Sorghum salt-tolerant gene and application

By cloning the sorghum salt-tolerant SbDFRs01 gene and constructing an expression vector, the problem of slowed plant growth and development caused by soil salinization was solved, and the effect of improving plant salt tolerance was achieved.

CN116004651BActive Publication Date: 2026-02-10HEBEI AGRICULTURAL UNIV.
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211091862.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-07
Publication Date
2026-02-10
Estimated Expiration
2042-09-07

AI Technical Summary

Technical Problem

Soil salinization slows down plant growth and development, making it difficult to improve salt-tolerant plant varieties.

Method used

The salt-tolerant sorghum gene SbDFRs01 was cloned, an expression vector was constructed, and the gene was introduced into plants via Agrobacterium-mediated transformation to improve the salt tolerance of the plants.

Benefits of technology

It significantly improved the salt tolerance of plants, especially the transgenic Arabidopsis thaliana showed better resistance to salt stress than the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116004651B_ABST
    Figure CN116004651B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of plant genetic engineering, and discloses a salt-tolerant sorghum gene and application. The nucleotide sequence of the salt-tolerant sorghum SbDFRs01 gene is shown in SEQ ID NO:1, and the amino acid sequence encoded by the nucleotide sequence is shown in SEQ ID NO:2. Gene expression level analysis results show that the SbDFRs01 gene has a high expression level in the root system of sorghum, and the expression level in the root system after salt and alkali stress is further significantly increased. When the SbDFRs01 gene is overexpressed in Arabidopsis, a cell hypersensitive reaction can be triggered, and the expression level of an anti-stress related gene is obviously increased. Therefore, the salt-tolerant sorghum SbDFRs01 gene improves the salt tolerance of plants, and provides a theoretical basis for cultivating salt-tolerant plant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a salt-tolerant gene for sorghum and its application. Background Technology

[0002] Soil salinization is one of the ecological crises facing humanity. It not only causes resource depletion and enormous losses in agricultural production, but also poses a threat to the biosphere and the ecological environment. Specifically in agricultural production, soil salinization affects plants through soil salt osmosis, a condition known as salt stress. Based on plant growth patterns, plant responses to salt stress can be categorized into osmotic stress and ion stress. Osmotic stress makes it difficult for plants to absorb water, causing water to seep out of the plant and leading to cellular dehydration, which affects plant growth and reduces leaf area, plant height, and dry matter content. Ion stress disrupts the ion balance within plant cells through the interaction of various ions, ultimately slowing down plant growth and development.

[0003] Salt-alkali stress induces or inhibits the expression of many genes, and research on gene expression regulation has become a hot topic in recent years. Sorghum, one of the world's five major crops, has strong salt-alkali tolerance; even in low-fertility soil conditions such as desertification, saline-alkali soil, and weed infestation, sweet sorghum can grow normally. The publication of the complete sorghum genome sequence and the development of sequencing technology have provided a good reference for studying the interaction mechanism between environmental stress and sorghum gene responses. Therefore, screening for genes with excellent salt tolerance in sorghum is of significant theoretical importance for the breeding of high-quality salt-tolerant plant varieties. Summary of the Invention

[0004] This invention proposes a salt-tolerant gene for sorghum and its application, which solves the problems in related technologies such as soil salinization leading to slowed plant growth and development and difficulties in modifying salt-tolerant plant varieties.

[0005] This invention proposes a sorghum salt-tolerant SbDFRs01 gene, the nucleotide sequence of which is as follows 1) or 2):

[0006] 1) The nucleotide sequence as shown in SEQ ID NO: 1;

[0007] 2) A nucleotide sequence with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 1.

[0008] As a further technical solution, the amino acid sequence of the sorghum salt-tolerant SbDFRs01 gene is as follows: 1) or 2):

[0009] 1) The amino acid sequence as shown in SEQ ID NO: 2,

[0010] 2) An amino acid sequence with the same function obtained by replacing, deleting or inserting one or more amino acids as shown in SEQ ID NO: 2.

[0011] The present invention also proposes a plant expression vector containing the sorghum salt-tolerant SbDFRs01 gene.

[0012] The present invention also proposes a host cell containing the sorghum salt-tolerant SbDFRs01 gene.

[0013] This invention also proposes the application of the sorghum salt-tolerant SbDFRs01 gene, specifically its application in improving plant salt tolerance.

