Genes that promote tomato fruit ripening and their regulation methods

Abstract

A gene that promotes tomato fruit ripening and a method for regulating the same, wherein the nucleotide sequence of the gene is shown in Seq No. 1. SlIMP3 The complete coding sequence of the gene was obtained, the target was designed, and the target was connected to the vector CRIPSR / Cas9. The plants were transformed by Agrobacterium infection to obtain gene-edited plants. The gene-edited plants were analyzed, and the results showed that the gene editing could accelerate the ripening of tomato fruit.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and relates to a gene for promoting tomato fruit ripening and a method for regulating the same, and in particular to a gene SlIMP3 encoding a tomato nuclear import protein, and the application of the gene in promoting tomato fruit ripening. Background Art

[0002] Tomato fruit is rich in vitamin C, lycopene, and a small amount of phosphorus, potassium and other nutrients needed by the human body. It has the advantages of sweet and sour taste, easy processing, and can be propagated by seeds or asexually propagated by top and tender branch cuttings. As a popular fruit and vegetable crop, tomatoes account for a large proportion of the number of tomatoes supplied to the fruit and vegetable market each year, but their fruit growth cycle is long. Therefore, promoting early maturity of tomatoes is of great significance for shortening the fruit cultivation cycle and resisting the risks of plant planting and sales. At the same time, it can also make tomato fruits go on the market earlier, increase market sales prices, and increase production benefits. Tomato has a clear genetic background and is a model plant that can be used for fruit development research. Because its mutant materials are easy to obtain and can be used for production research, tomatoes have become ideal plants for gene editing materials. Crispr / Cas9-mediated gene editing technology has been applied in tomatoes. Therefore, tomatoes are widely used in the study of gene functions, especially gene functions related to fruit development, including the study of the mechanism of fruit development and ripening. The study of fruit ripening is crucial to revealing the mechanism of fruit development and helps to increase yield and optimize quality.

[0003] Recent studies have found that H 2 As a gas signal molecule in plants, S can participate in a variety of physiological processes in plants and delay the maturation and aging of a variety of fruits and vegetables. Studies have shown that cysteine ​​desulfhydrylase LCD1 is a mediator of endogenous H 2 LCD1 deficiency accelerates the ripening and aging process of tomato fruit. Previous laboratory studies have found that LCD1 is localized in the cell nucleus. Yeast two-hybrid experiments and luciferase complementation experiments have found that there is an interaction between LCD1 and nuclear import protein importinα3. Nuclear import protein importinα3 is a key protein involved in mediating LCD1 into the cell nucleus. It is not clear whether importinα3 regulates tomato fruit ripening by mediating LCD1 nuclear localization.

[0004] During the process of ripening and aging, tomato fruit undergoes metabolism of various substances, and pigment metabolism is the most significant feature of this stage. The change in fruit pigment deposition is due to the degradation of chlorophyll and the accumulation of carotenoids in cells. The ripening process of tomato fruit is mainly divided into three stages: green ripening stage, color breaking stage and red ripening stage. The genes encoding enzymes related to the chlorophyll degradation pathway in tomato fruit include: chlorophyll b reductase (NYC1), pheophytinase (PPH), pheophorbide a oxygenase (PAO) and stay-green protein (SGR1). Studies have successfully identified three key genes in the carotenoid metabolic pathway in tomatoes, namely, the gene PSY encoding phytoenease, the gene PDS encoding phytoene dehydrogenase and the gene ZDS encoding carotene dehydrogenase. PSY regulates the synthesis of carotenoids in tomato fruit, and PDS and ZDS are the downstream key genes in its metabolic pathway. Summary of the invention

[0005] The purpose of the present invention is to provide a gene that promotes tomato fruit ripening and a method for regulating the gene.

[0006] To achieve the above purpose and other related purposes, the technical solution provided by the present invention is: a gene that promotes the ripening of tomato fruits, and the nucleotide sequence of the gene is shown in Seq No.1.

[0007] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: a method for regulating and controlling the ripening of tomato fruits, comprising the following steps:

[0008] Step 1: Add 10 μL of target-forward primer-F 1 , 10 μL target-reverse primer-R 1 , 80 μL ddHO 2 O and mix well; then add 10 μL of target two forward primer-F 2 、10μL Target II Reverse Primer-R 2 , 80 μL ddHO 2 O and mix well; place the above two tubes of primer mixture in a PCR instrument respectively, treat at 88-92℃ for 25-35s, and then move to room temperature to cool to complete the annealing of the target primers, and use them as target one adapter and target two adapter respectively;

[0009] Target-Forward Primer-F 1 :5'-GTCAGAGGCCAAGTGATAGGACCG-3';

[0010] Target-Reverse Primer-R 1 :5'-AAACCGGTCCTATCACTTGGCCTC-3';

[0011] Target 2 forward primer-F 2 :5'-GTCAGCGGCCTTCGTCGGCATCAA-3';

[0012] Target 2 Reverse Primer-R 2 :5'-AAACTTGATGCCGACGAAGGCCGC-3';

[0013] Step 2: Prepare 10 μL of enzyme digestion and ligation reaction solution, and use the cutting and ligation method to connect the target 1 linker and the target 2 linker to the gRNA expression cassette respectively, including:

[0014] 0.5μL target-adapter, 1μL gRNA plasmid U3d / U3b, 1μL 10×cutsmart buffer, 0.4μL BsaI, 0.1μL T4 DNA ligase, 0.4μL T4 DNA ligase buffer, ddH 2 O was added to 10 μL; PCR amplification parameters were: 37°C 5 min, 20°C 5 min, 5 cycles, 4°C∞; target point one product was obtained;

[0015] 0.5μL target two-linker, 1μL gRNA plasmid U3d / U3b, 1μL 10×cutsmart buffer, 0.4μL BsaI, 0.1μL T4 DNA ligase, 0.4μL T4 DNA ligase buffer, ddH 2 O was added to 10 μL; PCR amplification parameters were: 37°C 5 min, 20°C 5 min, 5 cycles, 4°C∞; target site II product was obtained;

