Application of biological factor Sparcl1 in drugs to promote inner ear hair cell regeneration

Abstract

The present invention discloses the use of a biological factor Sparcl1 in a drug that promotes the regeneration of inner ear hair cells, belonging to the field of gene technology for inner ear cell regeneration. The biological factor Sparcl1 is used to promote the regeneration of inner ear stem cells into hair cells. The amino acid sequence of the biological factor Sparcl1 is shown in SEQ NO.1. Compared with the prior art, this application explores the regenerative effect of the Sparcl1 gene on inner ear hair cells by combining gene regulation with the restoration of auditory function by inner ear stem cells. This patent uses AAV-ie as a viral vector for delivering the target gene, and then injects it through the round window of the ear of a newborn mouse. This method has the highest delivery efficiency and causes less damage to the cochlea, fundamentally avoiding the problems of low vector transfection efficiency and the choice of delivery method. Secondly, this patent uses human recombinant Sparcl1 protein, which can act directly on humans and therefore has important value and role in the regeneration of inner ear hair cells and the recovery of hearing loss in clinical practice.

Description

Technical Field

[0001] The present invention relates to the field of gene technology for inner ear cell regeneration, and in particular to application of a biological factor Sparcl1 in a drug for promoting the regeneration of inner ear hair cells. Background Art

[0002] It is known that the hair cells in the basilar membrane of the inner ear cochlea are the mechanical receptors of the auditory system, including outer hair cells and inner hair cells. These hair cells convert sound vibrations into electrical signals, which are then transmitted to the brain through neurons. In fact, most auditory diseases are caused by hair cell damage. However, hair cells cannot regenerate on their own in mammals; therefore, hearing loss caused by hair cell damage is permanent. The cochlea of ​​newborn mice contains some progenitor cells, which have a limited ability to produce new HCs and lose this ability in the cochlea of ​​adult mice. Therefore, finding the appropriate gene to regulate inner ear progenitor cells to re-enter the cell cycle and regenerate hair cells is very important for hearing restoration. Summary of the Invention

[0003] In view of the shortcomings of the existing technology, the present invention proposes the use of a biological factor Sparcl1 in a drug for promoting the regeneration of inner ear hair cells.

[0004] The purpose of the present invention can be achieved through the following technical solutions:

[0005] The invention relates to the use of the biological factor Sparcl1 or a pharmaceutical derivative thereof in the preparation of a drug for promoting the regeneration of inner ear stem cells into hair cells, wherein the biological factor Sparcl1 is used to promote the regeneration of inner ear stem cells into hair cells, and the amino acid sequence of the biological factor Sparcl1 is shown in SEQ NO.1.

[0006] Furthermore, the inner ear stem cells are precursor cells in the inner ear with proliferation and differentiation potential, and can undergo mitosis or transdifferentiation to become hair cells.

[0007] Furthermore, the drug of the present invention can be added to conventional excipients and prepared into various pharmaceutically acceptable dosage forms such as tablets, capsules, oral solutions, lozenges, injections, ointments, granules or various sustained-release preparations according to conventional processes.

[0008] The carriers of the drug of the present invention are common types available in the pharmaceutical field, including: adhesives, lubricants, disintegrants, solubilizers, diluents, stabilizers, suspending agents or bases, etc.

[0009] Furthermore, the drug is used in a dosage form suitable for releasing the biological factor Sparcl1 or a pharmaceutically acceptable derivative thereof in the inner ear of the user; the dosage form is an injection.

[0010] On the other hand, the invention also provides the use of a nucleic acid molecule in preparing a drug for promoting the regeneration of inner ear stem cells into hair cells, characterized in that the nucleotide sequence of the nucleic acid molecule encoding the biological factor Sparcl1 is shown in SEQ NO.2.

[0011] On the other hand, the invention also provides the use of a recombinant plasmid in preparing a drug for promoting the regeneration of inner ear stem cells into hair cells, characterized in that the recombinant plasmid integrates the above-mentioned nucleotide sequence encoding the biological factor Sparcl1.

[0012] On the other hand, the invention also provides the use of a recombinant vector in the preparation of a drug for promoting the regeneration of inner ear stem cells into hair cells, characterized in that the recombinant vector transforms the recombinant plasmid described above.

