Method for increasing rhamnolipid production based on gene fusion technology

Abstract

The present invention provides a method for increasing the yield of rhamnolipid based on gene fusion technology. rhl A and rhl The bioengineered bacteria with the B fusion gene were cultured and fermented to increase the rhamnolipid production to 33.72 g·L −1 .

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for increasing the yield of rhamnolipid based on gene fusion technology. Background Art

[0002] Rhamnolipids (RL) are anionic biosurfactants of glycolipids produced by microbial fermentation. Their hydrophilic and hydrophobic groups are composed of rhamnosyl and β-hydroxy fatty acids. RL has good emulsifying properties and can reduce surface / interfacial tension. In addition, it has antibacterial and anti-biofilm activity, which can help remove biofilm and promote wound healing. Most importantly, it is biodegradable, non-toxic and non-irritating, and can replace chemical surfactants in the fields of oil extraction, medicine, daily chemicals and environmental protection.

[0003] The synthesis pathway of rhamnolipids is a cascade reaction consisting of three key enzymes: RhlA, RhlB, and RhlC: RhlA (3-hydroxyacyl-ACP O-3-hydroxyacyl-transferase) catalyzes the precursor β-hydroxyacyl-ACP to obtain β-hydroxy fatty acid (HAA), which reacts with a molecule of dTDP-L-rhamnose under the catalysis of RhlB (rhamnosyltransferase I) to obtain monorhamnolipids, and monorhamnolipids react with a molecule of dTDP-L-rhamnose under the catalysis of RhlC (rhamnosyltransferase II) to generate dirhamnolipids; thus, rhlA and rhlB are the key to determining the speed of the cascade reaction, and the rhlC gene can only determine the ratio of mono- and di-rhamnolipids. At present, it is common to report that the gene expression of rhlA and rhlB is enhanced by overexpression to increase the production of rhamnolipids, but the improvement effect is often unsatisfactory.

[0004] Gene fusion technology is to connect different genes to express fusion proteins with complex functions. The basic principle of constructing fusion proteins is to remove the stop codon of the first protein gene and connect the second protein gene with a stop codon. In order to ensure that each gene of the fusion protein can exert its original activity, it is usually necessary to add a connecting sequence between the two genes, called a linker, which has a certain degree of flexibility. The presence of linkers can bring the spatial structures of proteins closer to each other, thereby accelerating the reaction process. This technology has achieved good research results in the transformation of many engineered bacteria.

[0005] There is no report on the fusion of RhlA and RhlB genes to increase rhamnolipid production. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a method for increasing the yield of rhamnolipid based on gene fusion technology, so as to solve the problem of low rhamnolipid yield in the prior art.

[0007] One aspect of the present invention provides a fusion gene comprising rhlA and rhlB genes.

[0008] Furthermore, the rhlA and rhlB genes are connected via a connecting fragment.

[0009] Furthermore, the connecting fragment is a nucleotide chain of no more than 90 nucleotides, for example, a nucleotide chain of nucleotide sequence SEQID NO.20 can be used. The connecting fragment is to shorten the distance between the two genes, so the nucleotide chain should not be too long.

[0010] Furthermore, the nucleotide sequence of the fusion gene is shown in SEQ ID NO.24.

[0011] Another aspect of the present invention provides a recombinant plasmid, wherein the recombinant plasmid contains the fusion gene as described above.

[0012] Furthermore, the recombinant plasmid is P oprL -rhlA-linker-rhlB-pUCP18E.

[0013] Another aspect of the present invention provides a bioengineering bacterium, wherein the bioengineering bacterium contains the recombinant plasmid described above.

[0014] Furthermore, the bioengineered bacteria are recombinant Escherichia coli or recombinant Pseudomonas aeruginosa, which are commonly used bioengineered bacteria for fermentation to prepare rhamnolipid.

[0015] Another aspect of the present invention provides the use of the above-mentioned fusion gene, recombinant plasmid or bioengineering bacteria in the preparation of rhamnolipid.

[0016] Another aspect of the present invention provides a method for increasing rhamnolipids, the method comprising:

[0017] 1) constructing a bioengineering bacterium containing a fusion gene, wherein the fusion gene contains rhlA and rhlB genes;

[0018] 2) Cultivating bioengineered bacteria can increase the production of rhamnolipids.

