A primer combination for dual targets of bovine streptococci and bovine cocci and its LAMP detection method

Abstract

The invention provides a primer combination with dual targets of bovine streptococcus and bovine coccidia and a LAMP detection method thereof, and relates to the technical field of rapid detection of molecular diagnosis. A primer combination for simultaneous detection of dual-target nucleic acid genes of bovine streptococci and bovine cocci, comprising a bovine streptococci RecN gene primer combination and a bovine cocci 18srRNA gene primer combination; the bovine streptococci RecN gene primer combination is combination I, as shown in sequence table SeqIDNO.1-6; the bovine cocci 18srRNA gene primer combination is primer combination II, as shown in sequence table SeqIDNO.31-36; the bovine streptococci RecN gene primer combination and the bovine cocci 18srRNA gene primer combination have the characteristics of high sensitivity and high specificity, and realize the simultaneous detection of two cattle pathogens, bovine streptococci and bovine cocci; the detection reaction can be completed at 60°C-64°C within 30-60min; the detection result is visualized, and whether a sample contains bovine streptococci or bovine cocci can be judged by color change, and the sample can be widely used in pastoral areas, farms and other places.

Description

Technical Field

[0001] The invention relates to the technical field of rapid detection of molecular diagnosis, and in particular to a primer combination of bovine streptococci and bovine coccidia dual targets and a LAMP detection method thereof. Background Art

[0002] Streptococcus bovis is a common facultative anaerobic bacterium in the rumen of yaks. It is a non-β-hemolytic streptococcus that exists in the digestive tract of herbivores and can cause gastrointestinal diseases such as rumen acidosis and diarrhea in ruminants such as yaks. Bovine coccidiosis is an infectious internal parasitic disease caused by various types of Eimeria parasitizing in cattle. It is one of the most common parasitic diseases in cattle worldwide. Eimeria mainly parasitizes in the rectum and small intestine of cattle. When cattle come into contact with food infected with Eimeria, the coccidia directly enter the intestinal oocysts of cattle, and then divide and multiply, which is highly infectious. In the early stage of coccidia infection, due to the relatively small number of parasites, typical clinical symptoms are usually not caused in cattle. However, as the parasites further multiply and grow in the intestines of cattle and produce a large amount of toxins, the intestinal peristalsis of cattle will be abnormal, and the nutrients in the feed cannot be digested well. Feces are often discharged from the body with abnormal intestinal peristalsis, showing severe diarrhea symptoms. The above two pathogens are both pathogens of cattle plague that have caused epidemics and serious harm in yak pastoral areas in recent years. However, the diagnostic methods are relatively cumbersome, the basic implementation is not standardized, and the accuracy is not high, which seriously threatens the health of yaks, causes great economic losses to agriculture and animal husbandry, and hinders the development of the yak industry.

[0003] At present, the detection of bovine streptococci mainly relies on bacterial isolation and culture and 16s rRNA sequencing technology. However, the isolation and culture of bacteria is complicated and time-consuming, and needs to be operated by professional technicians in professional laboratories. Therefore, sequencing technology requires professional sequencing companies to complete, and it is impossible to achieve rapid on-site detection of livestock infected with bovine streptococci in livestock farms. In addition, traditional detection methods for bovine cocci mainly include morphological examination of oocysts in cattle feces samples, saturated salt water flotation method and McMaster method. However, these traditional bovine pathogenic parasite detection methods are not specific, and the detection is time-consuming, requires skilled technology, and has certain defects. Since bovine streptococci and bovine cocci are common pathogens of yaks, both of which cause diarrhea in yaks, it is impossible to distinguish the specific causes of yaks from the symptoms. Therefore, it is necessary to develop a fast, convenient and more cost-effective method to accurately identify the two cattle pathogens, bovine streptococci and bovine cocci.