[0016] Step 3: First round of PCR amplification: PCR amplification is performed using the target 1 product and target 2 product obtained in step 2 as templates, including:

[0017] Target-1 reaction system: 1 μL target-1 product, 2 μL target-1 reverse primer-R 1 , 2μL primer UF, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2O; PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the first product was obtained; Primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0018] Target 2 reaction 1 system: 1 μL target 2 product, 2 μL target 2 reverse primer-R 2 , 2μL primer UF, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O; PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the second product was obtained; Primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0019] Target-reaction 2 system: 1 μL target-product, 2 μL target-forward primer-F 1 , 2μL primer gRNA-R, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O; PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the third product was obtained; Primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0020] Target 2 reaction 2 system: 1 μL target 2 product, 2 μL target 2 forward primer-F 2 , 2μL primer gRNA-R, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O, PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the fourth product was obtained; Primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0021] Step 4: Second round of amplification: Pre-mix the position-specific primer pairs into a 10× working solution, 1.5 μM each:

[0022] PT1: 1.5 μL primer B1' + 1.5 μL primer B2 + 7 μL ddH 2 O;

[0023] PT2L: 1.5 μL primer B2' + 1.5 μL primer BL + 7 μL ddH 2 O;

[0024] Take 1 μL of the first, second, third and fourth products of the first round of PCR amplification respectively and add ddH 2 O was diluted 10 times to obtain a first product dilution, a second product dilution, a third product dilution and a fourth product dilution; the first product dilution and the third product dilution were mixed to obtain a second round first template, and the second product dilution and the fourth product dilution were mixed to obtain a second round second template;

[0025] 2μL second round first template, 3μL PT1, 0.6μL dNTPs, 6μL 5× Super-Fidelity DNA Polymerase buffer, 0.6μL Super-Fidelity DNA Polymerase, 17.8μL ddH 2 O, PCR system: 95℃1min; 95℃10s, 60℃15s, 72℃15s, 15-20 cycles; 72℃10min; 4℃∞; get the second round PCR amplification product 1;

[0026] 2μL second round second template, 3μL PT2L, 0.6μL dNTPs, 6μL 5× Super-Fidelity DNA Polymerase buffer, 0.6μL Super-Fidelity DNA Polymerase, 17.8μL ddH 2 O, PCR system: 95℃1min; 95℃10s, 60℃15s, 72℃15s, 15-20 cycles; 72℃10min; 4℃∞; get the second round PCR amplification product 2;

[0027] Primer B1′: 5′-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3′;

[0028] Primer B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3';

[0029] Primer B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3';

[0030] Primer BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3';

[0031] Step 5: Mix the second-round PCR amplification product 1 and the second-round PCR amplification product 2 at a concentration ratio of 1:1, and purify the mixed product using a DNA product purification kit to obtain a purified gRNA expression cassette;

[0032] Step 6: Use the cutting and ligation method to connect the purified gRNA expression cassette obtained in step 5 to the Cas9 plasmid to obtain a ligation product;

[0033] Step 7: The ligation product obtained in step 6 was transformed into Escherichia coli DH5α by chemical heat shock method, and the recombinant Crispr / Cas9-SlIMP3 plasmid was extracted;

[0034] Step 8: Transform the recombinant CRISPR / Cas9-SlIMP3 plasmid into EHA105 Agrobacterium competent cells to obtain EHA105 Agrobacterium containing the Crispr / Cas9-SlIMP3 plasmid;

[0035] Step 9: Use EHA105 Agrobacterium containing Crispr / Cas9-SlIMP3 plasmid to infect tomato cotyledons to obtain transformed tomato plants.

[0036] The preferred technical solution is: in step 6, 15 μL ligation system: 0.5 μL purified gRNA expression cassette, 1 μL Cas9 plasmid, 1.5 μL 10×cutsmart buffer, 0.5 μL BsaI endonuclease, 11.5 μL ddH 2 O, PCR reaction system: 37℃, 10min; add 0.4μL 10×T4 DNA ligase buffer and 0.1μL T4DNA ligase to the reaction system after enzyme digestion, mix again and place in PCR instrument, reaction conditions are 37℃2min, 10℃3min, 20℃5min, 13 cycles; 37℃2min; 4℃∞; get the ligation product.

[0037] The preferred technical solution is: in step 7, take 1 μL of the above-mentioned ligation product and add it to 100 μL of Escherichia coli DH5α competent cells, let it stand on ice for 30 minutes, heat shock at 42°C for 45 seconds, and ice bath for 2-3 minutes. Add 700 μL of liquid culture medium without antibiotics to a centrifuge tube, place it at 37°C, 200rpm shaker for 60 minutes, centrifuge at 5000rpm for 2 minutes, collect the bacterial solution, discard 600 μL of the supernatant, and mix the remaining 100 μL of bacterial solution by suction and blowing, evenly spread it on a solid culture medium containing kanamycin, invert and culture at 37°C for 16 hours, pick a monoclonal colony, mix it by suction and blowing in 10 μL of sterile water, take 2 μL of bacterial solution for PCR identification, and the 25 μL colony PCR system is as follows: 2 μL bacterial solution, 1 μL each of SP-DL / SP-R, 12.5 μL of 2×Rapid Taq Master Mix, and ddH 2 O 8.5μL, PCR system: pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15s, annealing at 55℃ for 1min, extension at 72℃ for 45s, 32 cycles; thorough extension at 72℃ for 5min; 4℃∞, after the reaction is completed, check whether the PCR product band size conforms to the theoretical value on agarose gel, transfer the remaining bacterial liquid of the monoclonal with the correct band size to 4mL of liquid culture medium containing kanamycin, and culture in a shaker at 37℃ at 200rpm for 16h. Use a plasmid mini-extraction kit to extract the recombinant Crispr / Cas9-SlIMP3 plasmid, and verify whether the plasmid extraction is successful by agarose gel electrophoresis, and send the extracted plasmid to the company for sequencing and identification.