[0019] Furthermore, the step 1) is: constructing a recombinant plasmid containing a fusion gene, and introducing the recombinant plasmid into a bioengineering bacterium, wherein the recombinant plasmid is P oprL-rhlA-linker-rhlB-pUCP18E. Of course, those skilled in the art can also use other plasmids commonly used in the art.

[0020] Furthermore, the step 2) specifically includes: inoculating the bacterial strain into a culture medium to obtain a seed culture solution, and then inoculating the seed culture solution into a fermentation medium for fermentation.

[0021] Furthermore, the method further comprises step 3): extracting and purifying the rhamnolipid in the fermentation broth. The extraction and purification methods can refer to the extraction and purification methods known in the prior art.

[0022] The above-mentioned method for increasing the yield of rhamnolipids can refer to the examples given in this specification.

[0023] As described above, the method for increasing the production of rhamnolipids by gene fusion technology of the present invention has the following beneficial effects:

[0024] We constructed a bioengineered bacterium containing rhlA and rhlB fusion genes and fermented it to increase the yield of rhamnolipid to 33.72 g·L -1 , which is 3.31 times that of the wild type. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Gel electrophoresis after PCR amplification of rhlA and rhlB gene sequences

[0026] Figure 2 Gel electrophoresis after PCR amplification and adding linker sequence

[0027] Figure 3 Gel electrophoresis after PCR amplification and addition of homology arm sequences

[0028] Figure 4 Gel electrophoresis after PCR amplification and addition of homology arm sequences

[0029] Figure 5 Recombinant plasmid P oprL -Gel electrophoresis of rhlA-linker-rhlB-pUCP18E colony after PCR amplification

[0030] Figure 6 P oprL -rhlA-linker-rhlB-pUCP18E plasmid map

[0031] Figure 7 Recombinant plasmid P oprL -rhlA-linker-pUCP18E and P oprL-Gel electrophoresis of rhlB-linker-pUCP18E colony after PCR amplification

[0032] Figure 8 P oprL -rhlA-linker-pUCP18E plasmid map

[0033] Fig. 9 P oprL -rhlB-linker-pUCP18E plasmid map

[0034] Fig.10 Comparison of rhamnolipid production in recombinant gene fusion engineering bacteria DETAILED DESCRIPTION

[0035] The rhlA (GenBank accession number 878955) and rhlB (GenBank accession number 878954) genes are adjacent to each other in the genome of Pseudomonas aeruginosa, but due to the influence of spatial structure, the proteins they express are not close to each other, which easily makes it difficult for the product catalyzed by rhlA to quickly enter the catalytic center of rhlB to participate in the reaction, resulting in the phenomenon that the final yield is not significantly improved. In order to solve the problem of low rhamnolipid production, we connected the rhlA gene and the rhlB gene through a short linker sequence. On the basis of ensuring that the rhlA and rhlB proteins have their own activities, their spatial structures are close to each other to form a substrate channel, thereby avoiding the "escape" of the intermediate product, accelerating the process of the cascade reaction, and thus increasing the rhamnolipid production.

[0036] Definition of terms

[0037] In this article, the term "fusion gene": gene fusion refers to a gene formed by connecting the coding regions of two or more genes end to end and under the same set of regulatory sequences.

[0038] Herein, the term "bioengineering bacteria" refers to those cells used for transformation, i.e., cells for expressing a target gene. Bioengineering bacteria can be isolated cells or cell lines cultured in culture, or cells present in living tissues or organisms. In the context of the present invention, host cells are preferably cells that can grow in culture.

[0039] The following is an explanation of the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the process equipment or devices not specifically noted in the following embodiments all adopt conventional equipment or devices in the art. In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the presence of other method steps before and after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise specified; it should also be understood that the combined connection relationship between one or more devices / devices mentioned in the present invention does not exclude the presence of other devices / devices before and after the combination device / device or the insertion of other devices / devices between these explicitly mentioned two devices / devices, unless otherwise specified. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, rather than limiting the order of arrangement of each method step or limiting the scope of the present invention. The change or adjustment of its relative relationship, without substantial change in the technical content, should also be regarded as the scope of the present invention.

