Strain for one-step production of N-methylpyrrolidone

Abstract

The invention discloses a strain for the one-step production of N-methylpyrrolidone, belonging to the technical field of genetic engineering. By knocking out the metabolic pathway of the precursor GABA and some branch pathways, and enhancing the expression of some key genes in the synthesis pathway, the invention constructs an engineered Corynebacterium glutamicum with increased GABA production as the chassis cell for N-methylpyrrolidone synthesis. The invention expresses an N-methyltransferase derived from Coffea canephora in the chassis cell, enabling the constructed strain to ferment N-methylpyrrolidone with glucose as the carbon source in an environment with a pH of 7.0, and the production can reach 5.28 g / L after 96 h of fermentation.

Description

Technical Field

[0001] The present invention relates to a strain for the one-step production of N-methylpyrrolidone, belonging to the technical field of genetic engineering. Background Art

[0002] Pyrrole was first obtained from coke tar and bone oil, and later a variety of chemical synthesis methods were developed. N-methylpyrrolidone is one of the more widely used ones. NMP is short for N-methylpyrrolidone, and N-Methylpyrrolidone (1-Methyl-2-pyrrolidinone) is a five-membered cyclic amide and a highly efficient selective solvent. NMP has a series of excellent physical and chemical properties. NMP has a high boiling point, strong polarity, low viscosity, strong solubility, no corrosion, low toxicity, strong biodegradability, low volatility, excellent chemical stability and thermal stability, and is widely used in industries such as petrochemical, plastic industry, pharmaceuticals, pesticides, and lithium battery manufacturing. So far, there are mainly three production technologies for N-methylpyrrolidone: ①γ-butyrolactone and monomethylamine non-catalytic synthesis process, ②γ-butyrolactone and mixed methylamine continuous non-catalytic synthesis process, ③γ-butyrolactone and monomethylamine catalytic synthesis process and 1,4-butanediol catalytic dehydrogenation-amination process. The above chemical production methods have defects such as high energy consumption, cumbersome process, harsh reaction conditions, serious pollution, and low safety. The biological method has advantages such as a simpler post-treatment procedure, milder reaction conditions, higher product yield, higher product selectivity, and lower environmental pollution. Therefore, it is urgent to develop a biological method for the production of N-methylpyrrolidone. Summary of the Invention

[0003] The present invention provides a Corynebacterium glutamicum engineering bacterium, which has been subjected to at least one of the following transformations on the basis of Corynebacterium glutamicum FF10:

[0004] (1) Knock out pyruvate dehydrogenase poxB and increase the expression of aconitate hydratase;

[0005] (2) Knock out phosphotransacetylase and enhance the expression of 6-phosphofructokinase;

[0006] (3) Knock out the transcriptional regulator iolR and overexpress glutamate decarboxylase;

[0007] (4) Knock out the transcriptional regulator sugR and overexpress coenzyme A transferase;

[0008] (5) Knock out succinic semialdehyde dehydrogenase 3GabD3 and overexpress S-adenosylhomocysteine hydrolase.

[0009] In one embodiment, the pyruvate dehydrogenase poxB has the amino acid sequence shown by Genbank accession number CAF21272.1.

[0010] In one embodiment, the aconitate hydratase has the amino acid sequence shown by Genbank accession number BAB98933.1.

[0011] In one embodiment, the phosphotransacetylase has the amino acid sequence shown by Genbank accession number: CAF20775.1.

[0012] In one embodiment, the 6-phosphofructokinase has the amino acid sequence shown by Genbank accession number: BAB98643.1.

[0013] In one embodiment, the transcriptional regulator iolR has the amino acid sequence shown by Genbank accession number ASW12947.1.

[0014] In one embodiment, the transcriptional regulator sugR has the amino acid sequence shown by Genbank accession number ASW14321.1.

[0015] In one embodiment, the glutamate decarboxylase is glutamate decarboxylase GAD MUT128, which is a glutamate decarboxylase with D38N / I89V / D92N / / E93Q / S153T / D202N / P268T / E294R / D301N / F355Y / D432N / H435Q / L451* mutations, and the amino acid sequence is as shown in SEQ ID NO.1, which has been disclosed in the patent with publication number CN114752589B.