[0038] The preferred technical solution is: the reaction of step 8 is specifically as follows: take 100 μL of Agrobacterium competent cells EHA105, melt them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently shake the bottom of the centrifuge tube with your hand, mix well, let stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes; add 700 μL of antibiotic-free LB liquid culture medium, shake and culture at 28°C for 2-3 hours; centrifuge at 6000rpm for 1 minute to collect the bacteria, retain 90-110 μL of supernatant, blow and mix to resuspend the bacteria, spread on LB-Kana / Rif solid culture medium, invert and culture in a 28°C incubator for 2-3 days, and pick 5 Agrobacterium monoclonal colonies.

[0039] The preferred technical solution is: Step 9, culture EHA105 Agrobacterium containing Crispr / Cas9-SlIMP3 plasmid in 3 mL of liquid culture medium containing Kana and Rif, 200 rpm, 28 ° C for 12-16 h, take 300 μL of bacterial solution in 20 mL of liquid culture medium containing Kana and Rif, 200 rpm, 28 ° C for 6-7 h, and detect the OD of the bacterial solution with a spectrophotometer 600To 0.5-0.6, centrifuge at 5000rpm for 10min at room temperature to collect the bacteria, and dilute the bacteria with sterile water to OD 600 =0.1-0.2, pre-culture tomato cotyledons and stem segments in the dark for 2 days, then immerse in the diluted Agrobacterium infection solution, shake, and infect for 5 minutes before pouring out the infection solution, and use a gun tip to suck off the excess infection solution to complete the infection and obtain transformed tomato plants.

[0040] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0041] The present invention obtains the complete coding sequence of the SlIMP3 gene from tomatoes, designs a target, connects the target to the vector CRIPSR / Cas9, transforms the plant using the Agrobacterium infection method, obtains gene-edited plants, and analyzes the gene-edited plants. The results show that the gene editing can accelerate the ripening of tomato fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 :Sequencing identification diagram of CRIPSR / Cas9-SlIMP3 plasmid, the yellow part is the target sequence, and the green part is the gRNA expression box sequence, indicating that the SlIMP3 gene editing vector was successfully constructed.

[0043] Figure 2 :Target site sequencing map of SlIMP3 gene-edited tomato plants, indicating that imp3 tomato mutants were obtained,

[0044] Figure 3 :Tomato fruit ripening time of WT and SlIMP3 gene-edited plants,

[0045] Figure 4 :Chlorophyll and carotenoid contents in tomato fruits of WT and SlIMP3 gene-edited plants,

[0046] Figure 5 :Expression levels of chlorophyll degradation-related genes in tomato fruits of WT and SlIMP3 gene-edited plants,

[0047] Figure 6 :The expression levels of carotenoid synthesis-related genes in tomato fruits of WT and SlIMP3 gene-edited plants, DETAILED DESCRIPTION

[0048] The following is a description of the implementation of the present invention by specific embodiments. People familiar with the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0049] See also Figure 1-6It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings of this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions for the implementation of the present invention, so they have no technical substantive significance. Any modification of the structure, change of the proportional relationship or adjustment of the size, the following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0050] Example 1: Genes that promote tomato fruit ripening and methods for regulating them

[0051] A gene that promotes tomato fruit ripening, the nucleotide sequence of the gene is shown in Seq No.1.

[0052] A gene regulation method for promoting tomato fruit ripening, characterized in that it comprises the following steps:

[0053] (1) Download the tomato SlIMP3 genome sequence from the phytozome (https: / / phytozome-next.jgi.doe.gov / ) database, and use the CRISPR direct (http: / / crispr.dbcls.jp / ) website to screen gRNA candidate targets. Prioritize two targets with high GC% content and close to the transcription start site or gene functional domain, and design two pairs of target adapter primers:

[0054] Target-Forward Primer-F 1 :5'-GTCAGAGGCCAAGTGATAGGACCG-3';

[0055] Target-Reverse Primer-R 1 :5'-AAACCGGTCCTATCACTTGGCCTC-3';

[0056] Target 2 forward primer-F 2 :5'-GTCAGCGGCCTTCGTCGGCATCAA-3';

[0057] Target 2 Reverse Primer-R 2 :5'-AAACTTGATGCCGACGAAGGCCGC-3'

[0058] (2) Place the target primer F 1 , R 1 、F 2 , R 2 Use sterile ddHO 2Dissolve in 5% HO to make a 10 μM stock solution, and add 10 μL of each to 80 μL of sterile ddHO. 2 O, mix and dilute to 1 μM. Place in a PCR instrument at about 90°C for 30 seconds, and move to room temperature to cool to complete target primer annealing.

[0059] (3) Prepare 10 μL of enzyme digestion and ligation reaction solution, and use the cutting and ligation method to connect the target linker to the gRNA expression cassette: 1 μL of 10× cutsmart buffer, 20 ng of pYLgRNA-AtU# plasmid, 0.5 μL of target linker, 0.4 μL of BsaI, 0.1 μL of T4 DNA ligase, 0.4 μL of T4 DNA ligase buffer, ddH 2 The volume was filled to 10 μL with 1% O. The PCR amplification parameters were: 37°C for 5 min, 20°C for 5 min, 5 cycles, and 4°C for ∞.

[0060] (4) Amplification of gRNA expression cassette (2 rounds of nested PCR):

[0061] First round of amplification (two PCR reactions for each gRNA expression cassette): four reactions in total, 1 μL of the above ligation product was used as template, 4 μL of primer pair UF / R n (Reaction 1) and F n / gRNA-R (reaction 2), 1μL dNTPs, 10μL 5×Super-FidelityDNA Polymerase buffer, 1μL Super-Fidelity DNA Polymerase, 33μL ddH 2 O. PCR system: 95℃1min; 95℃10s, 60℃15s, 72℃15s, 25 cycles; 72℃10min; 4℃∞. Take 5μl of the product and detect it by 2% agarose gel electrophoresis. The product of reaction 1 is about 450bp, and the product of reaction 2 is about 140bp.

