Compositions and methods for treating cancers with atypical BRAF mutations

Abstract

The present invention provides, among other things, methods, pharmaceutical compositions and kits for treating or ameliorating the effects of cancer in subjects carrying atypical BRAF mutations (i.e., non-V600E / K BRAF mutations), the methods, pharmaceutical compositions and kits comprising ERK inhibitors. Methods for identifying subjects with atypical BRAF mutation cancers who will benefit from a therapy comprising an ERK inhibitor are also provided.

Description

[0001] This application is a divisional application of the Chinese patent application with application number 201880040655.8.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 506,995, filed May 16, 2017, the entire contents of which are incorporated herein by reference.

[0004] Public domain

[0005] The present disclosure relates to methods, kits, and pharmaceutical compositions for treating or ameliorating the effects of cancers having atypical genetic mutations using one or more anti-cancer agents.

[0006] Incorporation by Reference into the Sequence Listing

[0007] This application contains references to amino acid and / or nucleic acid sequences that have been concurrently submitted as a sequence listing text file "2391211.txt" with a file size of 246 KB, created on May 15, 2018. The above sequence listing is incorporated herein by reference in its entirety pursuant to 37 CFR §1.52(e)(5). Background of the Invention

[0008] Mitogen-activated protein kinase (MAPK) or RAS / RAF / MEK / ERK signaling is responsible for several cell signaling pathways involved in controlling proliferation, differentiation, and apoptosis. MAPK cell signaling pathways have been found to be disrupted in human cancers, usually due to activating mutations in KRAS, NRAS, or BRAF genes. Selective BRAF inhibitors, such as vemurafenib and dabrafenib, have been developed to target BRAF mutant tumors. For example, vemurafenib is approved for unresectable or metastatic melanoma with BRAF V600E mutations, and detection of BRAF V600E mutations has become the standard of care for predicting responses to vemurafenib, dabrafenib, and trametinib treatment.

[0009] Although the V600E mutation is the most common BRAF mutation observed in many tumor types, the Catalog of Somatic Mutations in Cancer (COSMIC) database has reported more than 100 other mutations within exons 11 and 15 of the BRAF gene. The clinical significance of BRAF mutations outside the V600 codon is largely unknown.

[0010] In view of the foregoing, there is a need for novel therapeutic agents that will target the MAPK pathway in cell types carrying BRAF mutations other than V600E. The present application is intended to meet these and other needs. Summary of the invention

[0011] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject having a non-V600E / K BRAF mutation, the method comprising administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.

[0012] According to some embodiments, the ERK inhibitor is selected from BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.

[0013] According to some embodiments, the ERK inhibitor is BVD-523.

[0014] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-impairing mutation, or a kinase-unknown mutation, and combinations thereof.

[0015] According to some embodiments, the kinase activating mutation is selected from R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.

[0016] According to some embodiments, the kinase-impairing mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.

[0017] According to some embodiments, the kinase unknown mutation is selected from T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.

[0018] According to some embodiments, the non-V600E / K BRAF mutation is selected from D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 splice variant, and combinations thereof.

[0019] According to some embodiments, the subject is a mammal.

[0020] According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0021] According to some embodiments, the mammal is a human.

[0022] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.

[0023] According to some embodiments, the cancer is selected from glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.

[0024] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.

[0025] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.

[0026] According to some embodiments, the MEK inhibitor is selected from anthrax toxin, anthraquinone (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) binimetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentamapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxonaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.)、R0092210(Roche)、R04987655(Hoffmann-La Roche)、R05126766(Hoffmann-La Roche)、selumetinib(AZD6244)(AstraZeneca)、SL327(Sigma)、TAK-733(Takeda)、trametinib(Japan Tobacco)、U0126(1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene)(Sigma)、WX-554(Wilex)、YopJ polypeptide(Mittal et al., 2010)、pharmaceutically acceptable salts thereof and combinations thereof. .

[0027] According to some embodiments, the RAF inhibitor is selected from AAL881 (Novartis), AB-024 (AmbitBiosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Novartis) , pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer HealthcarePharmaceuticals,Inc.)、RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. .

[0028] According to some embodiments, the HDAC inhibitor is selected from Abexinostat (PCI-24781), Givinostat, Entinostat, Vorinostat, CI-994, CUDC-101, Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0029] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulatory agent, a photoactivated therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.

[0030] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), ado-trastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab (Alemtuzumab), ab) atezolizumab (Tecentriq), avelumab (Bavencio), durvalumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva), panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.

[0031] According to some embodiments, the cytotoxic agent is selected from cyclophosphamide, mechlorethamine, uracil nitrogen mustard, melphalan, mechlorethamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0032] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.

[0033] According to some embodiments, the radionuclide is selected from the group consisting of 1-125, At-211, Lu-177, Cu-67, 1-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.

[0034] According to some embodiments, the immunomodulator is selected from granulocyte colony stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and cell membrane components from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine monophosphate guanosine (CpG), immune checkpoint inhibitors and combinations thereof.

[0035] According to some embodiments, the radiosensitizer is selected from misonidazole, metronidazole, tirapramine, sodium trans-syringate, and combinations thereof.

[0036] According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclins, thromboxanes, starch cellulose, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atriopeptin, brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, growth hormone-releasing peptide, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental secretagogue, growth hormone, inhibin, insulin, somatomedin, atomedin), leptin, lipotropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostain, thrombopoietin, thyroid stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcifediol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.