[0014] As a further technical solution, the application involves overexpressing the sorghum salt-tolerant SbDFRs01 gene in plants to improve their salt tolerance.

[0015] As a further technical solution, the following steps are included:

[0016] Cloning the salt-tolerant SbDFRs01 gene in sorghum;

[0017] Construct an expression vector containing the nucleotide sequence of the sorghum salt-tolerant SbDFRs01 gene;

[0018] The constructed expression vector was transferred into plants for expression, resulting in positive plants.

[0019] As a further technical solution, the plant is sorghum.

[0020] As a further technical solution, the primer sequences used in cloning the sorghum salt-tolerant SbDFRs01 gene are as follows:

[0021] Upstream primer: 5'AAGCTTGATATCGAATTCATGGGAGAGGTGGTGGCAAC 3'

[0022] Downstream primer: 5'ACTAGTGGATCCCCCGGGCTAAGGCAGAGCCCTCCCC 3'.

[0023] As a further technical solution, the constructed expression vector is transferred into the plant for expression, specifically by transferring the constructed expression vector into the plant through the Agrobacterium-mediated method.

[0024] The working principle and beneficial effects of this invention are as follows:

[0025] 1. This invention is the first to clone the SbDFRs01 gene: Data was assembled based on high-throughput deep transcriptome sequencing of sorghum with different salt tolerances; genes related to salt tolerance were screened, and then PCR-specific primers were designed using PrimerPremier 5 software. Total RNA was extracted from sorghum leaves, and reverse transcription PCR was performed to clone the sorghum salt-tolerant SbDFRs01 gene and obtain its encoded protein sequence. The sorghum salt-tolerant SbDFRs01 gene was introduced into other plants in the form of transgenes, which improved the salt tolerance of the plants and provided a theoretical basis for breeding salt-tolerant plant varieties.

[0026] 2. In this invention, through quantitative analysis of gene expression, the results showed that the expression level of SbDFRs01 was significantly increased after salt-alkali stress in sorghum plants. When the salt-tolerant SbDFRs01 of sorghum was transferred into Arabidopsis thaliana, the transgenic Arabidopsis thaliana under salt stress showed better resistance than the wild type, indicating that the SbDFRs01 gene can improve the salt tolerance of plants. Attached Figure Description

[0027] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0028] Figure 1 Example 2 of this invention: Salt tolerance test of the sorghum salt tolerance SbDFRs01 gene;

[0029] Figure 2 Here is an electrophoresis diagram of DNA from a positive T3 transgenic Arabidopsis thaliana plant in Example 3 of this invention:

[0030] Figure 3 This is the result of salt tolerance testing of transgenic Arabidopsis thaliana in Example 3 of the present invention;

[0031] In the picture, the first one from the left is a transgenic Arabidopsis seedling, the second one from the left is an Arabidopsis seedling with the 35s vector, and the first one from the right is a wild-type Arabidopsis seedling;

[0032] Figure 4 This is the result of timed quantitative PCR (qRT-PCR) of salt tolerance in transgenic Arabidopsis thaliana in Example 3 of the present invention. Detailed Implementation

[0033] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0034] In the following examples, unless otherwise specified, the specific experimental conditions are all conventional conditions well-known to those skilled in the art, such as the conditions described in Molecular Cloning: A Laboratory Manual by Sambrook J. and Russell, D.W. (New York: Cold Spring Harbor Laboratory Press, 2001), or the conditions recommended by the manufacturer.

[0035] In the following examples, the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial sources.

[0036] Example 1 Obtaining the Salt-Tolerant SbDFRs01 Gene from Sorghum

[0037] 1. Reagents

[0038] Plant RNA extraction reagent (Trizol), purchased from Invitrogen;

[0039] DNase I, purchased from TaKaRa;

[0040] RNA Library Prep Kit, purchased from Beijing Biomarker Technologies Co., Ltd.

[0041] 2. Plant Materials

[0042] Seeds of the salt-tolerant sorghum variety Gaoliangzhe (sorghum cane) were provided by Hebei Agricultural University.

[0043] 3. Experimental Methods

[0044] 3.1 RNA Extraction [[ID=3,2]]

[0045] The RNA of sorghum cane seeds was extracted using the Trizol method to obtain an RNA sample.