[0062] Second round of PCR: Since there are two target sites, the position-specific primer pairs are PT1 and PT2L. Mix the position-specific primer pairs into a 10× working solution in advance, 1.5μM each: 1.5μL B1'+1.5μL B2+7μL ddH 2 O(PT1), 1.5μL B2'+1.5μL BL+7μL ddH 2 O(PT2L). Take 1 μL of the four products of the two targets in the first round of PCR respectively and wash with ddH 2O was diluted 10 times. Take 1 μL of each of the two reaction dilution products of target 1 / target 2 and mix them as the template for the second round of PCR, a total of 2 templates, 2 groups of reactions. 30 μL reaction system: 2 μL target 1 / target 2 template, 3 μL PT1 (target 1) / PT2L (target 2), 0.6 μL dNTPs, 6 μL 5×Super-Fidelity DNA Polymerase buffer, 0.6 μL Super-Fidelity DNA Polymerase, 17.8 μL ddH 2 O. PCR system: 95℃1min; 95℃10s, 60℃15s, 72℃15s, 15-20 cycles; 72℃10min; 4℃∞. After the reaction, take 2μl of the product from each of the two reactions and perform agarose gel electrophoresis to check whether the product length meets the expectation and estimate the product concentration.

[0063] (4) Mix the second-round PCR products of the two targets of the IMP3 gene editing vector at a concentration ratio of 1:1, and purify the mixed product using a DNA product purification kit. Take 2 μL of the purified product for agarose gel electrophoresis to check the product purification effect and estimate the concentration of the purified product. If the concentration is not less than 5 ng / μL, proceed to the next step of the experiment.

[0064] (5) Use the cutting and ligation method to connect the gRNA expression cassette purified in (4) to the Cas9 plasmid. 15 μL ligation system: 0.5 μL of the second round of purification product, 1 μL of Cas9 plasmid, 1.5 μL of 10×cutsmart buffer, 0.5 μL of BsaI endonuclease, 11.5 μL of ddH 2 O. PCR reaction system: 37℃, 10min. Add 0.4μL 10×T4DNA ligase buffer and 0.1μL T4 DNA ligase to the reaction system after enzyme digestion. Mix again and place in PCR instrument. The reaction conditions are 37℃2min, 10℃3min, 20℃5min, 13 cycles; 37℃2min; 4℃∞.

[0065] (6) The ligation product of (5) was transformed into E. coli DH5α by chemical heat shock method. Take 1 μL of the above ligation product and add it to 100 μL of E. coli DH5α competent cells, let it stand on ice for 30 minutes, heat shock at 42°C for 45 seconds, and ice bath for 2-3 minutes. Add 700 μL of antibiotic-free liquid culture medium to the centrifuge tube, place it in a shaker at 37°C and 200 rpm for 60 minutes. Centrifuge at 5000 rpm for 2 minutes, collect the bacterial solution, discard 600 μL of the supernatant, and mix the remaining 100 μL of bacterial solution by pipetting and blowing, and evenly spread it on a solid culture medium containing kanamycin (add 500uL 10mg / mL kanamycin to every 100mL LB solid culture medium), and invert and culture at 37°C for 16 hours. Pick a single clone colony, pipette and mix it in 10 μL of sterile water, and take 2 μL of bacterial solution for PCR identification. 25μL colony PCR system: 2μL bacterial solution, 1μL each of SP-DL / SP-R, 12.5μL 2× Rapid Taq Master Mix, ddH 2 O8.5μL. The PCR system is: pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15s, annealing at 55℃ for 1min, extension at 72℃ for 45s, 32 cycles; complete extension at 72℃ for 5min; 4℃∞. After the reaction is completed, the PCR product band size is detected on the agarose gel to see if it meets the theoretical value. The remaining bacterial liquid of the monoclonal with the correct band size is transferred to 4mL of liquid culture medium containing kanamycin and cultured in a shaker at 37℃ at 200rpm for 16h. The recombinant Crispr / Cas9-SlIMP3 plasmid was extracted using a plasmid mini-extraction kit. The plasmid extraction was verified by agarose gel electrophoresis, and the extracted plasmid was sent to the company for sequencing and identification.

[0066] (7) Transform the Crispr / Cas9-SlIMP3 plasmid into EHA105 Agrobacterium competent cells. The reaction is as follows: Take 100 μL of Agrobacterium competent cells EHA105, melt them in an ice bath, add 1 μL of the correctly sequenced Cas9 plasmid, gently shake the bottom of the centrifuge tube with your hand, mix well, and let it stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes; add 700 μL of antibiotic-free LB liquid culture medium, shake and culture at 28°C for 2-3 hours; centrifuge at 6000 rpm for 1 minute to collect the bacteria, retain about 100 μL of supernatant, blow and mix to resuspend the bacteria, spread on LB-Kana / Rif solid culture medium, and invert and place in a 28°C incubator for 2-3 days. Pick 5 Agrobacterium monoclonal colonies and identify whether the IMP3-Cas9 plasmid has been successfully transformed into Agrobacterium according to the colony PCR method in (6).

[0067] (8) Use EHA105 Agrobacterium containing Crispr / Cas9-SlIMP3 plasmid to infect tomato cotyledons. Add Crispr / Cas9-SlIMP3 plasmid to 3mL liquid culture medium containing Kana and Rif (add 500uL 10mg / mL kanamycin and 500uL 10mg / mL rifampicin per 100mL LB culture medium), culture at 200rpm and 28℃ for 12-16h. Take 300μL of bacterial solution and add it to 20mL liquid culture medium containing Kana and Rif, shake and culture at 200rpm and 28℃ for 6-7h, and detect the OD of the bacterial solution with a spectrophotometer. 600 to 0.5-0.6. Centrifuge at 5000rpm for 10min at room temperature to collect the cells, and dilute the cells with sterile water to OD 600 = 0.1-0.2. After pre-culturing the tomato cotyledons and stem segments in the dark for 2 days, immerse them in the diluted Agrobacterium infection solution, shake them, and after infecting for 5 minutes, pour out the infection solution and suck off the excess infection solution with a gun tip to complete the infection. Combined with plant tissue culture technology, transformed tomato plants were obtained.