[0004] Loop-mediated isothermal amplification (LAMP) technology relies on six independent regions of the target DNA, so it has a very high specificity. The reaction is carried out under isothermal conditions, so there is no need for expensive equipment such as PCR instruments. It can be completed using only equipment such as a water bath that can maintain a stable constant temperature. The detection cost is greatly reduced and the scope of application is significantly expanded. Its high sensitivity, high specificity and rapid amplification have been tested and recognized by the market. Summary of the invention

[0005] In view of the above problems, a primer combination with dual targets of bovine Streptococcus and bovine cocci and a LAMP detection method thereof are provided, wherein primer combination I is designed based on the RecN gene of bovine Streptococcus, and primer combination II is designed based on the 18s rRNA gene of bovine cocci, and the primer combination has high sensitivity and specificity; the reaction is carried out under isothermal conditions, and does not require expensive equipment such as a PCR instrument, and can be completed only with equipment such as a water bath that can maintain a stable constant temperature, thereby greatly reducing the detection cost and significantly expanding the scope of application, and real-time monitoring can be carried out in fields, pastoral areas, etc.

[0006] The present invention adopts the following technical solutions:

[0007] A primer combination with dual targets of bovine streptococcus and bovine cocci, comprising a primer combination of bovine streptococcus RecN gene and a primer combination of bovine cocci 18s rRNA gene.

[0008] The Streptococcus bovis RecN gene primer combination is primer combination I, including two outer primers RecN 1-F3 and RecN1-B3, two inner primers RecN 1-FIP and RecN 1-BIP, and two loop guide primers RecN 1-LoopF ​​and RecN 1-LoopB, as shown in sequence table Seq ID NO.1-6.

[0009] The bovine coccidia 18s rRNA gene primer combination is primer combination II, including two outer primers 18s rRNA3-F3 and 18srRNA3-B3, two inner primers 18s rRNA3-FIP and 18s rRNA3-BIP, and two loop guide primers 18s rRNA3-LoopF ​​and 18s rRNA3-LoopB, as shown in the sequence table Seq ID NO.31-36.

[0010] Furthermore, the sensitivity of the primer combination I and the primer combination II are 1.0×10 2 copies / μL and 1.0×10 1 copies / μL.

[0011] A LAMP detection method for the dual targets of bovine streptococci and bovine cocci for non-diagnostic purposes comprises the following steps:

[0012] (1) Extraction of total DNA from samples

[0013] (2) LAMP amplification reaction using primer combination I and primer combination II

[0014] (3) Result judgment: if primer combination I successfully amplifies the total DNA as a template, it is positive for bovine Streptococcus; if primer combination II successfully amplifies the total DNA as a template, it is positive for bovine cocci.

[0015] Furthermore, in the primer combination I, the concentrations of primers RecN 1-F3, RecN 1-B3, RecN 1-FIP, RecN 1-BIP, RecN 1-LoopF, and RecN 1-LoopB are 1.2 μmol / L, 1.2 μmol / L, 0.2 μmol / L, 0.2 μmol / L, 0.4 μmol / L, and 0.4 μmol / L, respectively; in the primer combination II, the concentrations of primers 18s rRNA3-F3, 18s rRNA3-B3, 18srRNA3-FIP, 18s rRNA3-BIP, 18s rRNA3-LoopF, and 18s rRNA3-LoopB are 1.2 μmol / L, 1.2 μmol / L, 0.2 μmol / L, 0.2 μmol / L, 0.4 μmol / L, and 0.4 μmol / L, respectively.

[0016] Furthermore, the LAMP amplification reaction conditions are 60°C-67°C, 10-60min.

[0017] Furthermore, the result is determined by the color change of the phenol red reagent in the reaction system; after the reaction is completed, if the reaction system is orange-yellow, it is a positive result, and if the reaction system is purple-red, it is a negative result.

[0018] The application of the dual-target LAMP detection method of bovine Streptococcus and bovine coccidia in the simultaneous detection of bovine Streptococcus and bovine coccidia is as follows:

[0019] (1) preparing a kit for detecting bovine streptococci and bovine coccidia that cause diarrhea in yaks;

[0020] (2) Identification of Streptococcus bovis and Coccidia bovis that cause diarrhea in yaks;

[0021] (3) Detect whether the sample contains bovine streptococci and bovine coccidia, which cause yak diarrhea.

