A kit for assisting in diagnosing systemic lupus erythematosus based on CYP51A1 gene expression detection

Abstract

The application discloses a kit for diagnosing systemic lupus erythematosus, which is lanosterol lipid metabolite key enzyme CYP51A1, the expression amount of the transcription level of the lanosterol lipid metabolite key enzyme CYP51A1, and the cDNA sequence of the lanosterol lipid metabolite key enzyme CYP51A1 is shown as SEQ ID No. 1. The kit for diagnosing SLE provided by the application comprises CYP51A1 gene primers and primers of a housekeeping gene GAPDH, a standard product and amplification reagents. The application overcomes the defect that SLE gene diagnosis cannot be diagnosed. The application adopts a real-time fluorescent quantitative PCR method, has the characteristics of rapidness, sensitivity, accuracy and the like, the expression of CYP51A1 is detected through real-time fluorescent quantitative PCR, important basis and reference value can be provided for clinical diagnosis of diseases, thus being beneficial to the formulation of a treatment scheme of the disease, and having popularization and application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a key enzyme of lipid metabolite for diagnosing autoimmune diseases, and more particularly relates to a lanosterol lipid metabolite key enzyme CYP51A for diagnosing systemic lupus erythematosus. BACKGROUND

[0002] Systemic lupus erythematosus (SLE) is a common chronic autoimmune disease, accompanied by loss of immune tolerance and production of a large number of autoantibodies, and often involves multiple systems of the body, including the kidney, skin, joints, nervous system and serosa, etc. Among them, 20%-40% of lupus patients are refractory, with high mortality and disability, and poor clinical prognosis. If early classification diagnosis and disease condition assessment can be performed before important organ involvement occurs in SLE patients, it will have great significance for the treatment of SLE, improvement of the quality of life of patients, and improvement of the survival rate of patients.

[0003] At present, the diagnosis of SLE still depends on clinical manifestations and autoimmune serology. However, due to the low specificity and sensitivity of autoimmune serology results, there is no ideal index in the existing serum. In addition, single nucleotide polymorphisms are also detected at the DNA level to evaluate the risk of SLE in subjects. Since the genome is relatively stable, the detection result cannot reflect the current disease condition of the subject.

[0004] Lanosterol is the first sterol intermediate in the cholesterol biosynthesis pathway and is also a necessary precursor for synthesizing cholesterol. Studies have shown that in lymphocytes, several precursors of cholesterol biosynthesis are essential for their development and differentiation. However, the analysis of sterols such as lanosterol usually uses gas chromatography-mass spectrometry (GC-MS), which requires a gas chromatograph (GC) and a mass spectrometer (MS) detector. The detection price is expensive, and it involves knowledge in multiple chemical fields, so it is less likely to be implemented in our field.

[0005] CYP51A1 is a member of the cytochrome P450 family, encoding lanosterol-14α-demethylase, which catalyzes the demethylation of lanosterol-14α-methyl, the first step in cholesterol synthesis. Furthermore, multiple studies have shown that CYP51A1 is a key enzyme in lanosterol lipid metabolites. For example, Araldi E et al. found that TLR4-mediated downregulation of CYP51A1 transcription can induce lanosterol accumulation in macrophages. Inhibiting CYP51 can block the conversion of lanosterol to cholesterol, leading to lanosterol accumulation and thus lowering blood lipids. These findings indicate that changes in lanosterol in vivo are closely related to CYP51A1. Given the above, directly detecting changes in lanosterol in SLE patients is difficult; therefore, detecting its key metabolic enzyme CYP51A1 is chosen for the diagnosis of SLE patients. Summary of the Invention

[0006] To address the issue of low specificity and sensitivity of existing biomarkers in the diagnosis of systemic lupus erythematosus (SLE), this invention provides a CYP51A1 gene primer pair and its kit for the diagnosis of SLE, thereby improving the specificity and sensitivity of SLE diagnostic results.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] This invention provides a key enzyme CYP51A1 for the diagnosis of systemic lupus erythematosus (SLE). The gene for CYP51A1 is located in the segment 91939850-92246100 of chromosome 7, and the cDNA sequence of the CYP51A1 gene after transcription is shown in SEQ ID No. 1.