[0068] (9) Then, the DNA of the transgenic tomato plant was extracted, and PCR amplification was performed by designing upstream and downstream primers of the target site, and sequencing analysis was performed to identify whether the slIMP3 gene was edited, thereby obtaining the transgenic tomato SlIMP3 gene-edited plant imp3. The identification primers are as follows:

[0069] importinα3-F:GGGTTGTGCAATGAACCAAA

[0070] importinα3-R:ACAGAAGCTGGAGCAGGATT

[0071] (10) Photographs were taken to record the fruit color changes of WT and SlIMP3 gene-edited plants imp3 at 30d, 35d, 36d, 37d, 38d, 39d, 40d, and 42d after flowering.

[0072] (11) The total chlorophyll, chlorophyll a, chlorophyll b and carotenoid contents of WT and imp3 tomato fruits at 30 and 39 days after flowering were determined. The specific method is as follows: 0.5 g of tomato pulp was taken in a mortar, and ground into powder by adding liquid nitrogen. 5 mL of anhydrous ethanol was added to grind it thoroughly, and the homogenate was collected in a 10 mL centrifuge tube. Centrifuge at 4000 rpm for 5 min at room temperature, and the supernatant was collected. 200 μL of the supernatant was aspirated into an ELISA plate, and the absorbance of the supernatant was measured at 470 nm, 649 nm and 665 nm on the ELISA instrument. The specific calculation method is as follows:

[0073] Content in sample (mg / g) = (C×V)×10 3 / W, V is the volume of the extract, W is the fresh weight of the sample;

[0074] Chlorophyll a: C a =13.95×A665-6.88×A649;

[0075] Chlorophyll b:C b =24.96×A649-7.32×A665;

[0076] Total chlorophyll: C = C a +C b ;

[0077] Total carotenoids: Cc = (A470 × 10 3 -2.06Ca-114.8Cb) / 245.

[0078] (12) RealTime qPCR primers were designed through the Products IDT website to determine the expression levels of chlorophyll degradation-related genes NYC1, PPH, SGR1 and carotenoid synthesis-related genes PSY, PDS, and ZDS in WT and imp3 tomato fruits at 30 and 39 days after flowering. RNA was extracted from tomato fruits 30 and 39 days after flowering using an RNA extraction kit, and then the RNA was reverse transcribed into cDNA using a reverse transcription kit. RealTime qPCR was used to detect changes in the expression levels of related genes in tomato fruits. The reaction system was 10 μL: 2× Green Pro Taq HS Premix 5μL, cDNA 0.8μL, 10μM F / R 0.2μL each, RNase free water to 10μL. Reaction procedure: 95℃30s; 95℃5s, 60℃30s, 40 cycles, 91℃10s. Tomato Tubulin gene was used as internal reference, according to 2 -△△Ct The relative expression level was calculated.

[0079] Primer UF: 5′-CTCCGTTTTACCTGTGGAATCG-3′;

[0080] Primer gRNA-R: 5′-CGGAGGAAAATTCCATCCAC-3′;

[0081] Primer B1′: 5′-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3′;

[0082] Primer B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3';

[0083] Primer B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3';

[0084] Primer BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'.

[0085] Seq No.1:

[0086]

[0087] Example 2: Genes that promote tomato fruit ripening and methods for regulating them

[0088] A gene that promotes tomato fruit ripening, the nucleotide sequence of the gene is shown in Seq No. 1, the same as in Example 1.

[0089] A method for promoting tomato fruit ripening, characterized in that it comprises the following steps:

[0090] Step 1: Add 10 μL of target-forward primer-F 1 , 10 μL target-reverse primer-R 1 , 80 μL ddHO 2 O and mix well; then add 10 μL of target two forward primer-F 2 、10μL Target II Reverse Primer-R 2 , 80 μL ddHO 2 O and mix well; place the above two tubes of primer mixture in a PCR instrument respectively, treat at 88-92℃ for 25-35s, and then move to room temperature to cool to complete the annealing of the target primers, and use them as target one adapter and target two adapter respectively;

[0091] Target-Forward Primer-F 1 :5'-GTCAGAGGCCAAGTGATAGGACCG-3';

[0092] Target-Reverse Primer-R 1 :5'-AAACCGGTCCTATCACTTGGCCTC-3';

[0093] Target 2 forward primer-F 2 :5'-GTCAGCGGCCTTCGTCGGCATCAA-3';

[0094] Target 2 Reverse Primer-R 2 :5'-AAACTTGATGCCGACGAAGGCCGC-3';

[0095] Step 2: Prepare 10 μL of enzyme digestion and ligation reaction solution, and use the cutting and ligation method to connect the target 1 linker and the target 2 linker to the gRNA expression cassette respectively, including:

[0096] 0.5μL target-adapter, 1μL gRNA plasmid U3d / U3b, 1μL 10×cutsmart buffer, 0.4μL BsaI, 0.1μL T4 DNA ligase, 0.4μL T4 DNA ligase buffer, ddH 2O was added to 10 μL; PCR amplification parameters were: 37°C 5 min, 20°C 5 min, 5 cycles, 4°C∞; target point one product was obtained;

[0097] 0.5μL target two-linker, 1μL gRNA plasmid U3d / U3b, 1μL 10×cutsmart buffer, 0.4μL BsaI, 0.1μL T4 DNA ligase, 0.4μL T4 DNA ligase buffer, ddH 2 O was added to 10 μL; PCR amplification parameters were: 37°C 5 min, 20°C 5 min, 5 cycles, 4°C∞; target site II product was obtained;

[0098] Step 3: First round of PCR amplification: PCR amplification is performed using the target 1 product and target 2 product obtained in step 2 as templates, including:

[0099] Target-1 reaction system: 1 μL target-1 product, 2 μL target-1 reverse primer-R 1 , 2μL primer UF, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O; PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the first product was obtained; Primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0100] Target 2 reaction 1 system: 1 μL target 2 product, 2 μL target 2 reverse primer-R 2 , 2μL primer UF, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O; PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the second product was obtained; Primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3';

