginsenosides. Novel biocatalysts play an important role in green chemistry and sustainable chemical engineering, and are expected to overcome the deficiencies of existing biocatalysts. It is reported that the extracellular enzyme from Aspergillus tubingensis is the first GRAS enzyme that can completely convert protopanaxadiol-type major ginsenosides into CK. Similarly, we previously screened a strain A. tubingensis JE0609 that can effectively biotransform protopanaxadiol-type major ginsenosides into CK. Obviously, Aspergillus tubingensis is a very valuable industrial fungus for the preparation of rare ginsenosides and the high-value transformation of natural compounds. According to the literature, most of the glycosidases that can hydrolyze protopanaxadiol-type major ginsenosides are β-glucosidases. Therefore, identifying relevant β-glucosidases during the biotransformation of ginsenosides is the key and basic step for discovering novel and efficient biocatalysts and reasonably guiding the catalytic production of ginsenosides. Summary of the Invention

[0004] The present invention provides a recombinant Pichia pastoris, which overexpresses β-glucosidase β-GC derived from Aspergillus tubingensis, and the amino acid sequence of the β-glucosidase is as shown in SEQ ID NO.1 (named β-GC1) or as shown in SEQ ID NO.3 (named β-GC2).

[0005] In one embodiment of the present invention, the nucleotide sequence encoding the β-glucosidase β-GC1 is as shown in SEQ ID NO.2;

[0006] In one embodiment of the present invention, the nucleotide sequence encoding the β-glucosidase β-GC2 is as shown in SEQ ID NO.4.

[0007] In one embodiment of the present invention, the recombinant Pichia pastoris uses pPIC9K as an expression vector.

[0008] In one embodiment of the present invention, the recombinant Pichia pastoris uses Pichia pastoris GS115 as an expression host.

[0009] The present invention also provides a method for highly efficient secretion and expression of a recombinant Aspergillus tubingensis β-glucosidase. The main steps are as follows: First, extract the RNA of Aspergillus tubingensis and reverse transcribe it into cDNA. Using the Aspergillus tubingensis cDNA as a template, amplify the β-glucosidase gene by PCR, clone it onto the Pichia pastoris expression vector pPIC9K, and introduce the recombinant gene into the Pichia pastoris host strain GS115 by electrotransformation method. Then, obtain the β-glucosidase by methanol induction expression.

[0010] In one embodiment of the present invention, the amino acid sequence of the β-glucosidase encoded and produced by the present invention is the protein sequence composed of the amino acids in SEQ ID No.1; The recombinant gene simultaneously introduces ECORI and NOTI restriction enzyme sites to ensure the integrity of the natural N-terminus of the target protein and does not introduce additional amino acid residues such as purification tag sequences. The expression vector is the Pichia pastoris / E. coli shuttle plasmid pPIC9K; the host cell is Pichia pastoris GS115; before the recombinant plasmid is electrotransformed into the Pichia pastoris host cell, it needs to be linearized with SacI restriction endonuclease and recombined with the host cell at the AOX1 gene, and the strong alcohol oxidase promoter (AOX) of the vector pPIC9K is used for highly efficient secretion and expression of foreign proteins.

[0011] In one embodiment of the present invention, using the Aspergillus tubingensis cDNA as a template, amplification primers are designed. The primers are F: 5’- GCTGAAGCTTACGTAGAATTCCAAAGCAACGCAAGCTCTTTCG-3' and R: 5'- AAGGCGAATTAATTCGCGGC CGC TTGACCGTTCAAGAACACTGGTGG-3', where the underlined part is the homologous arm sequence. Then, the recombinant β-glucosidase gene (without the signal peptide sequence) was obtained by PCR amplification. The β-glucosidase gene was cloned into the Pichia pastoris expression vector pPIC9K (purchased from Invitrogen) by homologous recombination to obtain the recombinant expression plasmid pPIC9K-β-glucosidase.

[0012] In one embodiment of the present invention, after linearizing the recombinant expression plasmid with SacI, it was electrotransformed into the Pichia pastoris host cell GS115 (purchased from Invitrogen). The specific parameters of electrotransformation were: a 2 mm transformation cuvette, a voltage of 1500 V, a resistance of 200 Ω, and a capacitance of 25 μF. After screening with an MD plate, yeast colony PCR was used for verification. The specific process referred to the Pichia pastoris operation manual of Invitrogen to ensure that the β-glucosidase had been recombined with the host cell at the AOX1 gene and was highly expressed using the strong promoter (AOX) of the alcohol oxidase in the vector pPIC9K. Positive clones were picked and induced to express in an Erlenmeyer flask with 0.5% methanol according to the above manual. After 96 h, the supernatant was collected by centrifugation, and the activity was measured by the pNPG method. Recombinant β-glucosidase was obtained in the supernatant.