[0013] On the other hand, a drug for promoting the regeneration of inner ear stem cells into hair cells is also provided, comprising any one of the nucleic acid molecule, the recombinant plasmid, or the recombinant vector as described above.

[0014] Beneficial effects of the present invention:

[0015] This patent explores the regenerative effect of the Sparcl1 gene on inner ear hair cells by combining gene regulation with inner ear stem cells to restore auditory function. The difficulty of gene therapy generally lies in the low transfection efficiency of the vector and whether the delivery method damages the model animal. This patent uses AAV-ie as a viral vector to deliver the target gene, and then injects it through the round window of the newborn mouse ear. This method has the highest delivery efficiency and causes less damage to the cochlea, fundamentally avoiding the problems of low vector transfection efficiency and the choice of delivery method. Secondly, this patent uses human recombinant Sparcl1 protein, which can act directly on humans. Therefore, it has important value and role in the regeneration of inner ear hair cells and the recovery of hearing loss in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The present invention will be further described below with reference to the accompanying drawings.

[0017] Figure 1 This is a flowchart of the application;

[0018] Figure 2 This is a graph showing the RNA expression levels of Sparcl1 at different age stages of this application;

[0019] Figure 3 This is a graph showing the protein expression levels of Sparcl1 at different age stages in this application;

[0020] Figure 4 This is a diagram showing that Sparcl1 of the present application promotes the increase in the number and diameter of stem cell spheres in vitro;

[0021] Figure 5 This is a diagram of Sparcl1 promoting the increase of EdU in stem cell spheres in vitro;

[0022] Figure 6 This is a diagram of Sparcl1 promoting hair cell differentiation in vivo in this application;

[0023] Figure 7 This is a diagram showing that the recombinant human Sparcl1 protein of this application promotes hair cell differentiation in vivo. DETAILED DESCRIPTION

[0024] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0025] Throughout this specification, references to terms such as "one embodiment," "example," or "specific example" indicate that the specific features, structures, materials, or characteristics described in conjunction with that embodiment or example are included in at least one embodiment or example of the present invention. In this specification, schematic representations of these terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0026] The present invention uses the following steps to verify the effect of SPARCL1 on hair cell regeneration. For specific steps, see the attached Figure 1

[0027] Example 1 Expression of Sparcl1 in the cochlea of ​​wild-type mice at different ages

[0028] 1.1 RNA and total protein were extracted from the cochlea of ​​FVB wild-type mice at different ages, such as P0, P7, P14, P21, and P30. Real-time quantitative PCR (qPCR) and Western blotting were used to detect the expression of Sparcl1 at the RNA and protein levels in the inner ear of mice at different ages, such as P0, P7, P14, P21, and P30.

[0029] 1.1.1 qPCR experiments

[0030] (1) RNA extraction:

[0031] a) Prepare the necessary reagents and consumables: Trizol; chloroform; isopropanol; DEPC water; RNase-free pipette tips of different sizes; 1.5 mL RNase-free EP tubing

[0032] b) The procedure is as follows: Wild-type mouse cochleae of different ages were dissected under a microscope and placed in EP tubes. 1 ml of Trizol was added to each EP tube, followed by grinding using an automatic grinder with steel beads. 0.9 ml of the supernatant was then collected and placed in a new EP tube. A centrifuge was precooled to 4°C, 0.2 ml of chloroform was added to each EP tube, vortexed for 15 seconds, and allowed to stand at room temperature for 5 minutes. The centrifugation was then set to 12,000 rcf and centrifuged for 10 minutes. After centrifugation, the tube separated into three layers: the upper layer was colorless aqueous RNA, and the middle and lower layers were organic phenol-chloroform layers. The EP tubes were carefully removed. , vertically aspirate 0.4 ml of supernatant, add 0.4 ml of isopropanol, invert and mix ten times, and let stand at room temperature for 10 minutes; set the centrifugation conditions to 12000 rcf for 10 minutes; then discard the supernatant, add 75% ethanol prepared with DEPC water to each EP tube, and vortex to thoroughly rinse the white RNA precipitate at the bottom; set the centrifugation conditions to 7500 rcf for 5 minutes, remove and discard the supernatant, turn it upside down on filter paper and dry it for 15-20 minutes; then add 30 ul of DEPC water to dissolve the precipitate and use a spectrophotometer to measure the RNA concentration, and then use DEPC water to adjust the concentration to 2 ng / ul.