[0022] The beneficial effects of the present invention are:

[0023] The present invention designs primer combination I and primer combination II for specific genes RecN gene and 18s rRNA gene of bovine streptococcus and bovine coccidia, which have high sensitivity and specificity, realize the simultaneous detection of two cattle pathogens, bovine streptococcus and bovine coccidia, take a short detection reaction time, and can produce results in half an hour, the detection result is visualized, and it can be judged whether bovine streptococcus and bovine coccidia exist in the sample through color change, the detection equipment requirement is low, and only a water bath is needed to achieve the detection, the professional requirement is low, the operation is simple and convenient, and the method can be widely used in the real-time monitoring of bovine streptococcus and bovine coccidia in pastoral areas, farms and other places, and has a good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings of the embodiments will be briefly introduced below. Obviously, the drawings in the following description only relate to some embodiments of the present invention, but are not intended to limit the present invention.

[0025] Figure 1 Screening results of primer combination 1-3 for the RecN gene of Streptococcus bovis;

[0026] Figure 2 Screening results of primer combinations 1-3 for the 18s rRNA gene of bovine coccidia;

[0027] Figure 3 Primer combination I concentration optimization results;

[0028] Figure 4 Primer combination II concentration optimization results;

[0029] Figure 5 Primer combination I reaction temperature screening results;

[0030] Figure 6 Primer combination II reaction temperature screening results;

[0031] Figure 7 Primer combination I reaction amplification time screening;

[0032] Figure 8 Primer combination II reaction amplification time screening;

[0033] Fig. 9 Visualization results of dual-target LAMP detection of bovine Streptococcus and bovine cocci;

[0034] Fig.10 Results of double-target LAMP fluorescence quantitative amplification of bovine Streptococcus and bovine cocci;

[0035] Fig.11 Primer combination I LAMP specific visualization detection results;

[0036] Fig.12Primer combination I LAMP specific fluorescence quantitative amplification results;

[0037] Fig.13 Primer combination II LAMP specific visualization detection results;

[0038] Fig.14 Primer combination II LAMP specific fluorescence quantitative amplification results;

[0039] Fig.15 Primer combination I LAMP sensitivity visualization test results;

[0040] Fig.16 Primer combination I LAMP sensitivity fluorescence quantitative amplification results;

[0041] Fig.17 Primer combination II LAMP sensitivity visualization test results;

[0042] Fig.18 Primer combination II LAMP sensitivity fluorescence quantitative amplification results DETAILED DESCRIPTION

[0043] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. The experimental methods used in the following embodiments are conventional methods unless otherwise specified; the materials, reagents, etc. used can be obtained from commercial channels unless otherwise specified. The LAMP reaction solution was purchased from Nanjing Novozyme Co., Ltd., product number P701-01.

[0044] The target gene sequences of the bovine Streptococcus RceN gene and the bovine cocci 18s rRNA gene were introduced into the pUC57 plasmid (synthesized by Shenggong Biological Co., Ltd.) to establish positive standards for the establishment of the LAMP detection method. The primer combination I and the primer combination II were respectively prepared with the LAMP reaction solution into a 25μL system and reacted at a constant temperature of 60-65℃ for 30-60min to obtain the reaction result. The positive and negative of the reaction were judged by the traditional detection method of 2% agarose gel electrophoresis. Bright gradient bands were visible in positive results, and no bands were seen in negative results. A visual detection system was established using the acid-base indicator phenol red. After the reaction was completed, the system was observed to be orange-yellow with the naked eye, which was a positive result, and the system was purple-red, which was a negative result. The fluorescence quantitative detection system was established using SYBR Green I to quantitatively verify the established LAMP detection method. The detection results were judged according to the fluorescence quantitative amplification curve. The specific amplification curve was a positive result, and the absence of the amplification curve was a negative result.

[0045] Example 1 Design and screening of primers for the RecN gene of Streptococcus bovis and the 18s rRNA gene of Coccidia bovis

[0046] According to the sequences of the bovine Streptococcus RecN gene (GeneBank accession number: EU917264.1) and the bovine cocci 18s rRNA gene (GeneBank accession number: KT184336.1), three sets of primers were designed using PrimerExplorerV5 software for subsequent verification. The primer sequences are shown in Table 1 below. The primers were synthesized by Sangon Biotech Co., Ltd. Experimental verification showed that the RecN gene primer combination 1 and the 18s rRNA gene primer combination 3 had good detection capabilities. Figure 1 As shown in the figure, RecN gene primer combination 1 can identify positive and negative samples, while primer combinations 2 and 3 show non-specific amplification in negative samples. Figure 2 As shown, 18s rRNA gene primer combination 1 does not work, primer combination 2 shows nonspecific amplification, and primer combination 3 can identify positive and negative samples. RecN gene primer combination 1 is named primer combination I, and 18s rRNA gene primer combination 3 is named primer combination II for the subsequent establishment of a dual-target LAMP detection method for bovine Streptococcus and bovine cocci.