[0013] The present invention provides a method for preparing ginsenoside Rd. The method is to add the recombinant Pichia pastoris or β-glucosidase β-GC1 or β-glucosidase β-GC2 prepared by fermenting the recombinant Pichia pastoris into a reaction system containing ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and / or ginsenoside Rb3 for reaction to prepare ginsenoside Rd.

[0014] In one embodiment of the present invention, the addition amount of β-glucosidase β-GC1 or β-glucosidase β-GC2 is 400 U / mL.

[0015] In one embodiment of the present invention, the substrate in the reaction system is a ginsenoside mixture, and the ginsenoside mixture is prepared by mixing ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and ginsenoside Rb3 at a concentration ratio of 2:1:1:1; the total concentration of the substrate solution is 5 mg / mL.

[0016] In one embodiment of the present invention, the reaction conditions are: pH 5.5 - 6.0, reaction at 45 - 55 °C for 4 - 9 h.

[0017] In one embodiment of the present invention, the reaction conditions are a pH of 6.0, a reaction temperature of 50 °C for 6 h.

[0018] The present invention also provides a method for preparing ginsenoside CK. The method is to add the above-mentioned recombinant Pichia pastoris expressing β-glucosidase with the amino acid sequence shown in SEQ ID NO.1, or add β-glucosidase β-GC1 with the amino acid sequence shown in SEQ ID NO.1 to the reaction system for reaction to prepare ginsenoside CK.

[0019] The reaction system contains ginsenoside Rb1, Rc, Rb2 and / or Rb3, and lactase enzyme solution.

[0020] Or the reaction system contains ginsenoside F2.

[0021] In one embodiment of the present invention, the added concentration of ginsenoside F2 is: 2 mg / mL.

[0022] In one embodiment of the present invention, the addition amount of β-glucosidase β-GC1 is 400 U / mL.

[0023] In one embodiment of the present invention, the addition amount of the lactase enzyme solution is 170 U / mL.

[0024] In one embodiment of the present invention, the substrate in the reaction system is a ginsenoside mixture, and the ginsenoside mixture is prepared by mixing ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and ginsenoside Rb3 in a concentration ratio of 2:1:1:1; the total concentration of the substrate solution is 5 mg / mL.

[0025] In one embodiment of the present invention, the reaction conditions are: pH 5.5 - 6.0, reaction at 45 - 55 °C for 4 - 9 h.

[0026] In one embodiment of the present invention, the reaction conditions are a pH of 6.0, a reaction temperature of 50 °C for 6 h.

[0027] The present invention also provides the application of the above-mentioned recombinant Pichia pastoris or the above-mentioned β-glucosidase β-GC1 or the above-mentioned β-glucosidase β-GC2 in hydrolyzing ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2 and / or ginsenoside Rb3.

[0028] In one embodiment of the present invention, the nucleotide sequence encoding β-glucosidase β-GC2 is shown in SEQ ID NO.4.

[0029] In one embodiment of the present invention, the nucleotide sequence encoding the β-glucosidase β-GC1 is as shown in SEQ ID NO.2.

[0030] Beneficial effects

[0031] (1) The β-glucosidase β-GC1 derived from recombinant Aspergillus tubingensis is highly efficiently secreted and expressed in Pichia pastoris, and this recombinant β-glucosidase can be used for highly efficiently hydrolyzing protopanaxadiol-type major ginsenosides to prepare the rare ginsenoside CK.

[0032] (2) The enzyme activity of the recombinant β-glucosidase β-GC1 of the present invention can reach 235.73 U / mL, and it can highly efficiently hydrolyze ginsenoside Rb1, Rc, Rb2 and Rb3 to obtain Rd; the recombinant β-glucosidase can also hydrolyze ginsenoside F2 to obtain CK.

[0033] (3) The β-glucosidase β-GC2 derived from recombinant Aspergillus tubingensis is highly efficiently secreted and expressed in Pichia pastoris, and this recombinant β-glucosidase can be used for highly efficiently hydrolyzing protopanaxadiol-type major ginsenosides to prepare ginsenoside Rd.