[0037] According to some embodiments, the anti-angiogenic agent is selected from 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor 4, prolactin, SU5416, suramin, tacromonide, tegalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, zif-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0038] According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K / Akt pathway.

[0039] According to some embodiments, the inhibitor of the PI3K / Akt pathway is selected from A-674563 (CAS#552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxazol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxazol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Diego, CA), Francisco, CA), BML-257 (CAS#32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98 510-80-6, CCT128930(CAS#885499-61-6), CH5132799(CAS#1007207-67-1), CHR-4432(Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124(CAS#902779-59-3), GS-1101(CAL-101)(Gilead Sciences), GSK 690693(CAS#937174-76-0), H-89(CAS#127243-85-0), Honokiol, IC87114(Gilead Science), IPI-145 (Intellikine Inc.)、KAR-4139(Karus Therapeutics, Chilworth, UK)、KAR-4141(Karus Therapeutics)、KIN-1(Karus Therapeutics)、KT 5720(CAS#108068-98-0)、Miltefosine、MK-2206 dihydrochloride(CAS#1032350-13-2)、ML-9(CAS#105637-50-1)、naltrexone hydrochloride、OXY-111A(NormOxys Inc.,Brighton,MA)、perifosine、PHT-427(CAS#1191951-57-1)、PI3 kinase delta inhibitors,Merck KGaA(Merck & Co.,Whitehouse Station,NJ)、PI3 kinase delta inhibitors,Genentech(Roche Holdings Inc.)、PI3 kinase delta inhibitors,Incozen(Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor 2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.)、PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor, Evotec (Evotec), PI3-γ inhibitor, Cellzome (Cellzome AG), PI3-γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), Triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

[0040] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, comprising: (a) identifying a subject with cancer carrying a non-V600E / K BRAF mutation; and (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.

[0041] According to some embodiments, the ERK inhibitor is selected from BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.

[0042] According to some embodiments, the ERK inhibitor is BVD-523.

[0043] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-impairing mutation, or a kinase-unknown mutation, and combinations thereof.

[0044] According to some embodiments, the kinase activating mutation is selected from R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.

[0045] According to some embodiments, the kinase-impairing mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.

[0046] According to some embodiments, the kinase unknown mutation is selected from T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.

[0047] According to some embodiments, the subject is a mammal.

[0048] According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0049] According to some embodiments, the mammal is a human.

[0050] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.

[0051] According to some embodiments, the cancer is selected from glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.

[0052] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.

[0053] According to some embodiments, the method further comprises: (i) obtaining a biological sample from the subject; and (ii) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation.

[0054] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.

[0055] According to some embodiments, the MEK inhibitor is selected from anthrax toxin, anthraquinone (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) bemetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxonaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), refametinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.)、R0092210(Roche)、R04987655(Hoffmann-La Roche)、R05126766(Hoffmann-La Roche)、selumetinib(AZD6244)(AstraZeneca)、SL327(Sigma)、TAK-733(Takeda)、trametinib(Japan Tobacco)、U0126(1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene)(Sigma)、WX-554(Wilex)、YopJ polypeptide(Mittal et al., 2010)、pharmaceutically acceptable salts thereof and combinations thereof. .

[0056] According to some embodiments, the RAF inhibitor is selected from AAL881 (Novartis), AB-024 (AmbitBiosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Nova rtis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.)、RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. .

[0057] According to some embodiments, the HDAC inhibitor is selected from Abenostat (PCI-24781), Ginotinostat, Entinostat, Fulinostat, CI-994, CUDC-101, Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0058] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from an antibody or fragment thereof, a cytotoxic agent, a toxin, a radionuclide, an immunomodulatory agent, a photoactivated therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and combinations thereof.

[0059] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla) cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab tiuxetan (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), avelumab (Bavencio), duluvazumab (Imfinzi), B-701, ofatumumab, atezolizumab (Gazyva) panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.

[0060] According to some embodiments, the cytotoxic agent is selected from cyclophosphamide, mechlorethamine, uracil nitrogen mustard, melphalan, mechlorethamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0061] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.

[0062] According to some embodiments, the radionuclide is selected from the group consisting of 1-125, At-211, Lu-177, Cu-67, 1-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.

[0063] According to some embodiments, the immunomodulator is selected from granulocyte colony stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and cell membrane components from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine monophosphate guanosine (CpG), immune checkpoint inhibitors and combinations thereof.

[0064] According to some embodiments, the radiosensitizer is selected from misonidazole, metronidazole, tirapramine, sodium trans-syringate, and combinations thereof.

[0065] According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclins, thromboxanes, starch cellulose, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atrial peptide, brain natriuretic peptide, calcitonin, cholecystokinin, adrenocorticotropic hormone releasing hormone, enkephalin, endothelin, erythropoietin, follicle stimulating hormone, galanin, gastrin, growth hormone releasing peptide, glucagon, gonadotropin releasing hormone, growth hormone releasing hormone, human chorionic gonadotropin, human placental secretagogue, growth hormone, inhibin, insulin, growth regulator The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids.

[0066] According to some embodiments, the anti-angiogenic agent is selected from 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor 4, prolactin, SU5416, suramin, tacromonide, tegalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, zif-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0067] According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K / Akt pathway.