[0016] In one embodiment, the coenzyme A transferase has the amino acid sequence shown by Genbank accession number MCQ5130945.1.

[0017] In one embodiment, the succinic semialdehyde dehydrogenase 3 has the amino acid sequence shown by Genbank accession number CAF18619.1.

[0018] In one embodiment, the S-adenosylhomocysteine hydrolase has the amino acid sequence shown by Genbank accession number BAB98145.1.

[0019] In one embodiment, the Corynebacterium glutamicum engineered bacterium also expresses an N-methyltransferase derived from Coffea canephora; the N-methyltransferase has the amino acid sequence shown by Genbank accession number ABC74575.1.

[0020] In one embodiment, the N-methyltransferase is expressed using plasmid pCES; the plasmid pCES is disclosed in the paper "Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum".

[0021] In one embodiment, Corynebacterium glutamicum FF10 is disclosed in the patent with publication number CN114752544B.

[0022] The present invention also provides the application of the engineered Corynebacterium glutamicum in N-methylpyrrolidone.

[0023] In one embodiment, the application is to ferment and produce N-methylpyrrolidone at pH 7.0 ± 0.2 using the engineered Corynebacterium glutamicum with monosaccharides, polysaccharides or a mixture thereof that can be utilized by Corynebacterium glutamicum as a carbon source.

[0024] In one embodiment, the carbon source includes but is not limited to one or more of glucose, fructose, sucrose, and molasses.

[0025] In one embodiment, the application is to culture the engineered bacteria overnight in a seed medium, and then transfer them to a fermentation medium and ferment for a period of time at 28 - 30 °C.

[0026] In one embodiment, the fermentation is carried out at 28 - 30 °C and 150 - 250 rpm for at least 48 h.

[0027] In this embodiment, the seed medium is BHIS medium.

[0028] In one embodiment, the seed liquid is obtained by culturing the engineered bacteria in BHIS medium at 28 - 30 °C for 12 hours.

[0029] In one embodiment, the seed liquid is inoculated into the fermentation medium at an inoculation amount of 5 - 10%.

[0030] In one embodiment, the fermentation medium contains: glucose, (NH4)2SO4, urea, KH2PO4, K2HPO4, MgSO4·7H2O, CaCl2·2H2O, MOPS, biotin, and trace elements.

[0031] In one embodiment, the fermentation medium contains: 50 g / L of glucose, 20 g / L of (NH4)2SO4, 5 g / L of urea, 1 g / L of KH2PO4, 1 g / L of K2HPO4, 0.25 g / L of MgSO4·7H2O, 13.3 mg / L of CaCl2·2H2O, 42 g / L of MOPS, 0.2 mg / L of biotin, and 1 ml / L of trace element solution; the trace element solution contains: 10 g / L of FeSO4·7H2O, 10 g / L of MnSO4·1H2O, 1 g / L of ZnSO4·7H2O, 313 mg / L of CuSO4·5H2O, and 20 mg / L of NiCl·6H2O.

[0032] The present invention also claims the application of the engineered bacterium in the production of N-methylpyrrolidone.

[0033] Beneficial effects:

[0034] (1) By knocking out the metabolic pathway of the precursor GABA and some branch pathways, and enhancing the expression of some key genes in the synthesis pathway, the present invention constructs an engineered Corynebacterium glutamicum with increased GABA production as the chassis cell for N-methylpyrrolidone synthesis;

[0035] (2) By expressing the N-methyltransferase derived from Coffea canephora in Corynebacterium glutamicum, the constructed strain can ferment N-methylpyrrolidone with glucose as the carbon source under the condition of pH 7.0, and the yield can reach 5.28 g / L after 96 h of fermentation. Description of the drawings

[0036] Figure 1 It is a new biosynthetic pathway from GABA to N-methylpyrrolidone.

[0037] Figure 2 It is the synthesis pathway of N-methylpyrrolidone and the genes involved.