[0033] (2) Reverse transcription PCR: Reverse transcription PCR was performed on the extracted and leveled RNA using a reverse transcription kit (RevertAid First Strand cDNA Synthesis Kit, thermo, K1622).

[0034] (3) Real-time quantitative PCR (qPCR): Dilute the cDNA obtained by reverse transcription in the previous step ten-fold with RNase-free water and set up the system as follows, with three replicates per group to ensure reproducibility:

[0035] 2×ChamQ SYBR qPCR Master Mix 10.0 μl Primer 1(10 μM) 0.4 μl Primer 2(10 μM) 0.4 μl 50×ROX Reference Dye 1 0.4 μl Template DNA / cDNA 2.0 μl ddH2O To 20.0 μl

[0036] The qPCR primer sequences are as follows:

[0037] sparcl1-Q-F GCAGACAACCAAGAGGCCAA sparcl1-Q-R GGTTTCCCTTGTGGATCGGT GAPDH-Q-F GGAGCCAAACGGGTCATCAT GAPDH-Q-R TCACGCCACATCTTTCCAGA

[0038] After configuring the qPCR system, the reaction was carried out using a Bio-Rad IQ5 Real-Time PCR instrument, and the corresponding Ct value data were subsequently analyzed (see Appendix Figure 2 ).

[0039] 1.1.2 Western Blot Experiment

[0040] (1) Protein extraction experiment:

[0041] a) Prepare the necessary reagents and consumables: Ripa protein lysis buffer; Cocktail protease inhibitor; sterilized 1.5ml EP tube

[0042] b) Specific procedures are as follows: Microscopically dissect three cochleae from different age groups, then add 0.2 ml of pre-prepared Ripa protein lysis buffer containing 1% cocktail, followed by grinding with steel beads in a grinder. Centrifuge at 12,000 rpm, 4°C, for 20 min. Carefully aspirate 0.15 ml of the supernatant, which is the desired protein.

[0043] (2) Protein concentration determination

[0044] The following assays were performed using the BCA protein concentration assay kit (enhanced) (Biyuntian; P0010S):

[0045] a) Add 0, 1, 2, 4, 8, 12, 16, and 20 μl of the standard to the standard wells of a 96-well plate, and add standard diluent to make up to 20 μl. This corresponds to a standard concentration of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / ml, respectively.

[0046] b) Add an appropriate volume of sample to each well of a 96-well plate. If the sample volume is less than 20 μl, add standard diluent to make up to 20 μl. Be sure to record the sample volume.

[0047] c) Add 200 μl of BCA working solution to each well and incubate at 37°C for 20-30 minutes.

[0048] Note: Alternatively, incubate at room temperature for 2 hours or at 60°C for 30 minutes. When measuring protein concentration using the BCA assay, the color will deepen over time. Furthermore, the color development reaction accelerates with increasing temperature. For lower concentrations, incubate at a higher temperature or extend the incubation time appropriately.

[0049] d) Measure A562 or absorbance at wavelengths between 540 and 595 nm using a microplate reader.

[0050] e) Calculate the protein concentration of the sample based on the standard curve and the sample volume used.

[0051] f) Adjust the protein concentration using the previously prepared protein lysis buffer, then add 5x SDS. Boil in a metal bath at 100°C for 7 minutes before electrophoresis.

[0052] (3) Immunoblotting experiments

[0053] a) Gel preparation: Use a 12.5% ​​PAGE gel rapid preparation kit (Yazyme; PG113) to prepare 12.5% ​​SDS-PAGE stacking gel and separating gel:

[0054] 1. Take equal volumes of lower gel solution and lower gel buffer, 2.0 mL each, mix well, add 40 μL of the improved coagulant, vortex well, and inject into the glass plate for making gel, so that the distance between the liquid surface and the upper edge of the short glass plate is 0.5 cm longer than the comb teeth. Add appropriate amount of water to cover the lower gel, wait for 30 minutes for solidification, and discard the upper water.