[0068] According to some embodiments, the inhibitor of the PI3K / Akt pathway is selected from A-674563 (CAS#552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxazol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxazol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Diego, CA), Francisco, CA), BML-257 (CAS#32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98 510-80-6, CCT128930(CAS#885499-61-6), CH5132799(CAS#1007207-67-1), CHR-4432(Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124(CAS#902779-59-3), GS-1101(CAL-101)(Gilead Sciences), GSK 690693(CAS#937174-76-0), H-89(CAS#127243-85-0), Honokiol, IC87114(Gilead Science), IPI-145 (Intellikine Inc.)、KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS#108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), naltrexone hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS#1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor 2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.)、PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor, Evotec (Evotec), PI3-γ inhibitor, Cellzome (Cellzome AG), PI3-γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

[0069] According to one aspect, the present disclosure provides a method for identifying a subject having cancer who will benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation,

[0070] wherein the presence of a non-V600E / K BRAF mutation confirms that the subject will benefit from therapy with an ERK inhibitor, or a pharmaceutically acceptable salt thereof.

[0071] According to some embodiments, the ERK inhibitor is selected from BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.

[0072] According to some embodiments, the ERK inhibitor is BVD-523.

[0073] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-impairing mutation, or a kinase-unknown mutation, and combinations thereof.

[0074] According to some embodiments, the kinase activating mutation is selected from R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.

[0075] According to some embodiments, the kinase-impairing mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.

[0076] According to some embodiments, the kinase unknown mutation is selected from T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.

[0077] According to some embodiments, the subject is a mammal.

[0078] According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0079] According to some embodiments, the mammal is a human.

[0080] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.

[0081] According to some embodiments, the cancer is selected from glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.

[0082] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.

[0083] According to some embodiments, the method further comprises administering an ERK inhibitor or a pharmaceutically acceptable salt thereof to a subject having a non-V600E / K BRAF mutation.

[0084] According to some embodiments, the method further comprises administering to the subject at least one additional therapeutic agent selected from a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.

[0085] According to some embodiments, the MEK inhibitor is selected from anthrax toxin, anthraquinone (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) bemetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxonaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), remetinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.)、R0092210(Roche)、R04987655(Hoffmann-La Roche)、R05126766(Hoffmann-La Roche)、selumetinib(AZD6244)(AstraZeneca)、SL327(Sigma)、TAK-733(Takeda)、trametinib(JapanTobacco)、U0126(1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene)(Sigma)、WX-554(Wilex)、YopJ polypeptide(Mittal et al., 2010)、pharmaceutically acceptable salts thereof and combinations thereof. .

[0086] According to some embodiments, the RAF inhibitor is selected from AAL881 (Novartis), AB-024 (AmbitBiosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Nova rtis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.)、RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. .

[0087] According to some embodiments, the HDAC inhibitor is selected from Abenostat (PCI-24781), Ginotinostat, Entinostat, Fulinostat, CI-994, CUDC-101, Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0088] According to some embodiments, the method further comprises administering to the subject having a non-V600E / K BRAF mutation at least one additional therapeutic agent selected from an antibody, an antibody fragment, an antibody conjugate, a cytotoxic agent, a toxin, a radionuclide, an immunomodulatory agent, a photoactivated therapeutic agent, a radiosensitizer, a hormone, an anti-angiogenic agent, and a combination thereof.

[0089] According to some embodiments, the antibody or fragment thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla) cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab tiuxetan (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), avelumab (Bavencio), duluvazumab (Imfinzi), B-701, ofatumumab, obinutuzumab (Gazyva) panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.

[0090] According to some embodiments, the cytotoxic agent is selected from cyclophosphamide, mechlorethamine, uracil nitrogen mustard, melphalan, mechlorethamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0091] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.

[0092] According to some embodiments, the radionuclide is selected from the group consisting of 1-125, At-211, Lu-177, Cu-67, 1-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.

[0093] According to some embodiments, the immunomodulator is selected from granulocyte colony stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and cell membrane components from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine monophosphate guanosine (CpG), immune checkpoint inhibitors and combinations thereof.

[0094] According to some embodiments, the radiosensitizer is selected from misonidazole, metronidazole, tirapramine, sodium trans-syringate, and combinations thereof.

[0095] According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclins, thromboxanes, starch cellulose, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atrial peptide, brain natriuretic peptide, calcitonin, cholecystokinin, adrenocorticotropic hormone releasing hormone, enkephalin, endothelin, erythropoietin, follicle stimulating hormone, galanin, gastrin, growth hormone releasing peptide, glucagon, gonadotropin releasing hormone, growth hormone releasing hormone, human chorionic gonadotropin, human placental secretagogue, growth hormone, inhibin, insulin, growth regulator The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids.

[0096] According to some embodiments, the anti-angiogenic agent is selected from 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor 4, prolactin, SU5416, suramin, tacromonide, tegalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, zif-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0097] According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K / Akt pathway.