[0009] SEQ ID No.1

[0010]

[0011] The application also provides application of the lanosterol metabolism key enzyme CYP51A1 in the diagnosis reagent or kit for systemic lupus erythematosus, wherein the application determines the transcription level of CYP51A1 in peripheral blood mononuclear cells of a subject.

[0012] The application also provides a CYP51A1 gene primer pair for diagnosing systemic lupus erythematosus, which comprises a forward primer sequence as shown in sequence SEQ ID NO. 2 and a reverse primer sequence as shown in sequence SEQ ID NO. 3.

[0013] CYP51A1-F: ATAACCCAGCATCAGGGGAAA; (SEQ ID NO. 2);

[0014] CYP51A1-R: CACAGTGGGAAAGTATCCATCAA; (SEQ ID NO. 3).

[0015] The application also provides a kit for diagnosing systemic lupus erythematosus, which comprises the following components.

[0016] Normal control group cDNA samples, real-time fluorescent quantitative PCR amplification reagent premix, the primer pair of the CYP51A1 gene described in the above technical solution, the primer pair of the housekeeping gene GAPDH and nuclease-free water;

[0017] Further, the primer sequence of the primer pair of the housekeeping gene GAPDH is as follows:

[0018] GAPDH-F: ATCCCATCACCATCTTCCAG; (SEQ ID NO. 4);

[0019] GAPDH-R: GAGTCCTTCCACGATACCAA; (SEQ ID NO. 5).

[0020] Further, the normal control group cDNA samples are 28 normal human peripheral blood mononuclear cell cDNAs.

[0021] Specifically, the following steps are included:

[0022] (1) isolating peripheral blood mononuclear cells of a subject;

[0023] (2) extracting total RNA of peripheral blood mononuclear cells of the subject;

[0024] (3) reverse transcribing the total RNA into cDNA;

[0025] (4) Real-time quantitative PCR amplification of the cDNA of the subject and the standard product by specific PCR primers;

[0026] (5) Analysis of the detection results.

[0027] Further, in step (4), the reaction system for PCR amplification is composed of the following components: 1.0 μl of cDNA, 5 μl of PCR amplification reagent, 0.2 μl of upstream primer, 0.2 μl of downstream primer, and 3.6 μl of nuclease-free water.

[0028] Further, the real-time fluorescent quantitative PCR amplification reagent premix includes PCR buffer, dNTPs, high-efficiency Taq enzyme, Rox inert reference dye, and nuclease-free water. Further, the PCR buffer in the real-time fluorescent quantitative PCR amplification reagent premix is 2×PCR buffer, and the 2×PCR buffer includes 20 mM pH 8.3 Tris-HCl, 3 mM Mg2+, and 100 mM KCl.

[0029] The application provides a CYP51A1 gene primer pair for diagnosing systemic lupus erythematosus, the CYP51A1 can be combined with systemic lupus erythematosus specific autoantibodies to prepare a kit for diagnosing systemic lupus erythematosus, and the systemic lupus erythematosus specific autoantibodies are anti-Sm antibodies and / or anti-dsDNA antibodies. When the relative expression amount of the CYP51A1 is less than or equal to 0.556, the subject is diagnosed as having systemic lupus erythematosus, and the sensitivity and specificity of the single diagnosis are 79.2% and 96.6%, respectively; and the sensitivity and specificity of the diagnosis combined with the autoantibodies (anti-Sm antibodies and / or dsDNA antibodies) are 94.7% and 96.6%, respectively.

[0030] The application has the following beneficial effects:

[0031] The application adopts the method of real-time fluorescent quantitative PCR, has the characteristics of rapidness, sensitivity and accuracy, and can provide important basis and reference value for the evaluation of diseases in clinic through the detection of the relative expression amount of CYP51A1 by real-time fluorescent quantitative PCR, thereby being beneficial to the diagnosis and treatment of the disease and having the value of popularization and application. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 The application provides the comparison of the relative expression amount of CYP51A1 in healthy subjects and systemic lupus erythematosus patients;

[0033] Figure 2 The application provides the correlation between the relative expression amount of CYP51A1 and the disease activity;

[0034] Figure 3The ROC curve of the relative expression amount of CYP51A1 combined with autoantibody in diagnosing systemic lupus erythematosus is provided. DETAILED DESCRIPTION

[0035] The present application is further illustrated below in conjunction with the drawings and specific embodiments, and it should be understood that the following specific embodiments are only used to illustrate the present application and are not used to limit the scope of the present application; the reagents, instruments or reagents used are indicated by the manufacturer, and are all conventional products that can be obtained by purchase.