[0038] Figure 3 It is the liquid phase detection result of N-methylpyrrolidone.

[0039] Figure 4 It is the comparison of shake flask fermentation between the engineered strains FF15 pCES-NMT and FF16 pCES-NMT.

[0040] Figure 5 It is the shake flask fermentation result of the engineered strain FF16 pCES-NMT of N-methylpyrrolidone. Specific embodiments

[0041] Technical terms:

[0042] Expression: The term "expression" includes any step involved in the production of an enzyme or protein, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0043] Expression vector: The term "expression vector" means a linear or circular DNA molecule that contains a polynucleotide encoding a glutamate decarboxylase mutant of the present invention and is operably linked to a control sequence providing for its expression.

[0044] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector containing a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parental cell that is not identical to the parental cell due to mutations that occur during replication.

[0045] Fermentation broth: "Fermentation broth" refers to a preparation produced by cell fermentation that has not been recovered or has been recovered and / or purified. For example, when a microbial culture is incubated under carbon-limiting conditions that permit protein synthesis (e.g., expression of an enzyme by a host cell) and secretion of the protein into the cell culture medium until saturation, a fermentation broth is produced. The fermentation broth may contain the contents of the fermentation material obtained at the end of fermentation. For example, the fermentation broth contains the components of the medium that have been utilized by the microorganism and cell debris that remains after removal of the microbial cells (e.g., filamentous fungal cells) by centrifugation.

[0046] Culture medium:

[0047] CGXII medium: Glucose 50 g / L, (NH4)2SO4 20 g / L, Urea 5 g / L, KH2PO4 1 g / L, K2HPO4 1 g / L, MgSO4·7H2O 0.25 g / L, CaCl2·2H2O 13.3 mg / L, MOPS 42 g / L, Biotin 0.2 mg / L, Trace element solution 1 ml / L, pH adjusted to 7.0 with KOH; wherein, Trace element solution: FeSO4·7H2O 10 g / L, MnSO4·1H2O 10 g / L, ZnSO4·7H2O 1 g / L, CuSO4·5H2O 313 mg / L, NiCl·6H2O 20 mg / L.

[0048] Detection method:

[0049] Determination of the yield of N-methylpyrrolidone by liquid chromatography: Agilent 1290 liquid chromatograph, chromatographic column: InfinityLab Poroshell 120 EC C18 (2.7 μm, 4.6×100 mm, Agilent); the mobile phase was a mixed solution of 95% water-acetonitrile (containing 0.1% formic acid): methanol (90:10) isocratic elution for 5 min; flow rate 0.3 mL / min; FID detector; column temperature 30 °C; injection volume 1 μL.

[0050] Construction of the chassis cell of Corynebacterium glutamicum engineering strain with high yield of N-methylpyrrolidone in Example 1

[0051] Figure 1 For the new biosynthetic pathway from γ-aminobutyric acid (GABA) to N-methylpyrrolidone, chassis cells with high yields of GABA and 2-pyrrolidone were constructed according to this pathway. As Figure 2 shown, some metabolic pathways and some branch pathways were knocked out in the constructed strain, the expression of some key genes in the synthetic pathway was enhanced, and Corynebacterium glutamicum capable of synthesizing N-methylpyrrolidone was constructed. Specifically as follows:

[0052] 1) Construction of the recombinant plasmid pK18-ΔpoxB::acn to knockout pyruvate dehydrogenase poxB and simultaneously enhance the expression of aconitate hydratase (acn): Using the genome of Corynebacterium glutamicum FF10 (the strain is disclosed in the patent with the publication number CN114752544B) as a template, homologous arms of 1000 bp upstream and downstream of the poxB gene (Genbank accession number CAF21272.1) were cloned respectively, and the coding gene of aconitate hydratase containing a promoter (Genbank accession number BAB98933.1) was cloned and constructed between the upstream and downstream homologous arms of the poxB gene, and was ligated to the Pk18mobsacB backbone by the Gibson method to construct the recombinant plasmid pK18-ΔpoxB::acn. The obtained recombinant plasmid pK18-ΔpoxB::acn was transformed into the competent cells of recombinant Corynebacterium glutamicum FF10 to obtain the strain FF10 / ΔpoxB::acn, named FF11.