[0046] 3.2 Transcriptome Sequencing Assembly and Annotation

[0047] The obtained RNA sample was subjected to high-throughput transcriptome sequencing. The specific method is as follows:

[0048] 1) Enrich mRNA using Oligo dT magnetic beads and fragment the mRNA;

[0049] 2) Synthesize double-stranded cDNA by reverse transcription and purify the cDNA using beads;

[0050] 3) Repair the ends of the purified double-stranded cDNA and ligate sequencing adapters, and amplify the cDNA sequencing library by PCR;

[0051] 4) The cDNA library was sequenced using the Illumina HiSeq high-throughput sequencing platform, with a read length of PE125.

[0052] 5) Data analysis: Read the raw data, compare it with NR, Swiss-Prot, GO, COG, KOG, and KEGG databases, and add annotations.

[0053] 4. Experimental Results

[0054] The nucleotide sequence of the PCR amplification product is shown in SEQ ID NO: 1.

[0055] The gene shown in SEQ ID NO: 1 is named the SbDFRs01 gene, and the protein it encodes is named the SbDFRs01 protein, with the amino acid sequence shown in SEQ ID NO: 2.

[0056] Example 2: Salt tolerance test of the SbDFRs01 gene in sorghum.

[0057] 1. Reagents and Instruments

[0058] Plant RNA extraction reagent (Trizol), purchased from Invitrogen;

[0059] RT-qPCR Kit, purchased from Kangwei Century;

[0060] The RT-qPCR instrument used was a BIO-BAD7706.

[0061] 2. Materials

[0062] Plant material cultivation: Seeds of salt-tolerant sorghum variety Gaoliangzhe (sorghum sugarcane), provided by Hebei Agricultural University.

[0063] Material cultivation: Sorghum and sugarcane seeds were disinfected with 70% ethanol for 1 min, rinsed with distilled water, soaked and germinated for 24 hours at a germination temperature of 25℃±1℃. Seeds with uniform germination were sown in disinfected quartz sand and raised as seedlings in a light room using conventional methods. When the seedlings reached the stage of two leaves and one bud, they were treated with salt by watering them with 0.8% NaCl solution. The salt solution was replaced every 24 hours. Samples were taken at 0h, 24h, 48h, and 72h. The whole plant was sampled and frozen in liquid nitrogen and stored at -80℃. Each treatment was repeated three times.

[0064] 3. Experimental Methods

[0065] 3.1 RNA Extraction

[0066] RNA was extracted from sorghum and sugarcane seeds using the Trizol method to obtain RNA samples.

[0067] 3.2 RT-qPCR

[0068] Using RNA samples as templates, the following primers were designed:

[0069] Upstream primer F: GGGAACGAGGCACACTACTC;

[0070] Downstream primer R: GGGTGCTCGAAGAGGAAGAG;

[0071] RT-qPCR reactions were performed in a one-step manner using the RT-qPCR Kit.

[0072] 4. Experimental Results

[0073] The results are as follows Figure 1 As shown in the figure, under salt stress, the expression level of the salt-tolerant SbDFRs01 gene in sorghum increased.

[0074] Example 3: Application of the sorghum salt-tolerant SbDFRs01 gene in improving the salt tolerance of Arabidopsis thaliana.

[0075] I. Cloning and sequencing of the salt-tolerant SbDFRs01 gene in sorghum

[0076] Total RNA was extracted from sorghum and sugarcane plants using Trizol plant RNA extraction reagent to obtain RNA samples.

[0077] Using RNA samples as templates, first-strand cDNA was reverse transcribed from the reverse transcription premix solution HiFiScript RT.

[0078] Based on the data of the sorghum SbDFRs01 gene obtained in Example 1, the following PCR-specific primers were designed using PrimerPremier 5.0 software:

[0079] Upstream primer Sobic3F: 5'AAGCTTGATATCGAATTCATGGGAGAGGTGGTGGCAAC 3';

[0080] Downstream primer Sobic3R: 5'ACTAGTGGATCCCCCGGGCTAAGGCAGAGCCCTCCCC 3';

[0081] Using cDNA as a template, the above primers were used to amplify the template by PCR to obtain the PCR product of the SbDFRs01 gene.

[0082] The PCR product of the SbDFRs01 gene was purified and ligated into the pGreen0029 vector, which was then transformed into Escherichia coli DH5α competent cells to obtain the recombinant vector, which was then identified by colony PCR.

[0083] The recombinant vector identified by colony PCR was named pGreen-Sobic3 and sequenced.

[0084] Sequencing results revealed the full-length sequence of the Sobic3 gene linked to the pGreen cloning vector. The sequence of the SbDFRs01 gene is shown in SEQ ID NO.1.