[0034] (4) The enzyme activity of the recombinant β-glucosidase β-GC2 of the present invention can reach 59.41 U / mL, and it can highly efficiently hydrolyze ginsenoside Rb1, Rc, Rb2 and Rb3 to obtain Rd.

[0035] (5) The recombinant β-glucosidase β-GC1 can be hydrolyzed to prepare CK, and other recombinant β-glucosidases β-GC2 derived from Aspergillus tubingensis cannot be used to prepare CK.

[0036] The β-glucosidase β-GC1 prepared by the present invention has potential application value in the industrial production of rare ginsenosides, and can be widely applied to fields such as food, medicine, biomass conversion and the like. Description of the drawings

[0037] Figure 1 : Electrophoresis diagram of the amplified β-glucosidase gene.

[0038] Figure 2 : SDS-PAGE analysis of the supernatant of the 250 mL shake flask fermentation of the recombinant Aspergillus tubingensis β-glucosidase.

[0039] Figure 3 : Verification of the hydrolysis ability of the recombinant Aspergillus tubingensis β-glucosidase for protopanaxadiol-type ginsenosides. Detailed implementation manners

[0040] Ginsenoside Rb1, Rc, Rb2, and Rb3 involved in the following examples were purchased from: Chengdu Manchester Biotechnology Co., Ltd.

[0041] The culture media involved in the following examples are as follows:

[0042] BMGY medium (buffered glycerol complex medium, g·L -1 ): Tryptone 20.0, yeast extract 10.0, glycerol 10.0, YNB 13.4, biotin 4×10 -4 , and finally made up to 1 L with 0.1 mol·L -1 potassium phosphate (pH 6.0) buffer. After filtration sterilization of YNB and biotin through a membrane, they were directly added after the medium was sterilized and cooled.

[0043] BMMY medium (buffered methanol complex medium, g·L -1 ): Tryptone 20.0, yeast extract 10.0, methanol 5.0, YNB 13.4, biotin 4×10 -4 , and finally made up to 1 L with 0.1 mol·L -1 potassium phosphate (pH 6.0) buffer. After filtration sterilization of YNB and biotin through a membrane, they were directly added together with anhydrous methanol after the medium was sterilized and cooled.

[0044] The detection methods involved in the following examples are as follows:

[0045] Detection of β-glucosidase enzyme activity: The enzyme activities of recombinant β-glucosidases β-GC1 and β-GC2 were determined by the pNPG method.

[0046] Take 1 mL of the enzyme solution to be tested, centrifuge at 8000 r / min at 4 °C for 10 min, take 100 μL of the supernatant, and add 200 μL of 5 mmol·L -1 pNPG solution and mix well. After heating in a water bath at 50 °C for 30 min, immediately add 2 mL of 1 mol·L -1 Na2CO3 to terminate the reaction. Use the supernatant of the inactivated fermentation broth of the same strain as the control group, and measure the absorbance of the strain fermentation broth at 400 nm. Calculate the enzyme activity using the following formula.

[0047] Definition of enzyme activity: The amount of enzyme consumed to release 1 μmol of p-nitrophenol in 1 min is defined as one enzyme activity unit.

[0048] Enzyme activity calculation formula:

[0049] Where:

[0050] U—the size of enzyme activity (U·mL -1 );

[0051] C — p - nitrophenol concentration (mmol·L -1 )

[0052] V — volume of the reaction system (mL);

[0053] t — reaction time (min);

[0054] v — volume of the supernatant taken (mL);

[0055] N — dilution factor

[0056] Detection of the contents of ginsenosides Rb1, Rb2, Rb3, Rc, Rd, F2, and CK:

[0057] Detection by HPLC method:

[0058] Chromatographic equipment: Aglient 1260, chromatographic column: Sepax - C18 chromatographic column (4.6 mm×250 mm, 5 μm); column temperature: 30 °C; injection volume: 10 μL; flow rate: 1 mL·min -1 ; detection wavelength: 203 nm; gradient elution mobile phase: water (A) - acetonitrile (B), and its elution gradient is 30% B for 0 - 30 min, 55% B for 30 - 45 min, and 70% B for 45 - 60 min

[0059] Example 1: Construction of recombinant Pichia pastoris

[0060] The specific steps are as follows:

[0061] (1) Obtaining of β - glucosidase β - GC1 and β - glucosidase β - GC2 from Aspergillus tubingensis