[0040] Example 1 Construction of recombinant gene vector P oprL -rhlA-linker-rhlB-pUCP18E

[0041] Take rhlA without TGA (nucleotide sequence such as SEQ ID NO.23) and rhlB with TGA

[0042] SEQ ID NO.19:

[0043]

[0044] The rhlA and rhlB fragments were amplified by PCR using the genome of Pseudomonas aeruginosa ATCC27853 as a template. The reaction system was 50 μL: 1 μL genome, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 25 μL 2× Phanta Master Mix high-fidelity DNA polymerase, and 22 μL ultrapure water. The primers are shown in Table 1. The PCR program was: (1) 94°C, 10 min; (2) 30 cycles: 95°C, 30 s; 55°C, 30 s; 72°C, 1 min or 1 min 30 s; (3) 72°C, 10 min; (4) 16°C, +∞.

[0045] Table 1 PCR amplification primers

[0046]

[0047] The amplification primers are shown in Table 1. It should be noted that the termination codon TGA was removed from the reverse primer when the rhlA gene was retrieved. The gene retrieval results are shown in Figure 1 As shown, the gene sizes of rhlA and rhlB were 885 bp and 1281 bp, respectively. Bands of corresponding sizes were successfully obtained. The PCR products were purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent use.

[0048] Get linker sequence

[0049] The designed linker amplification primer sequences were mixed in a 1:1 ratio (as shown in Table 2), and a double-stranded DNA sequence was obtained by annealing (95°C, 3 min, cooled to room temperature), named linker, with a nucleotide sequence of GGCGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCGGCGGCAGC (SEQ ID NO.20); the amino acid sequence was GGGGS GGGGS GGGGS (SEQID NO.21).

[0050] Table 2 Linker primer nucleotide sequence

[0051]

[0052] Overlap extension PCR to obtain rhlA-linker

[0053] The rhlA obtained without TGA and the linker sequence were subjected to overlap extension PCR. The linker sequence was added to the back of the rhlA gene by this method. The results are as follows: Figure 2 As shown, the gene size of rhlA-linker is 930 bp (nucleotide sequence as SEQ ID NO.22), and a gene band of corresponding size was successfully obtained, indicating that the linker sequence was successfully inserted behind the rhlA gene. The PCR product was then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) and used for the subsequent addition of homology arm sequences.

[0054] SEQ ID NO.22:

[0055]

[0056]

[0057] PCR to add homology arm sequences

[0058] The rhlA-linker and rhlB genes recovered above were amplified by PCR to add homology arm sequences. The primer sequences are shown in Table 3. The PCR results are shown in Table 3. Figure 3 As shown, the gene sizes of rhlA-linker and rhlB were 930 bp and 1281 bp, respectively. Gene bands of corresponding sizes were successfully obtained, indicating that the homology arm sequence was successfully added. The PCR product was then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent one-step cloning connection (ClonExpress MultiS One Step Cloning Kit, Nanjing Novogene Co., Ltd., Cat. No. C113-02).

[0059] Table 3 Homologous arm primers

[0060]

[0061] Vector digestion

[0062] The vector used for connection is the shuttle expression vector P constructed in the early stage of the experiment and suitable for Pseudomonas aeruginosa. oprL -pUCP18E, enzyme digestion system: 50 μL: 1 μL Sal I, 1 μL Xho I, 4 μL P oprL -pUCP18E, 5μL 10×Q-Cutbuffer, 39μLddH 2 O, 37 ° C for 3 h, and the digestion product was purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent ligation.

[0063] One-step cloning ligation

[0064] The system for multi-fragment ligation is 10 μL: 1.5 μL rhlA-linker, 2.1 μL rhlB, 3.4 μL P oprL -pUCP18E(Sal I-Xho I, 26.3ng·μL -1 ), 1 μL Exnase Multis, 2 μL 5×CE Multis buffer. The ligation reaction was carried out at 37°C according to the above system for 0.5 h. After the reaction, the ligation product was transformed into E. coli BL21 (DE3) competent cells and spread on a plate containing carbenzyl antibiotics. After the transformants grew out, the transformants were picked for colony PCR verification.