[0047] Table 1 Primer combinations for RecN gene and 18s rRNA gene

[0048]

[0049]

[0050]

[0051] Example 2 Optimization of primer concentrations for the RecN gene of Streptococcus bovis and the 18s rRNA gene of Coccidia bovis

[0052] In order to explore the effect of the ratio of inner and outer primer concentrations on the LAMP reaction, the outer primer concentration in the most concentrated system: the inner primer concentration (F3: FIP and B3: BIP) were 1: 1, 1: 2, 1: 4, 1: 6, and 1: 8, respectively, and the other components were kept unchanged. The reaction was amplified at 65°C for 60 min, and SYBR Green I was used to measure the fluorescence value of the reaction system. The fluorescence amplification curve was drawn to determine the optimal ratio of inner and outer primers. Figure 3 As shown, for primer combination I, different ratios of internal and external primer concentrations have little effect on the amplification rate of the LAMP reaction; Figure 4As shown, for primer combination II, the LAMP reaction amplification rate is higher when the outer primer concentration: inner primer concentration ratio is 1: 6. Therefore, both primer combination I and primer combination II use an outer primer concentration: inner primer concentration ratio of 1: 4 as the final primer concentration ratio. Therefore, the concentrations of the primers in primer combination I: RecN 1-F3, RecN 1-B3, RecN 1-FIP, RecN 1-BIP, RecN 1-LoopF, and RecN 1-LoopB are 1.2 μmol / L, 1.2 μmol / L, 0.2 μmol / L, 0.2 μmol / L, 0.4 μmol / L, and 0.4 μmol / L, respectively; the concentrations of the primers in primer combination II: 18s rRNA3-F3, 18srRNA3-B3, 18s rRNA3-FIP, 18s rRNA3-BIP, 18s rRNA3-LoopF, and 18s rRNA3-LoopB are 1.2 μmol / L, 1.2 μmol / L, 0.2 μmol / L, 0.2 μmol / L, 0.4 μmol / L, and 0.4 μmol / L, respectively.

[0053] Example 3 Screening of amplification temperature of dual-target LAMP reaction of Streptococcus bovis and Coccidia bovis

[0054] In order to screen out the optimal amplification temperature for the LAMP reaction of primer combination I and primer combination II, the amplification temperature of primer combination I and primer combination II was verified at constant temperatures of 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C and 67°C for 60 min. Figure 5 As shown in Figure 1, primer combination I can identify positive and negative samples at 60°C-65°C, and non-specific amplification occurs at 66°C and 67°C. Figure 6 As shown, primer combination II can identify positive and negative samples at 60°C-64°C, and non-specific amplification occurs at 65°C-67°C. In order to unify the amplification temperature of primer combination I and primer combination II, the amplification effect is better when 60°C-64°C is selected.

[0055] Example 4 Screening of amplification time of dual-target LAMP reaction of Streptococcus bovis and Coccidia bovis

[0056] In order to screen the amplification time of primer combination I and primer combination II for LAMP reaction at a constant temperature (60°C), the amplification of primer combination I and primer combination II after amplification for 10min, 20min, 30min, 40min, 50min and 60min respectively was verified. Figure 7 As shown in Figure 1, primer combination I can produce positive amplification at 60°C for 30 minutes. Figure 8As shown, positive amplification can be obtained by amplifying primer combination II for 20 minutes at 60° C. In order to unify the amplification time of primer combination I and primer combination II, positive amplification can be obtained by selecting 30-60 minutes.