[0055] 2. Take equal volumes of 0.5 mL each of the upper gel solution and the colored upper gel buffer, mix well, add 10 μL of the modified coagulant, inject the mixed solution into the glass plate, and insert the comb teeth;

[0056] 3. After waiting for 15 minutes, the upper layer of gel solidifies and the comb teeth are removed for electrophoresis.

[0057] b) Electrophoresis:

[0058] 1. Place the solidified gel plate into the electrophoresis tank and add sufficient 1x Running buffer;

[0059] 2. Vortex the cooked protein sample to mix thoroughly, centrifuge briefly, and add 10 μL of molecular weight protein standard sample and 15 μL of protein sample to the sample wells respectively;

[0060] 3. Set electrophoresis conditions: constant voltage 80V, 30 minutes; then 100V, 60 minutes

[0061] c) Transfer:

[0062] 1. Cut the PVDF membrane of the corresponding size according to the target band and waking it with methanol for 10 minutes;

[0063] 2. After electrophoresis, use a gel opener to pry open the glass plate, cut the separation gel, and place it in transfer buffer;

[0064] 3. Use the sandwich method: positive electrode (white) - sponge pad - three layers of filter paper - PVDF membrane - separation gel - three layers of filter paper - sponge pad - negative electrode (black). The entire process is performed in the transfer solution, gently rolling each layer to remove bubbles.

[0065] 4. Set the transfer conditions: constant current 280mA, 60 minutes. Since the transfer process generates heat, the transfer tank needs to be placed in a low temperature environment.

[0066] d) Closure:

[0067] 1. After transfer, remove the corresponding PVDF membrane and stain the membrane with Ponceau red for 2-3 minutes. When obvious protein bands appear on the membrane, cut out the corresponding target protein bands and then rinse with distilled water 2-3 times to remove the Ponceau red.

[0068] 2. Place the membrane in the pre-prepared blocking solution (2.5g skim milk powder + 50ml 1xTBST) and block it on a shaker at room temperature for 1 hour.

[0069] f) Immune response:

[0070] 1. Use 1xTBST to slowly wash away the surface blocking solution;

[0071] 2. Prepare the primary antibody (5 μl Sparcl1 primary antibody + 10 ml 1xTBST; 5 μl Gapdh primary antibody + 10 ml 1xTBST), add it to the incubation box, allow the membrane to be gently shaken on a shaker in the box, and incubate at 4°C overnight.

[0072] 3. Recover the primary antibody and wash the membrane three times with 1xTBST for 7 minutes each time. Then incubate with the secondary antibody at room temperature for 60 minutes. Recover the secondary antibody and wash the membrane three times with 1xTBST for 7 minutes each time. Immerse the membrane in 1xTBST solution for the next step.

[0073] g) Color reaction

[0074] 1. Turn on the Tanon5200 fully automatic luminescence imaging analysis system and pre-cool the machine for 20 minutes;

[0075] 2. Mix the luminescent solution A and solution B in a ratio of 1:1, spread the solution evenly on the membrane with a pipette, and expose and take pictures.

[0076] The results showed that the corresponding mRNA and protein levels of Sparcl1 reached the highest level at P0-P7 and then decreased.

[0077] Example 2 Sparcl1 promotes hair cell proliferation in vitro

[0078] 2.1 Inner ear stem cells were cultured in 3D in vitro, and AAV-ie viruses overexpressing Sparcl1 and Control were added. Samples were collected on the tenth day of proliferation and treated with EdU for 60 minutes before sampling. Proliferation indicators were further characterized by counting the number and diameter of stem cell spheres and observing the EdU labeling by immunofluorescence. Data and image processing and analysis were performed using Image J, Prism8, and ZEN software.

[0079] 2.1.1 Virus packaging and purification

[0080] (1) pAAV-ie-Sparcl1, pAAV-helper and pAAV-ie plasmids were co-transfected into HEK293T cells; wherein the nucleotide sequence of the biological factor Sparcl1 encoded by pAAV-ie-Sparcl1 is shown in SEQ NO.2.