[0065] Colony PCR verification

[0066] The primers for colony PCR amplification were rhlA-F and M13R (SEQ ID NO.23: CAGGAA ACAGCTATGACC). The size of the target band was about 2214 bp. Figure 5As shown, the gene fragment of corresponding size was successfully amplified, proving that the gene fusion plasmid P oprL -rhlA-linker-rhlB-pUCP18E was successfully constructed, and the plasmid map is shown in Figure 6 As shown, the corresponding positive transformants were picked and inoculated into LB medium containing carbenicillin resistance and cultured overnight at 37°C and 220rpm. The next day, the plasmid was extracted using a plasmid mini-preparation kit (Shanghai Jierui Bioengineering Co., Ltd.) and sequenced and verified by Suzhou Hongxun Technology Co., Ltd.

[0067] The nucleotide sequence of rhlA-linker-rhlB is as follows: SEQ ID NO.24

[0068]

[0069] Example 2 Construction of recombinant plasmid rhlA-linker-P oprL -pUCP18E

[0070] In order to compare the effect of fusion genes, we also constructed single gene (rhlA, rhlB) recombinant plasmids containing linkers as control experiments. The specific construction process is as follows:

[0071] Retrieving the rhlA gene without TGA

[0072] The rhlA fragment was amplified by PCR using the genome of Pseudomonas aeruginosa ATCC27853 as a template. The reaction system was 50 μL: 1 μL genome, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 25 μL 2× Phanta Master Mix high-fidelity DNA polymerase, and 22 μL ultrapure water. The primers are shown in Table 1. The PCR program was: (1) 94°C, 10 min; (2) 30 cycles: 95°C, 30 s; 55°C, 30 s; 72°C, 1 min or 1 min 30 s; (3) 72°C, 10 min; (4) 16°C, +∞.

[0073] The amplification primers are shown in Table 1. It should be noted that the termination codon TGA should be removed from the reverse primer when the rhlA gene is retrieved. The gene retrieval results are shown in Figure 1 As shown, the size of the rhlA gene was 885 bp, and gene fragments of corresponding sizes were obtained. The PCR products were then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent overlap extension PCR.

[0074] Get linker sequence

[0075] The designed linker primer sequences were mixed in a 1:1 ratio (as shown in Table 2), and a double-stranded DNA sequence was obtained by annealing (95°C, 3 min, cooled to room temperature), named linker, with a nucleotide sequence of SEQ ID NO.20 and an amino acid sequence of SEQ ID NO.21.

[0076] Overlap extension PCR to obtain rhlA-linker

[0077] The designed linker primer sequence (as shown in Table 2) was annealed to obtain a double-stranded sequence, and then rhlA and the linker sequence were subjected to overlap extension PCR. The linker sequence was added to the back of rhlA by this method. The results are shown in FIG. Figure 2 As shown, the gene size of rhlA-linker is 930 bp, and a gene fragment of corresponding size was obtained. The linker sequence was successfully inserted behind the rhlA gene. The PCR product was then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) and used for the subsequent addition of homology arm primers.

[0078] PCR to add homology arm sequences

[0079] The rhlA-linker gene recovered above was amplified by PCR to add homology arm sequences. The homology arm primer sequences are shown in Table 4. The PCR results are shown in Table 4. Figure 3 As shown, the gene size of rhlA-linker is 933 bp, and the gene fragment of corresponding size was successfully obtained. Then, the PCR product was purified by gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent one-step cloning connection (Nanjing Novogene Co., Ltd. ClonExpress IIOne StepCloning Kit, Catalog No. C112-01).

[0080] Table 4 Homology arm primers

[0081]

[0082] Vector digestion

[0083] The vector used for connection is the shuttle expression vector P constructed in the early stage of the experiment and suitable for Pseudomonas aeruginosa. oprL -pUCP18E, enzyme digestion system: 50 μL: 1 μL Sal I, 1 μL Xho I, 4 μL P oprL -pUCP18E, 5μL 10×Q-Cutbuffer, 39μLddH 2O, 37 ° C for 3 h, and the digestion product was purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent ligation.