[0062] Extract the RNA of Aspergillus tubingensis JE0609 using the Fungal Total RNA Isolation Kit from Sangon Biotech (Shanghai) Co., Ltd., and reverse - transcribe the RNA to prepare cDNA using the HiFiScript gDNA Removal cDNA Synthesis Kit from CWBIO. Predict the signal peptide sequence of β - glucosidase using SignalP 5.0, and design amplification primers respectively:

[0063] Primer 1:

[0064] F: 5’ - GCTGAAGCTTACGTAGAATTC CAAAGCAACGCAAGCTCTTTCG - 3’ and R: 5’ - AAGGCGAATT AATTCGCGGCCGC TTGACCGTTCAAGAACACTGGTGG - 3’;

[0065] Primer 2:

[0066] F: 5'- GCTGAAGCTTACGTAGAATTC AGCACTTGCCAGGAACCTATCAAC - 3' and R: 5'- AAGGCGAA TTAATTCGCGGCCGC TCAATGATGATGATGATGATGCTTCCTAAGCAAGGTAGCAGTAG - 3';

[0067] Using cDNA as a template, the genes of β-glucosidase β-GC1 from Aspergillus tubingensis (nucleotide sequence shown in SEQ ID NO.2) and β-glucosidase β-GC2 (nucleotide sequence shown in SEQ ID NO.3) were amplified by PCR ( Figure 1 ).

[0068] (2) Obtaining of recombinant vectors

[0069] Determine the position where the β-glucosidase protein is introduced. The β-glucosidase gene was cloned into the Pichia pastoris expression vector pPIC9K (purchased from Invitrogen) by homologous recombination to obtain the recombinant expression plasmid pPIC9K-β-glucosidase, that is: the recombinant vectors pPIC9K-β-GC1 and pPIC9K-β-GC2 were obtained respectively.

[0070] (3) Obtaining of recombinant Pichia pastoris

[0071] After cloning the β-glucosidase gene into the Pichia pastoris expression vector pPIC9K, the recombinant expression plasmid was linearized by SacI and then the recombinant plasmid was recombined into the Pichia pastoris host strain GS115 by electroporation. The specific parameters of electroporation are: 2mm cuvette, 1500V voltage, 200Ω resistance, 25uF capacitance. After screening on MD plates, yeast colony PCR was used for verification. The specific process refers to the Pichia pastoris operation manual of Invitrogen to ensure that the β-glucosidase has been recombined with the host cell at the AOX1 gene.

[0072] Positive clones were picked, namely recombinant Pichia pastoris GS115-pPIC9K-β-GC1 and GS115-pPIC9K-β-GC2.

[0073] Example 2: Expression of β-glucosidase

[0074] The specific steps are as follows:

[0075] (1) The recombinant Pichia pastoris GS115-pPIC9K-β-GC1 and GS115-pPIC9K-β-GC2 prepared in Example 1 were respectively inoculated into 25 mL of BMGY medium and cultured at 28 °C with a shaking speed of 200 r / min for 24 h; 1 mL of the culture solution was taken and inoculated into a 500 mL shaking flask (eight-layer gauze) containing 25 mL of BMGY medium, and cultured at 28 °C with a shaking speed of 200 r / min for 24 h to obtain a culture solution; the culture solution was centrifuged at 3000 r / min for 5 min, and the supernatant was removed to obtain yeast cells.

[0076] (2) Then the yeast cells were suspended in 10 mL of BMMY medium, and the absorbance A600 of the cell suspension was controlled at about 40; the shaking flask was wrapped with four-layer gauze and continuously induced with 0.1 mL of methanol every 24 h at 22 °C with a shaking speed of 250 r / min for 5 d to respectively prepare fermentation broths containing β-glucosidase β-GC1 and β-glucosidase β-GC2;

[0077] The above fermentation broths were respectively centrifuged at 8000 r / min for 5 min, and the supernatant was collected after centrifugation. The SDS-PAGE is as Figure 2 shown, and the results show that both β-glucosidase β-GC1 and β-glucosidase β-GC2 were expressed.

[0078] (3) The enzyme activities of β-glucosidase β-GC1 and β-glucosidase β-GC2 were respectively detected, and the results show that the enzyme activities of β-glucosidase β-GC1 and β-glucosidase β-GC2 were 235.73 U / mL and 45.66 U / mL respectively.