[0081] a) Thaw HEK293T cells and passage them for 3-4 generations before transfection. Virus packaging can be performed only if at least eight 15 cm culture dishes are sufficient.

[0082] b) Prepare the transfection solution A and solution B as follows:

[0083] A B DMEM 471 μL DMEM 413 μL pAAV-ie-Sparcl1(1 ng / μL) 7 μL PEI 87 μL pAAV-helper(1 ng / μL) 14 μL pAAV-ie(1 ng / μL) 9 μL Total [[ID= forty-two]]500 μL Total

[0084] Slowly add solution B drop by drop into solution A, mix gently and let it stand for 20 minutes, adding 1 ml to each plate.

[0085] c) 12 hours after transfection, replace the culture medium with DMEM containing 1% FBS1. 48 hours after transfection, collect the supernatant from the culture dish and replace it with fresh DMEM containing 1% FBS. 96 hours after transfection, collect the supernatant and cells together.

[0086] (2) Virus purification

[0087] a) Centrifuge the collected 48-hour and 96-hour supernatants and cells at 11,000 rcf for 7 minutes. Divide the final cell pellets equally into three centrifuge tubes, and pour the supernatant into a bottle for storage;

[0088] b) Resuspend the cell pellet in each tube to 27 ml using a small amount of supernatant. Then, add 3.5 ml of chloroform to each tube to lyse the cells. Incubate the tube at 37°C, 220 rcf in a shaker for 1.5 hours to ensure that the cells are fully lysed.

[0089] c) After lysis, centrifuge at 11,000 rcf for 22 minutes, carefully pipette the supernatant into the supernatant stored in step 1, and measure the volume.

[0090] d) After calculating the total supernatant volume, add PEG8000 and NaCl powder, mix thoroughly, and incubate at 4°C overnight;

[0091] PEG 8000 dosage (g) = supernatant volume (ml) ÷ 10

[0092] NaCl dosage (g) = total supernatant volume (ml) ÷ 1000 × 58.4

[0093] e) Remove the supernatant from the previous day and centrifuge several times to collect the precipitate in a 2 ml EP tube at 12000 rcf for 22 minutes;

[0094] f) Add the enzymatic hydrolysate to the collected precipitate and place in a 37°C water bath for 2 hours, stirring constantly until the precipitate is dispersed;

[0095] g) Add an equal volume of chloroform to the enzymatic solution and centrifuge at 12,000 rcf for 7 minutes. Carefully pipette the supernatant into a 1.5 ml EP tube. Add an equal volume of the precipitate containing PEG8000 and f68 to each tube and incubate at 4°C overnight.

[0096] h) Remove the virus solution treated the previous day and centrifuge it several times to collect the precipitate in a 1.5 ml EP tube at 12,000 rcf for 7 minutes. Then, pool the precipitate in one tube.

[0097] i) Add 15-25 μL of enzymatic hydrolysis solution to the collected precipitate and mix thoroughly by pipetting until the precipitate is dissolved. Then add an equal volume of chloroform and centrifuge at 12,000 rcf for 7 minutes. Aspirate the supernatant, which is the AAV solution.

[0098] (3) Virus titer determination

[0099] a) Prepare the PCR system as follows:

[0100] 500 μL AAV solution <![CDATA[DNase I Buffer with MgCl2]]> 1 μL 1 μL DNase I <![CDATA[ddH2O]]> 1 μL 7 μL Total

[0101] PCR program 1: 37°C, 20 min; 95°C, 10 min.

[0102] After the completion, 10 μl Lysis and 2 μl Proteinase K were added.

[0103] PCR program 2: 55°C, 30 min; 95°C, 10 min;

[0104] The AAV lysate was obtained and diluted 100-fold before qPCR experiments.

[0105] b) Prepare the qPCR system as follows:

[0106] 10 μL AAV lysis dilution 2 μL SYBR 10 μL ROX Dye 2 0.4 μL WPRE-F 0.5 μL WPRE-R <![CDATA[ddH2O]]> 0.5 μL [[ID= sixty-three]]6.6 μL Total

[0107] After qPCR detection, the CT value obtained was analyzed and the corresponding virus titer was calculated.