[0101] Target-reaction 2 system: 1 μL target-product, 2 μL target-forward primer-F 1, 2μL primer gRNA-R, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O; PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the third product was obtained; Primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0102] Target 2 reaction 2 system: 1 μL target 2 product, 2 μL target 2 forward primer-F 2 , 2μL primer gRNA-R, 1μL dNTPs, 10μL 5×Super-Fidelity DNA Polymerase buffer, 1μL Super-Fidelity DNAPolymerase, 33μL ddH 2 O, PCR conditions: 95°C for 1 min; 95°C for 10 s, 60°C for 15 s, 72°C for 15 s, 25 cycles; 72°C for 10 min; 4°C∞, the fourth product was obtained; Primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3';

[0103] Step 4: Second round of amplification: Pre-mix the position-specific primer pairs into a 10× working solution, 1.5 μM each:

[0104] PT1: 1.5 μL primer B1' + 1.5 μL primer B2 + 7 μL ddH 2 O;

[0105] PT2L: 1.5 μL primer B2' + 1.5 μL primer BL + 7 μL ddH 2 O;

[0106] Take 1 μL of the first, second, third and fourth products of the first round of PCR amplification respectively and add ddH 2 O was diluted 10 times to obtain a first product dilution, a second product dilution, a third product dilution and a fourth product dilution; the first product dilution and the third product dilution were mixed to obtain a second round first template, and the second product dilution and the fourth product dilution were mixed to obtain a second round second template;

[0107] 2μL second round first template, 3μL PT1, 0.6μL dNTPs, 6μL 5× Super-Fidelity DNA Polymerase buffer, 0.6μL Super-Fidelity DNA Polymerase, 17.8μL ddH 2 O, PCR system: 95℃1min; 95℃10s, 60℃15s, 72℃15s, 15-20 cycles; 72℃10min; 4℃∞; get the second round PCR amplification product 1;

[0108] 2μL second round second template, 3μL PT2L, 0.6μL dNTPs, 6μL 5× Super-Fidelity DNA Polymerase buffer, 0.6μL Super-Fidelity DNA Polymerase, 17.8μL ddH 2 O, PCR system: 95℃1min; 95℃10s, 60℃15s, 72℃15s, 15-20 cycles; 72℃10min; 4℃∞; get the second round PCR amplification product 2;

[0109] Primer B1′: 5′-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3′;

[0110] Primer B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3';

[0111] Primer B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3';

[0112] Primer BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3';

[0113] Step 5: Mix the second-round PCR amplification product 1 and the second-round PCR amplification product 2 at a concentration ratio of 1:1, and purify the mixed product using a DNA product purification kit to obtain a purified gRNA expression cassette;

[0114] Step 6: Use the cutting and ligation method to connect the purified gRNA expression cassette obtained in step 5 to the Cas9 plasmid to obtain a ligation product;

[0115] Step 7: The ligation product obtained in step 6 was transformed into Escherichia coli DH5α by chemical heat shock method, and the recombinant Crispr / Cas9-SlIMP3 plasmid was extracted;

[0116] Step 8: Transform the recombinant CRISPR / Cas9-SlIMP3 plasmid into EHA105 Agrobacterium competent cells to obtain EHA105 Agrobacterium containing the Crispr / Cas9-SlIMP3 plasmid;

[0117] Step 9: Use EHA105 Agrobacterium containing Crispr / Cas9-SlIMP3 plasmid to infect tomato cotyledons to obtain transformed tomato plants.

[0118] The preferred technical solution is: in step 6, 15 μL ligation system: 0.5 μL purified gRNA expression cassette, 1 μL Cas9 plasmid, 1.5 μL 10×cutsmart buffer, 0.5 μL BsaI endonuclease, 11.5 μL ddH 2 O, PCR reaction system: 37℃, 10min; add 0.4μL 10×T4 DNA ligase buffer and 0.1μL T4DNA ligase to the reaction system after enzyme digestion, mix again and place in PCR instrument, reaction conditions are 37℃2min, 10℃3min, 20℃5min, 13 cycles; 37℃2min; 4℃∞; get the ligation product.

[0119] The preferred technical solution is: in step 7, take 1 μL of the above-mentioned ligation product and add it to 100 μL of Escherichia coli DH5α competent cells, let it stand on ice for 30 minutes, heat shock at 42°C for 45 seconds, and ice bath for 2-3 minutes. Add 700 μL of liquid culture medium without antibiotics to a centrifuge tube, place it at 37°C, 200rpm shaker for 60 minutes, centrifuge at 5000rpm for 2 minutes, collect the bacterial solution, discard 600 μL of the supernatant, and mix the remaining 100 μL of bacterial solution by suction and blowing, evenly spread it on a solid culture medium containing kanamycin, invert and culture at 37°C for 16 hours, pick a monoclonal colony, mix it by suction and blowing in 10 μL of sterile water, take 2 μL of bacterial solution for PCR identification, and the 25 μL colony PCR system is as follows: 2 μL bacterial solution, 1 μL each of SP-DL / SP-R, 12.5 μL of 2×Rapid Taq Master Mix, and ddH 2O 8.5μL, PCR system: pre-denaturation at 95℃ for 3min; denaturation at 95℃ for 15s, annealing at 55℃ for 1min, extension at 72℃ for 45s, 32 cycles; thorough extension at 72℃ for 5min; 4℃∞, after the reaction is completed, check whether the PCR product band size conforms to the theoretical value on agarose gel, transfer the remaining bacterial liquid of the monoclonal with the correct band size to 4mL of liquid culture medium containing kanamycin, and culture in a shaker at 37℃ at 200rpm for 16h. Use a plasmid mini-extraction kit to extract the recombinant Crispr / Cas9-SlIMP3 plasmid, and verify whether the plasmid extraction is successful by agarose gel electrophoresis, and send the extracted plasmid to the company for sequencing and identification.