[0084] One-step cloning ligation

[0085] The ligation system is 10 μL: 2 μL rhlA-linker, 5 μL P oprL -pUCP18E(Sal I-Xho I, 26.3ng·μL -1 ), 2 μL 5×CE buffer, 1 μL Exnase II. The ligation reaction was carried out at 37°C according to the above system for 0.5 h. After the reaction, the ligation product was transformed into E. coli BL21 (DE3) competent cells and spread on a plate containing carbenzyl antibiotics. After the transformants grew, the transformants were picked for colony PCR verification.

[0086] Colony PCR verification

[0087] The primers for PCR amplification were M13F (SEQ ID NO. 25TGTAAAACGACGGCCAGT) and M13R (CAGGAAACAGCTATGACC). rpsJ sequence (500bp), so the amplified target band is about 1434bp. The PCR results are as follows Figure 7 As shown, the target band of the corresponding size was successfully amplified, proving that the recombinant plasmid P oprL -rhlA-linker-pUCP18E was successfully constructed, and the plasmid map is as follows Figure 8 As shown, the corresponding positive transformants were picked and inoculated into LB medium containing carbenicillin resistance, and cultured overnight at 37°C and 220 rpm. The next day, the plasmid was extracted using a plasmid mini-extraction kit (Shanghai Jierui Bioengineering Co., Ltd.) and sequenced and verified by Suzhou Hongxun Technology Co., Ltd. Example 3 Construction of recombinant gene vector rhlB-linker-P oprL -pUCP18E

[0088] Retrieve the rhlB gene without TGA (SEQ ID NO.26):

[0089]

[0090]

[0091] The rhlB fragment was amplified by PCR using the genome of Pseudomonas aeruginosa ATCC27853 as a template. The reaction system was 50 μL: 1 μL genome, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 25 μL 2× Phanta Master Mix high-fidelity DNA polymerase, and 22 μL ultrapure water. The primers are shown in Table 1. The PCR program was: (1) 94°C, 10 min; (2) 30 cycles: 95°C, 30 s; 55°C, 30 s; 72°C, 1 min or 1 min 30 s; (3) 72°C, 10 min; (4) 16°C, +∞.

[0092] The amplification primers are shown in Table 1, and the gene retrieval results are shown in Figure 1 As shown, the gene size of rhlB was 1278 bp, and the corresponding gene sequence was successfully obtained. The PCR product fragments were then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent overlap extension PCR.

[0093] Get linker sequence

[0094] The designed linker primer sequences were mixed in a 1:1 ratio (as shown in Table 2), and a double-stranded DNA sequence was obtained by annealing (95°C, 3 min, cooled to room temperature), named linker, with a nucleotide sequence of SEQ ID NO.20 and an amino acid sequence of SEQ ID NO.21.

[0095] Overlap extension PCR to obtain rhlB-linker

[0096] The designed linker primer sequence (as shown in Table 2) was annealed to obtain a double-stranded sequence, and then rhlB and the linker sequence were subjected to overlap extension PCR. The linker sequence was added to the back of the rhlB gene by this method. The results are shown in FIG. Figure 2 The gene size of rhlB-linker shown is 1323 bp (nucleotide sequence as SEQ ID NO.27), and a gene band of corresponding size was obtained. The linker sequence was successfully inserted behind the rhlB gene. The PCR product was then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) and used for the subsequent addition of homology arm primers.

[0097] SEQ ID NO.27:

[0098]

[0099]

[0100] PCR to add homology arm sequences

[0101] The rhlB-linker gene recovered above was amplified by PCR to add homology arm sequences. The homology arm primer sequences are shown in Table 5. The PCR results are shown in Table 5. Figure 4 As shown, the size of the rhlB-linker gene is 1323 bp. The PCR product was then purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent one-step cloning connection (Nanjing Novogene Co., Ltd. ClonExpress IIOne Step Cloning Kit, Catalog No. C112-01).

[0102] Table 5 Homology arm primers

[0103]

[0104] Vector digestion

[0105] The vector used for connection is the shuttle expression vector P constructed in the early stage of the experiment and suitable for Pseudomonas aeruginosa. oprL -pUCP18E, enzyme digestion system: 50 μL: 1 μL Sal I, 1 μL Xho I, 4 μL P oprL -pUCP18E, 5μL 10×Q-Cutbuffer, 39μLddH 2 O, 37 ° C for 3 h, and the digestion product was purified using a gel recovery purification kit (Shanghai Jierui Bioengineering Co., Ltd.) for subsequent ligation.