[0098] According to some embodiments, the inhibitor of the PI3K / Akt pathway is selected from A-674563 (CAS#552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxazol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxazol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Diego, CA), Francisco, CA), BML-257 (CAS#32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98 510-80-6, CCT128930(CAS#885499-61-6), CH5132799(CAS#1007207-67-1), CHR-4432(Chroma Therapeutics, Ltd., Abingdon, UK), FPA 124(CAS#902779-59-3), GS-1101(CAL-101)(Gilead Sciences), GSK 690693(CAS#937174-76-0), H-89(CAS#127243-85-0), Honokiol, IC87114(Gilead Science), IPI-145 (Intellikine Inc.)、KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS#108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), naltrexone hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS#1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor 2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.)、PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor, Evotec (Evotec), PI3-γ inhibitor, Cellzome (Cellzome AG), PI3-γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

[0099] According to one aspect, the present disclosure provides a pharmaceutical composition for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.

[0100] According to some embodiments, the ERK inhibitor is selected from BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia), and combinations thereof.

[0101] According to some embodiments, the ERK inhibitor is BVD-523.

[0102] According to some embodiments, the non-V600E / K BRAF mutation is a kinase-activating mutation, a kinase-impairing mutation, or a kinase-unknown mutation, and combinations thereof.

[0103] According to some embodiments, the kinase activating mutation is selected from R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof.

[0104] According to some embodiments, the kinase-impairing mutation is selected from the group consisting of G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof.

[0105] According to some embodiments, the kinase unknown mutation is selected from T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q, and combinations thereof.

[0106] According to some embodiments, the subject is a mammal.

[0107] According to some embodiments, the mammal is selected from the group consisting of humans, primates, farm animals, and domestic animals.

[0108] According to some embodiments, the mammal is a human.

[0109] According to some embodiments, the cancer is a solid tumor cancer or a hematological cancer.

[0110] According to some embodiments, the cancer is selected from glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer, and gallbladder cancer.

[0111] According to some embodiments, the cancer is selected from the group consisting of small intestine cancer, non-small cell lung cancer, gallbladder cancer, and squamous cell carcinoma.

[0112] According to some embodiments, the composition is administered to the subject orally or by injection.

[0113] According to some embodiments, the composition is administered to the subject as a tablet.

[0114] According to some embodiments, the drug combination is at least one additional therapeutic agent selected from the group consisting of a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and combinations thereof.

[0115] According to some embodiments, the MEK inhibitor is selected from anthrax toxin, anthraquinone (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma) bemetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxonaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), PD318088 (Pfizer), PD334581 (Pfizer), 6-methoxy-7-(3-morpholin-4-yl-propoxy)-4-(4-phenoxy-phenylamino)-quinoline-3-carbonitrile, 4-[3-chloro-4-(1-methyl-1H-imidazol-2-ylsulfanyl)-phenylamino]-6-methoxy-7-(3-morpholin-4-yl-propoxy)-quinoline-3-carbonitrile, pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), remetinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.)、R0092210(Roche)、R04987655(Hoffmann-La Roche)、R05126766(Hoffmann-La Roche)、selumetinib(AZD6244)(AstraZeneca)、SL327(Sigma)、TAK-733(Takeda)、trametinib(JapanTobacco)、U0126(1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene)(Sigma)、WX-554(Wilex)、YopJ polypeptide(Mittal et al., 2010)、pharmaceutically acceptable salts thereof and combinations thereof. .

[0116] According to some embodiments, the RAF inhibitor is selected from AAL881 (Novartis), AB-024 (AmbitBiosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BeiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Nova rtis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedX Pharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.)、RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmithKline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof. .

[0117] According to some embodiments, the HDAC inhibitor is selected from Abenostat (PCI-24781), Ginotinostat, Entinostat, Fulinostat, CI-994, CUDC-101, Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0118] According to some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent selected from antibodies or fragments thereof, cytotoxic agents, toxins, radionuclides, immunomodulatory agents, photoactivated therapeutic agents, radiosensitizers, hormones, anti-angiogenic agents, and combinations thereof.

[0119] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla) cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab tiuxetan (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), avelumab (Bavencio), duluvazumab (Imfinzi), B-701, ofatumumab, atezolizumab (Gazyva) panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.

[0120] According to some embodiments, the cytotoxic agent is selected from cyclophosphamide, mechlorethamine, uracil nitrogen mustard, melphalan, mechlorethamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0121] According to some embodiments, the toxin is diphtheria toxin or a portion thereof.

[0122] According to some embodiments, the radionuclide is selected from the group consisting of 1-125, At-211, Lu-177, Cu-67, 1-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90, and combinations thereof.

[0123] According to some embodiments, the immunomodulator is selected from granulocyte colony stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and cell membrane components from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine monophosphate guanosine (CpG), immune checkpoint inhibitors and combinations thereof.

[0124] According to some embodiments, the radiosensitizer is selected from misonidazole, metronidazole, tirapramine, sodium trans-syringate, and combinations thereof.

[0125] According to some embodiments, the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclins, thromboxanes, starch cellulose, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atrial peptide, brain natriuretic peptide, calcitonin, cholecystokinin, adrenocorticotropic hormone releasing hormone, enkephalin, endothelin, erythropoietin, follicle stimulating hormone, galanin, gastrin, growth hormone releasing peptide, glucagon, gonadotropin releasing hormone, growth hormone releasing hormone, human chorionic gonadotropin, human placental secretagogue, growth hormone, inhibin, insulin, growth regulator The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids. The invention relates to steroids, steroids, and steroids.

[0126] According to some embodiments, the anti-angiogenic agent is selected from 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitory factor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor 4, prolactin, SU5416, suramin, tacromonide, tegalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, zif-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0127] According to some embodiments, the additional therapeutic agent is an inhibitor of the PI3K / Akt pathway.