[0053] 2) Construct the recombinant plasmid pK18-Δpta::pfka to knockout phosphoacetyltransferase (Genbank accession number: CAF20775.1) and enhance the expression of 6-phosphofructokinase pfka (Genbank accession number: BAB98643.1) according to the same strategy as in step 1). The constructed recombinant plasmid pK18-Δpta::pfka was transformed into the competent cells of FF11 constructed in step 1), and the recombinant strain FF11 / Δpta::pfka was obtained, named FF12.

[0054] 3) Construct the knockout of the transcriptional regulator iolR (Genbank accession number: ASW12947.1) according to the same strategy as above, and overexpress the gene of GAD MUT 128 mutant (the sequence is disclosed in the patent with publication number CN114752589B) in the recombinant plasmid pK18-ΔiolR::GADmut to enhance the synthesis of γ-aminobutyric acid. Transform the constructed recombinant plasmid pK18-ΔiolR::GADmut into the FF12 competent cells constructed in step 2) to obtain the recombinant strain FF12 / ΔiolR::GADmut, named FF13.

[0055] 4) Construct the recombinant plasmid pK18-ΔsugR::act according to the same strategy as above, knockout the transcriptional regulator sugR (Genbank accession number: ASW14321.1), and overexpress the act gene (Genbank accession number: MCQ5130945.1) to enhance the synthesis of 2-pyrrolidone. Transform the constructed recombinant plasmid pK18-ΔsugR::act into the FF13 competent cells to obtain the recombinant strain FF13 / ΔsugR::act, named FF15.

[0056] 5) Construct the recombinant plasmid pK18-ΔgabD3::sahH according to the same strategy as above, knockout succinic semialdehyde dehydrogenase 3 (Genbank accession number: CAF18619.1), and overexpress the S-adenosylhomocysteine hydrolase sahH gene (Genbank accession number: BAB98145.1). Transform the constructed recombinant plasmid pK18-ΔgabD3::sahH into the FF15 competent cells to obtain the recombinant strain FF13 / ΔgabD3::sahH, named FF16.

[0057] Example 2 Construction of Recombinant Plasmids and Recombinant Bacteria of N-Methyltransferase

[0058] N-methyltransferase (NMT) catalyzes the formation of N-methylpyrrolidone from 2-pyrrolidone and is a key enzyme in N-methylpyrrolidone-producing bacteria. Design amplification primers for the nmt gene from Coffea canephora (Genbank accession number: ABC74575.1):

[0059] NMTF: tcgcaccttggttggtaggagtagcatgggatccatggagctccgagaagtcctgcatatgaatgaag,

[0060] NMTR: tgggaccaccgcgctactgccgccaggcagcggccgttacacgtctgacttctctggctttttggc。

[0061] Synthesize the gene with the nucleotide sequence as Gene ID: ABC74575.1. Using this gene fragment as a template, amplify the target fragment NMT by PCR. After purification with a DNA purification kit, ligate the PCR amplification product and the backbone fragment of plasmid pCES (the plasmid is disclosed in the paper "Development of a high-copy-number plasmid via adaptive laboratory evolution of Corynebacterium glutamicum") by Gibson, transform it into E. coli DH5α, and verify its successful construction by sequencing. Transform the expression vector pCES-NMT carrying the NMT coding sequence into the Corynebacterium glutamicum engineering strains FF15 and FF16 constructed in Example 1 respectively to obtain the N-methylpyrrolidone-producing recombinant strains FF15 pCES-NMT and FF16 pCES-NMT.

[0062] Example 3 Fermentation production of N-methylpyrrolidone using Corynebacterium glutamicum engineering strains

[0063] Use the N-methylpyrrolidone-producing recombinant strains constructed in Example 2 to ferment and produce N-methylpyrrolidone from glucose in one step. The specific steps are as follows: Culture the strains FF15 pCES-NMT and FF16 pCES-NMT in BHIS medium at 30 °C for 12 hours to obtain a seed solution; Inoculate the seed solution into a 500 mL shake flask containing 50 mL of CGXII medium at an inoculation amount of 10%, and ferment at 30 °C and 200 rpm for 96 hours.