[0106] One-step cloning ligation

[0107] The ligation system is 10 μL: 3 μL rhlB-linker, 4 μL P oprL -pUCP18E(Sal I-Xho I, 26.3ng·μL -1 ), 2 μL 5×CE buffer, 1 μL Exnase II. The ligation reaction was carried out at 37°C according to the above system for 0.5 h. After the reaction, the ligation product was transformed into E. coli BL21 (DE3) competent cells and spread on a plate containing carbenzyl antibiotics. After the transformants grew out, the transformants were picked for colony PCR verification.

[0108] Colony PCR verification

[0109] The primers for PCR amplification were M13F and M13R. rpsJ sequence (500bp), so the amplified target band is about 1826bp. The PCR results are as follows Figure 7 As shown, the target band of the corresponding size was successfully amplified, proving that the recombinant plasmid P oprL -rhlB-linker-pUCP18E was successfully constructed, and the plasmid map is as follows Fig. 9 As shown, the corresponding positive transformants were picked and inoculated into LB medium containing carbenicillin resistance and cultured overnight at 37°C and 220rpm. The next day, the plasmid was extracted using a plasmid mini-preparation kit (Shanghai Jierui Bioengineering Co., Ltd.) and sequenced and verified by Suzhou Hongxun Technology Co., Ltd.

[0110] Example 4 Construction of recombinant Pseudomonas aeruginosa expressing gene fusion

[0111] 3 μL of the successfully verified recombinant plasmids were added to the competent cells of Pseudomonas aeruginosa ATCC27853 in sequence, and mixed by pipetting and incubation on ice for 30 min. Use the BIO-RAD Micro Pulser electroporator, select a 0.1 cm electric shock cup for transformation, the electric shock voltage is 2.5 kV, the time is 3.0 ms, and the electric shock is placed on ice after the end. 800 μL LB culture medium is quickly added, and after pipetting and resuspending, the bacterial solution is sucked out and placed in a centrifuge tube. It is shaken and cultured in a 37 ° C shaker for 2 hours, and then the inoculated bacterial solution is spread on the LB plate containing carbenicillin resistance. The grown transformants are Pseudomonas aeruginosa containing the recombinant plasmid. After that, pick a single colony and inoculate it into LB liquid culture medium, and take an appropriate amount of bacterial solution for preservation the next day.

[0112] Example 5 Comparison of the yield of rhamnolipid expressed by gene fusion in recombinant Pseudomonas aeruginosa

[0113] The recombinant Pseudomonas aeruginosa obtained in Example 4 was fermented and cultured in turn to compare the rhamnolipid production. Different recombinant Pseudomonas aeruginosa and wild bacteria were inoculated into LB medium, and cultured overnight at 37°C in a shaking incubator as seed culture medium. The seed culture medium was then inoculated into 100 mL of fermentation medium (80 g·L -1 Soybean oil, 0.3 g·L -1 K 2 HPO 4 , 15g·L -1 NaNO 3 , 1.0g·L -1 KCl, 0.5 g L -1 MgSO 4 7H 2 O) in a 500 mL conical flask and add 0.1% trace elements (2 g L -1 Trisodium citrate·2H 2 O, 0.28mg·L -1 FeCl 3 6H2 O, 1.4 g L - 1 ZnSO 4 7H 2 O, 1g·L -1 CoCl 2 7H 2 O, 3g·L -1 CuSO 4 7H 2 O) and carbenicillin (200 mg mL -1 Carbenicillin) at 30°C, 180 rpm·min -1 After fermentation for 7 days, samples were taken to determine the rhamnolipid content.

[0114] Rhamnolipid concentration determination

[0115] Take 100 μL of the fermentation broth, adjust the pH to 2.0 with hydrochloric acid; add 300 μL of ethyl acetate and shake to extract for 10 min, centrifuge at 12000 rpm for 5 min after the extraction; aspirate the organic phase, add 300 μL of ethyl acetate to extract for 10 min, centrifuge at 12000 rpm for 5 min after the extraction; aspirate the organic phase again, combine the organic phases aspirated twice, and volatilize the organic phase under a nitrogen blower. After the ethyl acetate is completely volatilized, add 100 μL of H 2 O, shake and mix evenly, and use it as the sample to be tested.