[0128] According to some embodiments, the inhibitor of the PI3K / Akt pathway is selected from A-674563 (CAS#552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, CA), AS-041164 (5-benzo[1,3]dioxazol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxazol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Diego, CA), Francisco, CA), BML-257 (CAS#32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, CA), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98 510-80-6, CCT128930(CAS#885499-61-6), CH5132799(CAS#1007207-67-1), CHR-4432(Chroma Therapeutics, Ltd., Abingdon, UK), FPA124 (CAS#902779-59-3), GS-1101 (CAL-101) (Gilead Sciences), GSK 690693 (CAS#937174-76-0), H-89 (CAS#127243-85-0), Honokiol, IC87114 (Gilead Science), IPI-145 (Intellikine Inc.)、KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS#108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), naltrexone hydrochloride, OXY-111A (NormOxys Inc., Brighton, MA), perifosine, PHT-427 (CAS#1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor 2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.)、PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor, Evotec (Evotec), PI3-γ inhibitor, Cellzome (Cellzome AG), PI3-γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, CA), triciribine, X-339 (Xcovery, West Palm Beach, FL), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

[0129] According to some embodiments, the pharmaceutical composition is a unit dosage form comprising an ERK inhibitor and an additional therapeutic agent.

[0130] According to some embodiments, the pharmaceutical composition ERK inhibitor is in a first unit dosage form and the additional therapeutic agent is in a second unit dosage form separate from the first unit dosage form.

[0131] According to some embodiments, the ERK inhibitor and the additional therapeutic agent are co-administered to the subject.

[0132] According to some embodiments, the ERK inhibitor and the additional therapeutic agent are administered to the subject sequentially.

[0133] According to some embodiments, the ERK inhibitor is administered to the subject prior to or after administration of the additional therapeutic agent.

[0134] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the method comprising administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0135] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, comprising: (a) identifying a subject with cancer carrying a non-V600E / K BRAF mutation; and (b) administering to the subject an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0136] According to one aspect, the present disclosure provides a method for identifying a subject having cancer who will benefit from therapy with BVD-523 or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from the subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of the non-V600E / K BRAF mutation confirms that the subject will benefit from therapy with BVD-523 or a pharmaceutically acceptable salt thereof.

[0137] According to one aspect, the present disclosure provides a pharmaceutical composition for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the composition comprising a pharmaceutically acceptable carrier or diluent and an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof.

[0138] According to one aspect, the present disclosure provides a kit for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the kit comprising a pharmaceutical composition according to any one of claims 88, 103 and 107 and instructions for use thereof packaged together.

[0139] According to some embodiments, the RAF inhibitor is selected from erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof.

[0140] According to some embodiments, the RAF inhibitor is selected from LXH254 (Novartis), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), REDX0535 (RedX Pharma Plc), pharmaceutically acceptable salts thereof, and combinations thereof.

[0141] According to some embodiments, the HDAC inhibitor is selected from the group consisting of fulamistat, panobinostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0142] According to some embodiments, the antibody, fragment thereof, or conjugate thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), durvalumab (Imfinzi), ofatumumab, atezolizumab (Gazyva), panitumumab, and combinations thereof.

[0143] According to some embodiments, the inhibitor of the PI3K / Akt pathway is BVD-723.

[0144] BRIEF DESCRIPTION OF THE DRAWINGS

[0145] Figure 1 A schematic diagram of the mitogen-activated protein kinase (MAPK) pathway is shown.

[0146] Figure 2 Responses of patients treated with BVD-523 are shown. All patients with disease as measured by RECIST v1.1 who received one or more doses of study treatment and more than one on-treatment tumor assessment are included. Response was measured as the change from baseline in the sum of the longest diameters of each target lesion. The solid line indicates the threshold for partial response according to RECIST v1.1. Abbreviations: GBM, glioblastoma; NSCLC, non-small cell lung cancer; CRC, colorectal cancer. Atypical BRAF mutations associated with each patient's cancer are indicated.

[0147] Figure 3 The duration of treatment in a Swimmer's plot classified by group is shown. Members of the first group are any patients with any BRAF mutation in any tumor type except colorectal cancer (CRC) and non-small cell lung cancer (NSCLC) who have not previously received treatment with a MAPK pathway inhibitor. Members of group 2 are patients with any BRAF mutation in CRC who have not previously received treatment with a MAPK pathway inhibitor. Members of group 3 are patients with tumors with BRAF V600E / K mutations who are refractory to treatment with MAPK inhibitors. Members of group 6 are patients with any BRAF mutation present in NSCLC. Figure 3As shown, all 28 patients are represented by horizontal lines, one for each subject. The treatment duration for each subject in each group is illustrated from the top of the group (longest treatment duration) to the bottom (shortest treatment duration). The horizontal axis represents the duration (days) that the patient was in the study. Figure 3 Also shown is the type of response achieved for each patient according to RECIST v1.1 (diamonds = partial response; circles = stable disease; vertical lines = progressive disease; triangles = not evaluable).

[0148] Figure 4 Treatment duration in the swimmer plot disrupted by BRAF mutation is shown. All 28 patients measured according to RECIST v1.1 response criteria are included, as well as other patients not evaluated by RECIST v1.1 (diamonds = partial response; circles = stable disease; vertical bars = progressive disease; triangles = not evaluated). DETAILED DESCRIPTION OF THE INVENTION

[0149] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation, the method comprising administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.