[0057] Example 5 Dual-target LAMP detection based on primer sets of bovine Streptococcus RecN gene and bovine cocci 18s rRNA gene

[0058] Place PCR tubes of four samples, including primer combination I negative control, bovine Streptococcus, primer combination II negative control, and bovine cocci, in a fluorescent quantitative PCR instrument, use SYBR Green I as the nucleic acid dye, set the constant temperature condition of 60°C for amplification for 60 minutes, and collect the fluorescence signal once a minute to obtain the real-time fluorescence amplification curve of dual-target detection of bovine Streptococcus and bovine cocci. During the LAPM reaction, positive amplification will continuously consume dNTPs to generate new chains as well as by-products such as magnesium pyrophosphate and hydrogen ions, and the pH value in the solution will decrease. Therefore, the SYBR Green I fluorescent dye in the reaction system was replaced with phenol red (color change range pH 6.8-8.4, purple-red to orange-yellow) acid-base indicator, and the visual detection results were observed with the naked eye after reacting in a 60°C water bath for 30 minutes. The visual detection results are shown in the following figure. Fig. 9 As shown in FIG. 1 , the negative control of primer combination I and the negative control of primer combination II are purple-red, and the bovine streptococci and bovine cocci are orange-yellow. The real-time fluorescence quantitative detection results are shown in FIG. Fig.10 As shown, the negative control of primer combination I and the negative control of primer combination II showed no specific amplification curve, which was a negative result, and the specific S-type amplification curve of bovine Streptococcus and bovine cocci was positive amplification. Therefore, the dual-target LAMP detection based on the primer set of bovine Streptococcus RecN gene and bovine cocci 18s rRNA gene can obtain good results by both visual detection and fluorescence quantitative detection.

[0059] Example 6 Specificity of dual-target LAMP detection of Streptococcus bovis RecN gene and bovine cocci 18s rRNA gene

[0060] In order to verify the specificity of primer combination I and primer combination II, experiments were conducted using 11 control strains including Streptococcus bovis, Streptococcus aureus, Streptococcus group A, Streptococcus group B, Streptococcus pneumoniae, Staphylococcus aureus, Haemophilus influenzae, Vibrio parahaemolyticus, Pseudomonas aeruginosa, Escherichia coli, Shigella, Salmonella, and Helicobacter pylori. Streptococcus bovis, Streptococcus group B, and Streptococcus group A were purchased from Ningbo Mingzhou Biotechnology Co., Ltd., and the remaining strains were strains preserved by the Microbiology Teaching and Research Department of West China School of Basic Medical Sciences and Forensic Medicine, Sichuan University. Fig.11 and 12 As shown, the visualization LAMP detection and fluorescence quantitative LAMP detection methods were used to verify that primer combination I only produced positive amplification for bovine Streptococcus; Fig.13 and 14 As shown in 14 , the primer combination II was verified to produce positive amplification only for bovine coccidia by applying visual LAMP detection and fluorescence quantitative LAMP detection methods. Therefore, the dual-target LAMP detection method established based on the RecN gene of Streptococcus bovis and the 18S rRNA gene of bovine coccidia has good specificity.

[0061] Example 7 Sensitivity of the dual-target LAMP detection of the RecN gene of Streptococcus bovis and the 18S rRNA gene of bovine coccidia

[0062] To determine the sensitivity of the dual-target LAMP detection of the RecN gene of Streptococcus bovis and the 18S rRNA gene of bovine coccidia, the RecN target gene sequence of Streptococcus and the 18S rRNA target gene sequence of bovine coccidia were respectively introduced into the pUC57 plasmid (purchased from Sangon Biotech Co., Ltd.) to establish standards, and the standard plasmids were diluted into gradient samples of 1.0×10 8 copies / μL - 1.0×10 0 copies / μL for detection by amplification at a constant temperature of 60°C for 30 - 60 min. The results are as Fig.15 shown. By applying the LAMP visual detection system primer combination I, amplification can be performed on samples of 1.0×10 8 copies / μL - 1.0×10 2 copies / μL under the condition of amplification at a constant temperature of 60°C for 30 min. The results are as Fig.16 shown. By applying the LAMP fluorescence quantitative detection system primer combination I, S-shaped amplification curves of samples of 1.0×10 8 copies / μL - 1.0×10 2 copies / μL can be obtained under the condition of amplification at a constant temperature of 60°C for 60 min. It shows that the lowest detection limit of the LAMP detection method established with primer combination I is 1.0×10 2 copies / μL. The results are as Fig.17 shown. By applying the LAMP visual detection system primer combination II, amplification can be performed on samples of 1.0×10 8 copies / μL - 1.0×10 1 copies / μL under the condition of amplification at a constant temperature of 60°C for 30 min. The results are as Fig.18 shown. By applying the LAMP fluorescence quantitative detection system primer combination II, S-shaped amplification curves of samples of 1.0×10 8 copies / μL - 1.0×10 1 copies / μL can be obtained under the condition of amplification at a constant temperature of 60°C for 60 min. It shows that the lowest detection limit of the LAMP detection method established with primer combination II is 1.0×10 1In summary, the sensitivity of the dual-target LAMP detection established by the primer combination of bovine Streptococcus RecN gene and bovine cocci 18s rRNA gene was 1.0×10 2 copies / μL and 1.0×10 1 copies / μL.