[0116] After appropriately diluting the above 100 μL treated sample, take 100 μL into a 1.5 mL centrifuge tube, add 100 μL of orcinol reagent (1.6% w / v), add 800 μL of 60% concentrated sulfuric acid (v / v), react at 80°C, 1000 r / min for 30 min, cool to room temperature, measure the absorbance at 421 nm, and substitute the reading into the standard curve to calculate the rhamnosyl concentration, rhamnolipid concentration = rhamnosyl concentration × 3.4 × dilution factor.

[0117] Drawing of standard curve

[0118] According to Table 6, 0, 0.01, 0.02, 0.04, 0.05, 0.06, 0.08, 0.1, and 0.2 mg mL -1 L-Rhamnose solution.

[0119] Table 6 Preparation of rhamnose standard curve

[0120]

[0121] Take 100 μL of standard solution of different concentrations into 1.5 mL centrifuge tubes, add 100 μL of orcinol reagent (1.6% w / v), add 800 μL of 60% concentrated sulfuric acid, react at 80°C, 1000 r / min for 30 min, cool to room temperature, measure the absorbance at 421 nm, and draw a standard curve.

[0122] The results of rhamnolipid determination are as follows Fig.10 Show: Gene fusion engineering bacteria ATCC27853 / pUCP18E-P rpsJ -rhlA-linker-rhlB rhamnolipid production reached 33.72 g·L -1 , which is 3.31 times of the wild type, and the single gene overexpression engineering bacteria ATCC27853 / pUCP18E-P rpsJ -rhlA-linker and ATCC27853 / pUCP18E-P rpsJ -rhlB-linker, 2.94 and 2.20 times, product yield Y p / s Reached 0.42 g·g –1 , exceeding the Y reported in the literature p / s Level: 0.278 g·g –1 and 0.392 g·g –1 (Appl.Microbiol.Biotechnol.2011,89,585–592; Bioresour.Technol.2012,117,208–213), indicating that the production of rhamnolipids can be significantly increased through gene fusion technology, and rhamnolipid-engineered bacteria with high product yields were obtained. This method is also applicable to the transformation of other engineered bacteria.

[0123] In summary, the present invention provides a method for increasing the rhamnolipid production of Pseudomonas aeruginosa by gene fusion technology, and obtains an engineered bacterium with high rhamnolipid production by gene fusion technology, while reducing production costs. At the same time, a method for rapidly constructing a gene fusion plasmid is disclosed, which has strong versatility and can also be applied to the metabolic modification of other engineered bacteria.

[0124] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A fusion gene, characterized in that: The nucleotide sequence of the fusion gene is shown in SEQ ID NO.

24.

2. A recombinant plasmid, characterized in that: The recombinant plasmid contains the fusion gene as claimed in claim 1.

3. The recombinant plasmid according to claim 2, characterized in that: The recombinant plasmid is P oprL - rhl A-linker- rhl B-pUCP18.

4. A bioengineering bacterium, characterized in that: The bioengineering bacteria contains the recombinant plasmid as claimed in claim 2.

5. The bioengineering bacteria according to claim 4, characterized in that: The bioengineering bacteria are recombinant Escherichia coli or recombinant Pseudomonas aeruginosa.

6. Use of the fusion gene according to claim 1, the recombinant plasmid according to any one of claims 2 to 3, or the bioengineering bacteria according to any one of claims 4 to 5 in the preparation of rhamnolipid.

7. A method for preparing rhamnolipid, the method comprising: 1) constructing a bioengineered bacterium containing the fusion gene as claimed in claim 1; 2) Cultivate bioengineered bacteria and ferment them to obtain rhamnolipids.

8. The method according to claim 7, characterized in that: The step 1) is to construct a recombinant plasmid containing a fusion gene and introduce the recombinant plasmid into bioengineering bacteria. The recombinant plasmid is P oprL - rhl A-linker- rhl B-pUCP18E.

Images