[0150] As used herein, the term "V600E / K BRAF mutation", associated with cancer in a subject, and grammatical variations thereof, refers to a cancer cell comprising a non-synonymous substitution mutation in the gene encoding human BRAF (SEQ ID NO: 2), the non-synonymous substitution mutation resulting in the substitution of the amino acid valine (V) at amino acid position 600 of BRAF to glutamic acid (E) or lysine (K). As used herein, the term "carrying a non-V600E / K BRAF mutation", associated with cancer in a subject, and grammatical variations thereof, refers to a cancer cell comprising a somatic mutation that is not a V600E / K BRAF mutation. As used herein, all BRAF mutations are based on the human wild-type sequence (SEQ ID NO: 2). Orthologs from other species are also included herein.

[0151] As used herein, the terms "treat", "treating", "treatment" and grammatical variations thereof refer to subjecting an individual subject to a method, regimen, process or measure in which a physiological response or result is desired in a subject, such as a patient. In particular, the methods and compositions of the present invention can be used to slow the development of disease symptoms or delay the onset of a disease or condition, or to halt the progression of disease development. However, because each treated subject may not respond to a particular treatment method, regimen, process or measure, treatment need not achieve a desired physiological response or result in each or every subject or subject population, such as a patient population. Therefore, a given subject or subject population, such as a patient population, may not respond or respond insufficiently to treatment.

[0152] As used herein, the term "alleviate" and grammatical variations thereof refer to a reduction in the severity of disease symptoms in a subject.

[0153] As used herein, a "subject" is a mammal, preferably a human. In addition to humans, categories of mammals within the scope of the present invention include, for example, farm animals, domestic animals, laboratory animals, etc. Some examples of farm animals include cows, pigs, horses, goats, etc. Some examples of domestic animals include dogs, cats, etc. Some examples of laboratory animals include primates, rats, mice, rabbits, guinea pigs, etc.

[0154] As used herein, the term "effective amount" or "therapeutically effective amount" of a compound or composition disclosed herein is an amount of such compound or composition sufficient to achieve a beneficial or desired result as described herein when administered to a subject. Effective dosage forms, modes of administration, and dosages can be determined empirically, and such determinations are within the skill of the art. It will be appreciated by those skilled in the art that dosages will vary with route of administration, rate of excretion, duration of treatment, characteristics of any other drug administered, age, size, and species of mammals, such as human patients, and similar factors well known in the medical and veterinary fields. Typically, a suitable dose of a compound or composition according to the present invention will be such an amount of the composition that is the minimum dose that effectively produces the desired effect. The effective dose of a compound or composition of the present invention can be administered in two, three, four, five, six, or more sub-doses at appropriate intervals throughout the day.

[0155] According to some embodiments, the ERK inhibitor is selected from BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia) and combinations thereof. According to some embodiments, the ERK inhibitor is BVD-523.

[0156] In the present invention, BVD-523 is a compound according to formula (I):

[0157]

[0158] and pharmaceutically acceptable salts thereof. BVD-523 is an efficient, selective, reversible, ATP-competitive ERK1 / 2 inhibitor. BVD-523 can be synthesized according to the method disclosed in, for example, U.S. Patent No. 7,354,939, which is incorporated herein by reference. Enantiomers and racemic mixtures of the two enantiomers of BVD-523 are also included within the scope of the present invention. BVD-523 is an ERK1 / 2 inhibitor whose mechanism of action is considered to be unique and different from certain other ERK1 / 2 inhibitors such as SCH772984. For example, other ERK1 / 2 inhibitors (e.g., SCH772984) inhibit the autophosphorylation of ERK (Morris et al., 2013), while BVD-523 allows the autophosphorylation of ERK while still inhibiting ERK.

[0159] According to some embodiments, the subject's cancer has a somatic mutation in the BRAF gene. As used herein, "somatic mutation" refers to a change that occurs in any cell that is not destined to become a germ cell. The mutation can be, for example, a substitution, deletion, insertion, or fusion. Table 1 below shows an overview of the distribution of BRAF mutations, as shown in the Sanger database.

[0160] Table 1

[0161]

[0162] BRAF mutations are found in approximately 66% of melanomas (Davies et al., 2002; Brose et al., 2002; Hocket et al., 2007), and in relatively lower percentages in other cancers, 36% of thyroid tumors and 10% of colon cancers (Xu et al., 2003; Fransen et al., 2004). The most common BRAF mutation occurs at amino acid 600 of the human wild-type protein kinase (SEQ ID NO: 2), and the mutant B-RafV600E is generated by replacing valine with glutamic acid, which accounts for approximately 80% of BRAF mutations (Davies et al., 2002; Hocker et al., 2007). The B-RafV600E kinase domain has 500-fold higher kinase activity compared to the basal activity of wild-type B-Raf (Wan et al., 2004). Among other BRAF mutations identified in melanoma, V600K and V600D / R are also common and represent 16% and 3% of all BRAF mutations, respectively (Long et al., 2011). In addition to melanoma, BRAF mutations are also common in many other cancers, including papillary thyroid cancer, ovarian cancer, and colorectal cancer. (Wellbrock et al., 2004). In one study, BRAF splice variants (splicing exons 14 and 15) were found in 5 / 24 (21%) colorectal cancer cell lines (Seth et al., 2009).