[0120] The preferred technical solution is: the reaction of step 8 is specifically as follows: take 100 μL of Agrobacterium competent cells EHA105, melt them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently shake the bottom of the centrifuge tube with your hand, mix well, let stand on ice for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes; add 700 μL of antibiotic-free LB liquid culture medium, shake and culture at 28°C for 2-3 hours; centrifuge at 6000rpm for 1 minute to collect the bacteria, retain 90-110 μL of supernatant, blow and mix to resuspend the bacteria, spread on LB-Kana / Rif solid culture medium, invert and culture in a 28°C incubator for 2-3 days, and pick 5 Agrobacterium monoclonal colonies.

[0121] The preferred technical solution is: Step 9, culture EHA105 Agrobacterium containing Crispr / Cas9-SlIMP3 plasmid in 3 mL of liquid culture medium containing Kana and Rif, 200 rpm, 28 ° C for 12-16 h, take 300 μL of bacterial solution in 20 mL of liquid culture medium containing Kana and Rif, 200 rpm, 28 ° C for 6-7 h, and detect the OD of the bacterial solution with a spectrophotometer 600 To 0.5-0.6, centrifuge at 5000rpm for 10min at room temperature to collect the bacteria, and dilute the bacteria with sterile water to OD 600 =0.1-0.2, pre-culture tomato cotyledons and stem segments in the dark for 2 days, then immerse in the diluted Agrobacterium infection solution, shake, and infect for 5 minutes before pouring out the infection solution, and use a gun tip to suck off the excess infection solution to complete the infection and obtain transformed tomato plants.

[0122] The above description is only used to explain the preferred embodiments of the present invention, and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.

Claims

1. A method for promoting tomato fruit ripening, characterized in that: The following steps are involved: Step 1: Mix 10 μL target one forward primer-F1, 10 μL target one reverse primer-R1, and 80 μL ddH2O; then mix 10 μL target two forward primer-F2, 10 μL target two reverse primer-R2, and 80 μL ddH2O; place the above two tubes of primer mixture in a PCR instrument, treat at 88-92℃ for 25-35s, and then move to room temperature to cool to complete the target primer annealing, and use them as target one adapter and target two adapter respectively; Target one forward primer-F1: 5′-GTCAGAGGCCAAGTGATAGGACCG-3′; Target one reverse primer-R1: 5′-AAACCGGTCCTATCACTTGGCCTC-3′; Target two forward primer-F2: 5′-GTCAGCGGCCTTCGTCGGCATCAA-3′; Target two reverse primer-R2: 5′-AAACTTGATGCCGACGAAGGCCGC-3′; Step 2: Prepare 10 μL of enzyme digestion and ligation reaction solution, and use the cutting and ligation method to connect the target 1 adapter and the target 2 adapter to the gRNA expression cassette respectively, including: 0.5 μL target site one adapter, 1 μL gRNA plasmid U3d / U3b, 1 μL 10×cutsmart buffer, 0.4 μL BsaI, 0.1 μL T4 DNA ligase, 0.4 μL T4 DNA ligase buffer, ddH2O to 10 μL; PCR amplification parameters: 37℃ 5min, 20℃ 5min, 5 cycles, 4℃ ∞; get target site one product; 0.5 μL target site II adapter, 1 μL gRNA plasmid U3d / U3b, 1 μL 10×cutsmart buffer, 0.4 μL BsaI, 0.1 μL T4 DNA ligase, 0.4 μL T4 DNA ligase buffer, ddH2O to 10 μL; PCR amplification parameters: 37℃ 5min, 20℃ 5min, 5 cycles, 4℃ ∞; target site II product was obtained; Step 3: First round of PCR amplification: PCR amplification is performed using the target 1 product and target 2 product obtained in step 2 as templates, including: Target one reaction 1 system: 1 μL target one product, 2 μL target one reverse primer-R1, 2 μL primer UF, 1 μL dNTPs, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL Super-Fidelity DNA Polymerase, 33 μL ddH2O; PCR conditions: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 25 cycles; 72℃ 10 min; 4℃ ∞, get the first product; primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; Target 2 reaction 1 system: 1 μL target 2 product, 2 μL target 2 reverse primer-R2, 2 μL primer UF, 1 μL dNTPs, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL Super-Fidelity DNA Polymerase, 33 μL ddH2O; PCR conditions: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 25 cycles; 72℃ 10 min; 4℃ ∞, get the second product; primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3'; Target-reaction 2 system: 1 μL target-product, 2 μL target-forward primer-F1, 2 μL primer gRNA-R, 1 μL dNTPs, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL Super-Fidelity DNA Polymerase, 33 μL ddH2O; PCR conditions: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 25 cycles; 72℃ 10 min; 4℃ ∞, get the third product; primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'; Target 2 reaction 2 system: 1 μL target 2 product, 2 μL target 2 forward primer-F2, 2 μL primer gRNA-R, 1 μL dNTPs, 10 μL 5×Super-Fidelity DNA Polymerase buffer, 1 μL Super-Fidelity DNA Polymerase, 33 μL ddH2O, PCR conditions: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 25 cycles; 72℃ 10 min; 4℃ ∞, get the fourth product; primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3'; Step 4: Second round of amplification: Pre-mix the position-specific primer pairs into a 10 × working solution, 1.5 μM each: PT1: 1.5 μL primer B1' + 1.5 μL primer B2 + 7 μL ddH2O; PT2L: 1.5 μL primer B2' + 1.5 μL primer BL + 7 μL ddH2O; Take 1 μL of the first product, second product, third product and fourth product of the first round of PCR amplification respectively, dilute 10 times with ddH2O to obtain the first product dilution solution, the second product dilution solution, the third product dilution solution and the fourth product dilution solution; mix the first product dilution solution and the third product dilution solution to obtain the second round first template, and mix the second product dilution solution and the fourth product dilution solution to obtain the second round second template; 2 μL of the first template of the second round, 3 μL of PT1, 0.6 μL of dNTPs, 6 μL of 5×Super-Fidelity DNAPolymerase buffer, 0.6 μL of Super-Fidelity DNA Polymerase, 17.8 μL of ddH2O, PCR system: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 15-20 cycles; 72℃ 10 min; 4℃ ∞; obtain the second round PCR amplification product 1; 2 μL second round second template, 3 μL PT2L, 0.6 μL dNTPs, 6 μL 5×Super-Fidelity DNA Polymerase buffer, 0.6 μL Super-Fidelity DNA Polymerase, 17.8 μL ddH2O, PCR system: 95℃ 1 min; 95℃ 10 s, 60℃ 15 s, 72℃ 15 s, 15-20 cycles; 72℃ 10 min; 4℃ ∞; obtain the second round PCR amplification product II; Primer B1′: 5′-TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG-3′; Primer B2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'; Primer B2': 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'; Primer BL: 5'-AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC-3'; Step 5: Mix the second-round PCR amplification product 1 and the second-round PCR amplification product 2 at a concentration ratio of 1:1, and purify the mixed product using a DNA product purification kit to obtain a purified gRNA expression cassette; Step 6: Use the cutting and ligation method to connect the purified gRNA expression cassette obtained in step 5 to the Cas9 plasmid to obtain a ligation product; Step 7: The ligation product obtained in step 6 was transformed into Escherichia coli DH5α by chemical heat shock method to extract the recombinant Crispr / Cas9- SlIMP3 Plasmids; Step 8: Recombinant CRISPR / Cas9- SlIMP3 The plasmid was transformed into EHA105 Agrobacterium competent cells to obtain Crispr / Cas9- SlIMP3 EHA105 Agrobacterium containing plasmids; Step 9: Using Crispr / Cas9- SlIMP3 The EHA105 Agrobacterium carrying the plasmid was used to infect tomato cotyledons to obtain transformed tomato plants.