[0064] As Figure 3 shown, by comparing with the peak position of the N-methylpyrrolidone standard product, the peak of N-methylpyrrolidone was detected in the sample, indicating that the constructed strains can produce N-methylpyrrolidone.

[0065] Figure 4 Shows the shake flask yields of N-methylpyrrolidone of FF15 pCES-NMT and FF16 pCES-NMT. It can be seen that the N-methylpyrrolidone yield of FF16 pCES-NMT has increased significantly, which is 1.66 times that of FF15 pCES-NMT.

[0066] Figure 5It shows the changes in OD, residual sugar, and N-methylpyrrolidone production during the shake-flask fermentation of FF16 pCES-NMT. After 72 hours of fermentation, the 50 g / L glucose was nearly exhausted, and the OD reached the maximum value of 44. Finally, at 96 hours, the shake-flask fermentation could produce 5.28 g / L N-methylpyrrolidone.

[0067] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. An engineered Corynebacterium glutamicum strain, characterized in that, Based on Corynebacterium glutamicum FF10, the following improvements were made: (1) Knock out pyruvate dehydrogenase and enhance the expression of aconitate hydratase; (2) Knock out phosphoacetyltransferase and enhance the expression of 6-phosphofructokinase; (3) Knock out the transcriptional regulator iolR and overexpress glutamate decarboxylase; (4) Knock out the transcriptional regulator sugR and overexpress coenzyme A transferase; (5) Knock out succinic semialdehyde dehydrogenase 3 and overexpress S-adenosylhomocysteine hydrolase; The pyruvate dehydrogenase poxB has the amino acid sequence shown in Genbank accession number CAF21272.1; the aconitate hydratase has the amino acid sequence shown in Genbank accession number BAB98933.1; the phosphoacetyltransferase has the amino acid sequence shown in Genbank accession number: CAF20775.1; the 6-phosphofructokinase has the amino acid sequence shown in Genbank accession number: BAB98643.1; the transcriptional regulator iolR has the amino acid sequence shown in Genbank accession number ASW12947.1; the transcriptional regulator sugR has the amino acid sequence shown in Genbank accession number ASW14321.1; the coenzyme A transferase has the amino acid sequence shown in Genbank accession number MCQ5130945.1; the succinic semialdehyde dehydrogenase 3 has the amino acid sequence shown in Genbank accession number CAF18619.1; the S-adenosylhomocysteine hydrolase has the amino acid sequence shown in Genbank accession number BAB98145.1; the amino acid sequence of the glutamate decarboxylase is as shown in SEQ ID NO.1; Corynebacterium glutamicum FF10 is disclosed in the patent with publication number CN114752544B.

2. The Corynebacterium glutamicum engineering bacteria according to claim 1, wherein The engineered Corynebacterium glutamicum also expresses an N-methyltransferase derived from Coffea canephora.

3. The Corynebacterium glutamicum engineering bacteria according to claim 1, characterized in that, The N-methyltransferase has the amino acid sequence shown in Genbank accession number ABC74575.

1.

4. Use of the engineered Corynebacterium glutamicum according to claim 3 in the preparation of N-methylpyrrolidone.

5. A method for fermentatively producing N-methylpyrrolidone, characterized in that, The engineered Corynebacterium glutamicum according to claim 3 is used for fermentative production of N-methylpyrrolidone with an available monosaccharide, polysaccharide or a mixture thereof as the carbon source at pH 7.0 ± 0.

2.

6. The method according to claim 5, wherein The carbon source includes one or more of glucose, fructose, sucrose, and molasses.

7. The method according to claim 5 or 6, characterized in that, The fermentation is carried out at 28 - 30 °C and 150 - 250 rpm for at least 48 h.

8. Use of the engineered Corynebacterium glutamicum according to claim 3 in the production of N-methylpyrrolidone.

Images