[0163] Table 2 below from the Sanger database shows the distribution and frequency of BRAF mutations in human tumors.

[0164] Table 2

[0165]

[0166]

[0167] Table 3 below shows selected nucleic acid and amino acid sequences of BRAF. These sequences can be used in methods of identifying subjects with a mutant BRAF genotype (eg, in the methods set forth below).

[0168] Table 3

[0169]

[0170]

[0171] Methods for identifying mutations in nucleic acids such as the BRAF gene identified above are known in the art. Nucleic acids can be obtained from biological samples. In the present invention, biological samples include, but are not limited to, blood, plasma, urine, skin, saliva, and biopsy samples. Biological samples are obtained from subjects by conventional procedures and methods known in the art.

[0172] Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybridization capture, in-solution capture, molecular inversion probes, fluorescence in situ hybridization (FISH) assays, and combinations thereof.

[0173] Various sequencing methods are known in the art. These include but are not limited to Sanger sequencing (also referred to as dideoxy sequencing) and various synthetic sequencing (SBS) methods disclosed in, for example, Metzker 2005, sequencing by hybridization, sequencing by connection (e.g., WO2005021786), sequencing by degradation (e.g., U.S. Patent No. 5,622,824 and 6,140,053) and nanopore sequencing (which can be commercially available from Oxford Nanopore Technologies, UK). In deep sequencing technology, a given nucleotide in a sequence is repeatedly read during sequencing. Deep sequencing technology is disclosed in, for example, U.S. Patent Publication No. 20120264632 and International Patent Publication No. WO2012125848.

[0174] PCR-based methods for detecting mutations are known in the art and employ PCR amplification, wherein each target sequence in a sample has a corresponding pair of unique, sequence-specific primers. For example, the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method allows rapid detection of mutations after amplification of genomic sequences by PCR. The mutations are distinguished by digestion with specific restriction endonucleases and identified by electrophoresis. See, e.g., Ota et al., 2007. Real-time PCR can also be used to detect mutations. See, e.g., International Application Publication No. WO2012046981.

[0175] Hybridization capture methods are known in the art and are disclosed in, for example, U.S. Patent Publication No. 20130203632 and U.S. Patent Nos. 8389219 and 8288520. These methods are based on the selective hybridization of user-designed oligonucleotides to target genomic regions. Hybridization can be with oligonucleotides immobilized on high-density or low-density microarrays (array capture), or with solution-phase hybridization of oligonucleotides modified with ligands (e.g., biotin), which can then be immobilized on a solid surface such as beads (capture in solution).

[0176] The molecular inversion probe (MIP) method is known in the art and is disclosed, for example, in Absalan et al., 2008. Such methods use MIP molecules, which are special "padlock" probes (Nilsson et al., 1994) for genotyping. MIP molecules are linear oligonucleotides containing specific regions, universal sequences, restriction sites and Tag (index) sequences (16-22 bp). In this method, the MIP is directly hybridized around the target genetic marker / SNP. The MIP method can also use a number of "padlock" probe sets that are hybridized in parallel with genomic DNA (Hardenbol et al., 2003). In the case of a perfect match, the genomic homologous regions are connected by performing a configuration inversion (as the technical name implies) and creating a circular molecule. After the first restriction enzyme digestion, all molecules are amplified with universal primers. The amplicon is restricted again to ensure short fragments for hybridization on the microarray. The short fragments produced are labeled and hybridized with the cTag (complementary strand of the index) on the array through the Tag sequence. After the Tag-cTag duplex is formed, the signal is detected.

[0177] According to some embodiments, non-V600E / K BRAF mutations are kinase-activating mutations, kinase-impaired mutations, kinase-unknown mutations, and combinations thereof. As used herein, the term "kinase-activating mutation" and its grammatical variations refer to an increase in the kinase activity of the kinase that causes the mutation relative to the wild-type kinase. As used herein, the term "kinase-impaired mutation" and its grammatical variations refer to a decrease in the kinase activity of the kinase that causes the mutation relative to the wild-type kinase. As used herein, the term "kinase-unknown mutation" and its grammatical variations refer to an unknown activity of the mutant kinase or an activity of the kinase that is approximately equal to the kinase activity of the wild-type kinase. (See Zheng, G. et al., Clinical detection and categorization of uncommon and concomitant mutations involving BRAF, BMC Cancer, (2015) 15: 779, incorporated herein by reference in its entirety)

[0178] According to some embodiments, the BRAF kinase activating mutation is selected from R462I, I463S, G464E, G464R, G464V, G466A, G469A, N581S, E586K, F595L, L597Q, L597R, L597S, L597V, A598V, T599E, V600R, K601E, S602D, A728V, and combinations thereof. According to some embodiments, the BRAF kinase impairing mutation is selected from G466E, G466R, G466V, Y472C, K483M, D594A, D594E, D594G, D594H, D594N, D594V, G596R, T599A, S602A, and combinations thereof. According to some embodiments, the unknown mutation of BRAF kinase is selected from T440I, S467L, G469E, G469R, G469S, G469V, L584F, L588F, V600_K601delinsE, S605I, Q609L, E611Q and combinations thereof. As used herein, all BRAF mutations are based on the human wild-type sequence (SEQ ID NO: 2). Orthologs from other species are also included herein.