[0085] II. Construction of Gene Expression Vectors for Plants

[0086] Plasmid was extracted from the correctly sequenced E. coli bacterial culture to obtain the extracted pGreen0029 plasmid.

[0087] The pGreen0029 plasmid was extracted and added to competent Agrobacterium strain GV3101, and colony PCR was performed to identify the positive Agrobacterium strains of the recombinant plasmid.

[0088] III. Obtaining Transgenic Arabidopsis

[0089] Using the Agrobacterium-mediated method, a suspension of Agrobacterium positive for recombinant plasmids was sprayed onto Arabidopsis thaliana. After normal culture for 1 week, it was sprayed again to harvest T1 seeds.

[0090] T1 seeds were purified at 4℃ for one week, planted in seed trays, and sprayed with basta herbicide 7 days later. The surviving seedlings were positive seedlings, namely T2 plants, and T2 seeds were harvested.

[0091] After disinfection, T2 seeds were sown in 1 / 2 MS solid medium with basta herbicide added. After 14 days of growth, seedlings with long roots and green leaves were transplanted into nutrient soil. DNA was extracted, and after PCR identification, transgenic positive T3 plants were obtained. After subsequent purification, homozygous Arabidopsis seeds were obtained.

[0092] DNA electrophoresis image of positive T3 plants is shown below Figure 2 As shown.

[0093] IV. Salt Tolerance Experiment of Transgenic Arabidopsis

[0094] Harvested homozygous Arabidopsis seeds were purified at 4℃ for one week and planted in seed trays. Seven days later, they were sprayed with Basta herbicide. At 21 days of age, they were subjected to salt stress treatment. Arabidopsis seedlings transferred with the 35s vector and wild-type Arabidopsis seedlings served as a control group and were also subjected to salt stress treatment. All treatments involved drenching with a 0.9% sodium chloride solution every 24 hours. Leaves were harvested at 0h, 24h, 48h, and 72h of treatment, flash-frozen in liquid nitrogen, and stored at -80℃. A photograph taken after 72h of treatment is shown below. Figure 3 As shown in the figure, the salt tolerance of transgenic Arabidopsis seedlings is significantly improved, and the plants grow well after salt stress treatment.

[0095] Analysis of real-time quantitative PCR (qRT-PCR) results Figure 4 The results showed that under no salt stress (CK) treatment, the gene expression level of transgenic plants (OE) was not significantly different from that of wild-type plants (WT). Under salt stress (T) treatment, the gene expression level of wild-type plants was not significantly different from that of CK; the gene expression level of transgenic plants showed a significant upward trend compared with CK, and the expression level did not differ significantly between short-term salt stress (24H) and long-term salt stress (72H). This indicates that the gene in transgenic plants can be induced to express relatively quickly by salt stress, thereby enhancing the salt tolerance of transgenic Arabidopsis thaliana.

[0096] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An application of the sorghum salt-tolerant SbDFRs01 gene in improving plant salt tolerance, characterized in that, The nucleotide sequence of the sorghum salt-tolerant SbDFRs01 gene is as shown in SEQ ID NO: 1; The application of the sorghum salt-tolerant SbDFRs01 gene involves overexpressing the sorghum salt-tolerant SbDFRs01 gene in plants to improve their salt tolerance. The application includes the following steps: Cloning the salt-tolerant SbDFRs01 gene in sorghum; Construct an expression vector containing the nucleotide sequence of the sorghum salt-tolerant SbDFRs01 gene; The constructed expression vector was transferred into plants for expression, resulting in positive plants; The plant in question is Arabidopsis thaliana.

2. The application according to claim 1, characterized in that, The amino acid sequence of the sorghum salt-tolerant SbDFRs01 gene is as shown in SEQ ID NO:

2.

3. The application according to claim 1, characterized in that, The primer sequences used in cloning the salt-tolerant SbDFRs01 gene in sorghum are as follows: Upstream primer: 5' AAGCTTGATATCGAATTCATGGGAGAGGTGGTGGCAAC 3' Downstream primer: 5' ACTAGTGGATCCCCCGGGCTAAGGCAGAGCCCTCCCC 3'.

4. The application according to claim 1, characterized in that, The specific method for transferring the constructed expression vector into plants for expression is as follows: the constructed expression vector is transferred into plants for expression using the Agrobacterium-mediated method.