[0108] 2.1.2 3D stem cell culture

[0109] The basement membrane of P1 newborn mice was dissected under a microscope and digested with 0.25% trypsin at 37°C for 6 minutes. DMEM-F12 was then added to terminate the digestion. The tissue was pipetted 200 times with a 200μL pipette tip, and the undigested tissue was filtered out. The centrifugation condition was set to 2500rcf for 3 minutes. The tissue was resuspended in DMEM-F12 and 30% Matrigel was added. After mixing, the tissue was seeded into a 24-well dish with a round glass slide (for subsequent sample collection) for proliferation culture.

[0110] The conditions of the proliferation culture medium are as follows:

[0111] 20 μL DMEM / F12 N2 50 mL B27 500 uL 1000 uL EGF 10 uL IGF 25 uL FGF 20 uL VPA 120 uL Ampicillin 60 uL Note: In the translation, for the units like "uL" which is an abbreviation of microliter, it is usually better to use the full form "μL" in scientific texts for clarity. However, since you asked to preserve the original form, I left "uL" as it is. Also, for "forty-two" in the translation of , it should be "500 μL" as in the original text, this is just to show the incorrect form in the translation process for that specific ID.

[0112] 2.1.3 Immunofluorescence staining

[0113] (1) Primary antibody incubation

[0114] Stem cell spheres that had proliferated for 10 days were collected, fixed with 4% PFA at room temperature for 1 hour, and rinsed three times with PBS for 5 minutes each time. After blocking with Blocking medium (1 ml donkey serum + 9 ml 5 / 1000 Tritonx-100) at room temperature for 1 hour, the cell proliferation marker EdU was stained for one hour using the EdU Cell Proliferation Kit (thermo). After blocking for another hour, the supporting cell marker sox2 was added at a dilution of 1:200 in PBT (0.1 ml donkey serum + 990 ml 5 / 1000 Tritonx-100) and incubated overnight at 4°C.

[0115] (2) Secondary antibody incubation

[0116] Rinse with PBS three times, 5 minutes each time; then dilute the corresponding secondary antibody with PBT at 1:400 (DAPI at 1:1000), incubate at room temperature for 1 hour, rinse with PBS three times, 5 minutes each time, add DAKO, invert on the slide, and seal with nail polish; use a confocal microscope to collect images.

[0117] The results showed that the number and diameter of the spheroids in the Sparcl1 virus-treated group were higher than those in the control group, and immunofluorescence results showed that the number of EdU-labeled cells in the spheroids in the Sparcl1 virus-treated group was significantly higher than that in the control group.

[0118] Example 3 Sparcl1 promotes hair cell differentiation in vivo

[0119] 3.1 P1.5 newborn mice were injected through the round window with AAV-IE viruses overexpressing Sparcl1 and a control. The mice were harvested on day 7. Since this protein is secreted, exogenous recombinant human Sparcl1 protein was subsequently injected through the round window. Immunofluorescence was used to detect the hair cell marker Myosin7a. Data and image analysis were performed using Image J, Prism8, and ZEN software.

[0120] The results showed that the Sparcl1 virus-treated group had more ectopic hair cells than the control group, and the ectopic hair cell phenomenon was very obvious in mice injected with exogenous recombinant human Sparcl1 protein.

[0121] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention, and such changes and modifications fall within the scope of the invention as claimed.

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

Claims

1. Application of biological factor Sparcl 1 in the preparation of hearing repair medicine, characterized in that: The amino acid sequence of the biological factor Sparcl 1 is shown in SEQ NO.

1.

2. The use according to claim 1, characterized in that The drug dosage forms are tablets, capsules, liquid preparations, aerosols, injections, ointments, and granules.

3. The use of nucleic acid molecules in the preparation of hearing repair drugs, characterized in that: The nucleotide sequence of the nucleic acid molecule encoding the biological factor Sparcl 1 is shown in SEQ NO.

2.

4. The use of the recombinant plasmid in the preparation of hearing repair drugs, characterized in that: The recombinant plasmid integrates the nucleotide sequence encoding the biological factor Sparcl 1 according to claim 3.

5. A hearing repair drug, characterized in that: Comprising the nucleic acid molecule according to claim 3 or the recombinant plasmid according to claim 4.

Images