[0036] Example 1

[0037] Diagnostic efficiency of CYP51A1 for systemic lupus erythematosus

[0038] I. Experimental samples

[0039] Twenty-eight healthy subjects and twenty-four patients with systemic lupus erythematosus were collected from Gulou Hospital Affiliated to Nanjing University Medical College. The healthy subjects were normal people who passed the physical examination, and the diagnosis of systemic lupus erythematosus met the revised criteria of the American College of Rheumatology (ACR) in 1997. The gender and age of the patients in each group were matched.

[0040] Exclusion criteria: ① combined with other rheumatology diseases; ② combined with serious primary diseases of cardiovascular, cerebrovascular, liver, kidney and hematopoietic system; ③ with mental illness and cannot cooperate; ④ participated in other clinical trials within 1 month; ⑤ unwilling to accept the study.

[0041] II. Experimental methods

[0042] 1. Density gradient centrifugation method for separation of human peripheral blood mononuclear cells (peripheral blood monocytes, PBMCs):

[0043] 1) Collect 1-2ml of fasting systemic lupus erythematosus (SLE) and control group healthy person (healthy donor control, HC) EDTA anticoagulation peripheral blood, centrifuge at 2000rpm for 5 minutes;

[0044] 2) Discard the upper layer, mix the lower layer blood cells with the same volume of PBS dilution, then slowly add the diluted blood cells along the wall of the centrifuge tube above the human lymphocyte separation medium (Lymphoprep TM , STEMCELL, Cat#07851 / 07861) (the ratio of blood cell diluent to human lymphocyte separation medium is 1:1);

[0045] 3) Place in centrifuge 2000 rpm room temperature deceleration centrifugation for 20 minutes, the centrifuge tube from top to bottom of the cell into four layers. The first layer is the plasma layer, the second layer of cloud-like single nuclear cell layer, the third layer is the transparent separation liquid layer, the fourth layer is the red blood cell layer;

[0046] 4) Carefully pipette the second layer of cloud-like cells into a new centrifuge tube, then add an appropriate amount of PBS 1800 rpm for two washes, 5 minutes each time, discard the supernatant after centrifugation, add 1 ml Trizol and mix well, transfer to a 1.5 ml enzyme-free EP tube, store in a -80°C freezer, and use for RNA extraction.

[0047] 2, Real-time quantitative polymerase chain reaction, rt-PCR

[0048] 1) Total RNA extraction:

[0049] Trizol stored cells were taken out of the -80°C freezer and thawed at room temperature. The total RNA of SLE patients and healthy people was extracted from single nuclear cells according to the total RNA extraction instructions (RNA isolater Total RNA Extraction Reagent, R401, Norgen Biotek Corporation)

[0050] 2) Reverse transcription reaction:

[0051] Take 1 ug of RNA as a reverse transcription template, use the two-step reverse transcription reagent of Norgen Biotek Corporation (R323, Norgen Biotek Corporation) for reverse transcription, and operate on ice throughout.

[0052] 3) Design and synthesis of real-time PCR primers:

[0053] Search for human mRNA sequences in the Gene database of the National Center for Biotechnology Information website (https: / / www.ncbi.nlm.nih.gov / ), design human CYP51A1 primers and internal reference gene GAPDH primer sequences using Primer blast software (https: / / www.ncbi.nlm.nih.gov / tools / primer blast / index.cgi?LINK_LOC=BlastHome), and send to Jin Sui Biological Company for primer synthesis. The specific primer sequences are shown in the sequence listing (CYP51A1: SEQ ID NO. 2-3; GAPDH: SEQ ID NO. 4-5).