[0063] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A primer combination with dual targets of bovine Streptococcus and bovine coccidia, It is characterized in that It includes a Streptococcus bovis RecN gene primer combination and a bovine coccidia 18s rRNA gene primer combination; the Streptococcus bovis RecN gene primer combination is primer combination I, including the following 6 primers: RecN 1-F3:GGTCGTTCTATTAGCCGTATC; RecN 1-B3:TCTCGATAGTGTTTTTTGACAG; RecN 1-FIP:ACCGTGAATATCAACCAAGTACTGCGGTCAA ATGGTTAATCTGAC; RecN 1-BIP:TGACCAAGAAGAATTAATGAAGCCCCTGAAAAATGTTCATCCCCAA; RecN 1-LoopF: CAACCGCACGAAGGGTT; RecN 1-LoopB:AACATGCACATCCGTATGCT; The bovine coccidia 18s rRNA gene primer combination is primer combination II, which includes the following 6 primers: 18s rRNA3-F3:ACGCAAGGAAGTTTGAGGC; 18s rRNA3-B3:GGGCGGTGTGTACAAAGG; 18s rRNA3-FIP: ACTTCCCGGCCAAGGTCAAGA-CCCTTAGATGTTCTGGGCTG; 18s rRNA3-BIP:TGAGTGTGCATCGTGATGGGGA-AGCTG CTGACTTACGCCTA; 18s rRNA3-LoopF:TGCATGCATCAGTGTAGCG; 18s rRNA3-LoopB:TTAATCTTCAACGAGGAATGCCTAG.

2. A LAMP detection method for the dual targets of bovine Streptococcus and bovine cocci for non-diagnostic purposes, It is characterized in that The following steps are involved: (1) Extract total DNA from samples; (2) performing a LAMP amplification reaction using primer combination I and primer combination II; (3) Result judgment: if primer combination I successfully amplifies the total DNA as a template, it is a positive result for bovine Streptococcus; if primer combination II successfully amplifies the total DNA as a template, it is a positive result for bovine cocci; Wherein, the primer combination I and primer combination II are the primer combination I and primer combination II described in claim 1.

3. The LAMP detection method for the dual-target of non-diagnostic bovine Streptococcus and bovine coccidia according to claim 2, It is characterized in that In the primer combination I, the concentrations of primers RecN1-F3, RecN 1-B3, RecN 1-FIP, RecN 1-BIP, RecN1-Loop F, and RecN 1-LoopB are 1.2 μmol / L, 1.2 μmol / L, 0.2 μmol / L, 0.2 μmol / L, 0.4 μmol / L, and 0.4 μmol / L, respectively; in the primer combination II, the concentrations of primers 18s rRNA3-F3, 18s rRNA3-B3, 18s rRNA3-FIP, 18s rRNA 3-BIP, 18s rRNA3-LoopF, and 18s rRNA3-LoopB are 1.2 μmol / L, 1.2 μmol / L, 0.2 μmol / L, 0.2 μmol / L, 0.4 μmol / L, and 0.4 μmol / L, respectively.

4. The LAMP detection method for the dual-target of non-diagnostic bovine Streptococcus and bovine coccidia according to claim 2, It is characterized in that The conditions of the LAMP amplification reaction are 60° C.-67° C., 10-60 min.

5. A LAMP detection method for the dual targets of bovine Streptococcus and bovine cocci for non-diagnostic purposes according to claim 2, wherein the result is determined by the color change of the phenol red reagent in the reaction system; after the reaction is completed, if the reaction system is orange-yellow, it is a positive result, and if the reaction system is purple-red, it is a negative result.

Images