[0079] Example 3: Preparation of Ginsenoside Rd

[0080] The specific steps are as follows:

[0081] (1) Substrate solution

[0082] The substrate solution is a ginsenoside mixture, which is prepared by mixing ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and ginsenoside Rb3 in a concentration ratio of 2:1:1:1; the total concentration of the substrate solution is 5 mg / mL.

[0083] (2) Respectively add β-glucosidase β-GC1 and β-glucosidase β-GC2 prepared in Example 2 into 1 mL of the substrate solution prepared in step (1) (the contents of ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and ginsenoside Rb3 are 2 mg / mL, 1 mg / mL, 1 mg / mL, and 1 mg / mL respectively) at an addition amount of 400 U / mL, and react at pH 6.0 and 50 °C for 6 h respectively to obtain ginsenoside solutions respectively.

[0084] (3) Detect the contents of ginsenosides (ginsenoside Rb1, Rb2, Rb3, Rc, Rd, F2, CK) in the prepared solutions respectively. The results are as Figure 3 shown. The results show that the contents of ginsenoside Rd prepared by using β-glucosidase β-GC1 and β-glucosidase β-GC2 respectively are 4.01 mg / mL and 4.06 mg / mL respectively.

[0085] Example 4: Preparation of ginsenoside CK

[0086] The specific steps are as follows:

[0087] (1) Preparation of the substrate solution

[0088] The substrate solution is a ginsenoside mixture, which is prepared by mixing ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and ginsenoside Rb3 in a concentration ratio of 2:1:1:1; the total concentration of the substrate solution is 5 mg / mL.

[0089] Preparation of the lactase enzyme solution: Inoculate Aspergillus oryzae into a solid medium of soybean hull:corn cob:bran (w / w / w = 2:1:1) with a water content of 60% (v / w) at an inoculation amount of 20%, and perform solid-state fermentation at 25 °C for 7 d. At the end of fermentation, add the fermentation substrate into a buffer solution of pH 5.5 and 20 mM acetate, and soak at 4 °C in a ratio of 1:5 (w / v) for 24 h. The extract is filtered to obtain the lactase solution.

[0090] (2) Respectively add β-glucosidase β-GC1 and β-glucosidase β-GC2 prepared in Example 2 into 1 mL of the substrate solution prepared in step (1) (the contents of ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and ginsenoside Rb3 are 2 mg / mL, 1 mg / mL, 1 mg / mL, and 1 mg / mL respectively) at an addition amount of 400 U / mL to obtain a reaction system. After adding the lactase enzyme solution with a concentration of 170 U / mL to the above reaction system, react at pH 6.0 and 50 °C for 6 h respectively to obtain ginsenoside solutions respectively.

[0091] (3) Detect the contents of various substances (ginsenoside Rb1, Rb2, Rb3, Rc, Rd, F2, CK) in the ginsenoside solution prepared in step (2). The results are as Figure 3 shown in and Table 1 shown.

[0092] Table 1: Contents of various substances in the ginsenoside solution

[0093]

[0094] The results show that the content of ginsenoside CK obtained using β-glucosidase β-GC1 is: 2.38 mg / mL;

[0095] However, in the reaction solution prepared using β-glucosidase β-GC2, the content of CK could not be detected, proving that the β-glucosidase β-GC2 cannot prepare ginsenoside CK and can only produce 4.01 mg / mL of F2.

[0096] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. Use of β-glucosidase in hydrolysis of ginsenosides, characterized in that, Add β-glucosidase and lactase to the ginsenoside mixture for reaction simultaneously; the ginsenosides include but are not limited to ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, ginsenoside Rb3, and ginsenoside F2; the amino acid sequence of the β-glucosidase is as shown in SEQ ID NO.1 or SEQ ID NO.

3.

2. The application according to claim 1, wherein The nucleotide sequence encoding the β-glucosidase is as shown in SEQ ID NO.2 or SEQ ID NO.

4.

3. A method for preparing ginsenoside CK, characterized in that, The method is to add the β-glucosidase with the amino acid sequence as shown in SEQ ID NO.1 and lactase to the reaction system for reaction simultaneously to prepare ginsenoside CK; the reaction system contains ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and / or ginsenoside Rb3.

4. A method for preparing ginsenoside F2, characterized in that, The method is to add the β-glucosidase with the amino acid sequence as shown in SEQ ID NO.1 and lactase to the reaction system for reaction simultaneously to prepare ginsenoside F2; the reaction system contains ginsenoside Rb1, ginsenoside Rc, ginsenoside Rb2, and / or ginsenoside Rb3.