2. The method for promoting tomato fruit ripening according to claim 1, characterized in that: In step 6, 15 μL ligation system: 0.5 μL purified gRNA expression cassette, 1 μL Cas9 plasmid, 1.5 μL 10× cutsmart buffer, 0.5 μL BsaI endonuclease, 11.5 μL ddH2O, PCR reaction system: 37°C, 10 min; add 0.4 μL 10× T4 DNA ligase buffer and 0.1 μL T4 DNA ligase to the reaction system after enzyme digestion, mix again and place in a PCR instrument, the reaction conditions are 37°C 2 min, 10°C 3 min, 20°C 5 min, 13 cycles; 37°C 2 min; 4°C ∞; get the ligation product.

3. The method for promoting tomato fruit ripening according to claim 1, characterized in that: In step 7, 1 μL of the above ligation product was added to 100 μL of E. coli DH5α competent cells, placed on ice for 30 min, heat-shocked at 42°C for 45 s, and placed on ice for 2-3 min. 700 μL of liquid culture medium without antibiotics was added to the centrifuge tube, and the tube was shaken and cultured at 37°C and 200 rpm for 60 min. The tube was centrifuged at 5000 rpm for 2 min, the bacterial solution was collected, 600 μL of the supernatant was discarded, and the remaining 100 μL of bacterial solution was mixed by pipetting and blowing, and evenly spread on the solid culture medium containing kanamycin, and inverted cultured at 37°C for 16 h. A single clone colony was picked and mixed by pipetting in 10 μL of sterile water. 2 μL of bacterial solution was taken for PCR identification. The PCR system for 25 μL colonies was as follows: 2 μL bacterial solution, 1 μL each of SP-DL / SP-R, 12.5 μL of 2× Rapid Taq Master Mix, and 8.5 μL of ddH2O. The PCR system was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 1 min, extension at 72℃ for 45 s, 32 cycles; complete extension at 72℃ for 5 min; 4℃∞, after the reaction is completed, check whether the PCR product band size conforms to the theoretical value on agarose gel, transfer the remaining bacterial liquid of the monoclonal with the correct band size to 4 mL of liquid culture medium containing kanamycin, and culture in a shaking incubator at 37℃ and 200 rpm for 16 h. Use a plasmid extraction kit to extract the recombinant Crispr / Cas9- SlIMP3 The plasmid was verified by agarose gel electrophoresis to verify whether the plasmid extraction was successful, and the extracted plasmid was sent to the company for sequencing and identification.

4. The method for promoting tomato fruit ripening according to claim 1, characterized in that: The reaction of step 8 is as follows: take 100 μL of Agrobacterium competent cells EHA105, melt them in an ice bath, add 1 μL of correctly sequenced Cas9 plasmid, gently stir the bottom of the centrifuge tube by hand, mix well, let it stand on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min; add 700 μL of antibiotic-free LB liquid culture medium, shake and culture at 28°C for 2-3 h; centrifuge at 6000 rpm for 1 min to collect the bacteria, retain 90-110 μL of supernatant, mix and resuspend the bacteria by pipetting, spread on LB-Kana / Rif solid culture medium, invert and culture in a 28°C incubator for 2-3 days, and pick 5 Agrobacterium monoclonal colonies.

5. The method for promoting tomato fruit ripening according to claim 1, characterized in that: Step 9: Place the Crispr / Cas9- SlIMP3 EHA105 Agrobacterium containing plasmid was cultured in 3 mL of liquid medium containing Kana and Rif, cultured at 200 rpm and 28°C for 12-16 h, 300 µL of bacterial solution was added to 20 mL of liquid medium containing Kana and Rif, cultured at 200 rpm and 28°C for 6-7 h, and the OD of bacterial solution was detected by spectrophotometer. 600 The cells were centrifuged at 5000 rpm for 10 min at room temperature to collect the cells, and the cells were diluted with sterile water to OD 600 =0.1-0.2, pre-culture tomato cotyledons and stem segments in the dark for 2 days, then immerse them in the diluted Agrobacterium infection solution, shake them, and pour out the infection solution after 5 minutes of infection. Use a gun tip to suck off the excess infection solution to complete the infection and obtain transformed tomato plants.

Images