[0054] 4) Real-time quantitative PCR:

[0055] a. ChamQ Universal SYBR qPCR Master Mix reagent (Q711, Qiagen) was used, and all operations were performed on ice;

[0056] b. Reaction system: The PCR reaction solution was prepared according to the following table. The PCR reaction was performed using QuantStudio TM 6Flex real-time fluorescent quantitative PCR detection system (Applied Biosystems, USA) to perform PCR reaction, each sample of each gene was made into 3 duplicate holes.

[0057] Reagent Volume 2X ChamQ Universal SYBR qPCR Master Mix 5 μl PCR Forward primer (10 μM) 0.2 μl PCR Reverse primer (10 μM) 0.2 μl cDNA 1 μl DEPC treated water 3.6 μl total 10 μl

[0058] c. Reaction conditions: first step (pre-deformation): 95℃ for 3 minutes; second step: denaturation, annealing and extension, 95℃ for 10 seconds, 60℃ for 30 seconds, 40 cycles; third step: melting curve.

[0059] 5. Data analysis:

[0060] The Ct values of CYP51A1 and housekeeping gene GAPDH were obtained by QuantStudio TM 6Flex (Applied Biosystems, USA), the average value of 3 repeated was calculated, the amplification curve and melting curve were confirmed to be correct, and the Ct value difference of each duplicate hole was not more than 0.5. GAPDH was used as an internal reference, and the Ct value of the target gene CYP51A1 was subtracted from the Ct value of GAPDH as △Ct, and the 2 -△△Ct value after standardization was calculated, which was expressed as the relative expression content of the target gene mRNA.

[0061] CYP51A1 relative expression, correlation with SLEDAI and ROC curve were analyzed and plotted by GraphPad Prism 9.0.0 software, independent sample T test, pearson correlation analysis and ROC curve were used, p<0.05 had statistical significance, among which ****p<0.0001, ***p<0.001, **p<0.01, *p<0.05, ns. No statistical difference.

[0062] III. Experimental results

[0063] 1. The results were judged by calculating the relative expression of CYP51A1, and when the relative expression was less than or equal to 0.556, it was diagnosed as systemic lupus erythematosus, and the sensitivity and specificity were 79.2% and 96.6%, respectively;

[0064] 2、Compare the relative expression of CYP51A1 in SLE patients and normal people: compared with normal people, the expression of CYP51A1 in SLE patients is significantly lower than that in normal group( Figure 1 )。

[0065] 3、Analysis of the correlation between the relative expression of CYP51A1 and the disease activity of the subjects: linear correlation analysis was performed between the relative expression of CYP51A1 of the subjects and the SLE disease activity SLEDAI, and the result showed that there was no significant correlation( Figure 2 )。

[0066] 4、The sensitivity and specificity of CYP51A1 relative expression combined with autoantibody for diagnosing SLE: the AUC of CYP51A1 is 0.908, and when the cutoff value is 0.556, the specificity is 96.6% and the sensitivity is 79.2%; the AUC of anti-Sm antibody is 0.733, and the AUC of CYP51A1 combined with anti-Sm antibody is 0.960, and when the cutoff value is 0.556, the specificity is 96.6% and the sensitivity is 94.7%( Figure 3 )。

[0067] 5、Similarly, the AUC of anti-dsDNA antibody is 0.714, and the AUC of CYP51A1 combined with anti-dsDNA antibody is 0.960; when the cutoff value is 0.556, the specificity is 96.6% and the sensitivity is 94.7%( Figure 3 )。

[0068] It should be noted that the above content only illustrates the technical idea of the present application, and cannot limit the protection scope of the present application. For ordinary skilled persons in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which fall within the protection scope of the claims of the present application.

Claims

1. Use of a reagent for detecting lanosterol metabolism key enzyme CYP51A1 in the preparation of a kit for the diagnosis of systemic lupus erythematosus, characterized in that, The reagent is used for determining the transcription level of CYP51A1 in peripheral blood mononuclear cells of a subject.

2. The use of a reagent for detecting the key enzyme CYP51A1 of lanosterol lipid metabolites according to claim 1 in the preparation of a kit for the diagnosis of systemic lupus erythematosus, characterized by, The reagent comprises a gene primer pair of CYP51A1 for systemic lupus erythematosus diagnosis, and the primer pair comprises a forward primer as shown in sequence SEQ ID NO. 2 and a reverse primer as shown in sequence SEQ ID NO. 3.

Images