[0179] In the present invention, the methods and compositions for treating non-V600E / K BRAF mutations are effective for disease states carrying single mutations and one or more mutations. In fact, any single mutation or any combination of mutations disclosed herein (or identified below) can be treated with a composition or method according to the present invention (e.g., any combination of non-V600E / K mutations or any combination of non-V600E / K mutations and V600E / K mutations).

[0180] According to some embodiments, the non-V600E / K BRAF mutation is selected from D594, G469, K601E, L597, T599 duplication, L485W, F247L, G466V, BRAF fusion, BRAF-AGAP3 rearrangement, BRAF exon 15 splice variant, and combinations thereof.

[0181] As used herein, the annotation of amino acid substitution mutations includes the following closed form: wild-type amino acid; position; substituted amino acid (e.g., K601E). As used herein, the annotation of amino acid substitutions also includes the following open form: wild-type amino acid; position (e.g., G469). As used herein, open annotations include substitutions of any amino acid. For example, the G469 mutation reveals that the glycine at position 469 is replaced by any of the amino acids A, R, N, D, C, Q, E, H, I, L, K, M, F, P, S, T, W, Y, and V. Also as used herein, closed annotations include substitutions by any amino acid, and preferably by the substituted amino acid. For example, the K601E mutation reveals that the lysine at position 601 is replaced by amino acids A, R, N, D, C, Q, E, G, H, I, L, M, F, P, S, T, W, Y, and V, and more preferably by amino acid E. The use of closed annotations used herein should not be construed as limiting the disclosure to specifically described amino acid substitutions.

[0182] According to some embodiments, the subject comprising a cancer carrying a non-V600E / K BRAF mutation is a mammal. According to some embodiments, the mammal is selected from humans, primates, farm animals, and domestic animals. According to some embodiments, the mammal is a human.

[0183] According to some aspects, the present disclosure provides solid cancers and hematological cancers. Non-limiting examples of solid cancers include adrenocortical carcinoma, anal cancer, bladder cancer, bone cancer (e.g., osteosarcoma), brain cancer, breast cancer, carcinoid, carcinoma, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, extrahepatic bile duct cancer, Ewing family cancer, extracranial germ cell cancer, eye cancer, gallbladder cancer, gastric cancer, germ cell tumor, gestational trophoblastic tumor, head and neck cancer, hypopharyngeal cancer, islet cell carcinoma, kidney cancer, colorectal cancer, laryngeal cancer, leukemia, lip and oral cancer, liver tumor / cancer, lung tumor / cancer, lymphoma, malignant mesothelioma, Merkel cell carcinoma, mycosis fungoides, myelodysplastic syndrome syndrome, myeloproliferative disorders, nasopharyngeal carcinoma, neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell cancer, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pituitary cancer, plasma cell tumors, prostate cancer, rhabdomyosarcoma, rectal cancer, renal cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter, salivary gland cancer, Say's syndrome, skin cancer (such as cutaneous T-cell lymphoma, Kaposi's sarcoma, mast cell tumor, and melanoma), small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.

[0184] Examples of hematological cancers include, but are not limited to, leukemias such as adult / childhood acute lymphocytic leukemia, adult / childhood acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, and hairy cell leukemia, lymphomas such as AIDS-related lymphoma, cutaneous T-cell lymphoma, adult / childhood Hodgkin lymphoma, mycosis fungoides, adult / childhood non-Hodgkin lymphoma, primary central nervous system lymphoma, Sayre's syndrome, cutaneous T-cell lymphoma, and Waldenstrom's macroglobulinemia, and other proliferative disorders such as chronic myeloproliferative disease, Langerhans cell histiocytosis, multiple myeloma / plasmacytoma, myelodysplastic syndrome, and myelodysplastic / myeloproliferative neoplasms.

[0185] According to some embodiments, the subject's cancer is selected from glioblastoma, melanoma, cholangiocarcinoma, small cell lung cancer, colorectal cancer, prostate cancer, vaginal cancer, angiosarcoma, non-small cell lung cancer, appendix cancer, squamous cell carcinoma, salivary duct carcinoma, adenoid cystic carcinoma, small intestine cancer and gallbladder cancer. Preferably, the cancer is selected from small intestine cancer, non-small cell lung cancer, gallbladder cancer and squamous cell carcinoma.

[0186] According to some aspects, the present disclosure provides administering to a subject at least one additional mitogen-activated protein kinase (MAPK) pathway inhibitor. According to some embodiments, the at least one additional therapeutic agent is selected from a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, an ERK inhibitor, and combinations thereof.

[0187] As used herein, a "mitogen-activated protein kinase (MAPK) pathway inhibitor" is any substance that modulates, for example, decreases, the activity, expression, or phosphorylation of a protein in the MAPK pathway, thereby resulting in decreased cell growth or increased cell death.

[0188] An overview of the mammalian MAPK cascade is given in Figure 1 Details on the MAPK pathway are reviewed in, for example, Akinleye et al., 2013. In brief, Figure 1 The ERK1 / 2 module in (light purple box), the MAPK 1 / 2 signaling cascade is activated by ligand binding to receptor tyrosine kinases (RTKs). Activated receptors recruit and phosphorylate the adaptor proteins Grb2 and SOS, which then interact with and activate the membrane-bound GTPase Ras. Ras, in its activated GTP-bound form, recruits and activates Raf kinases (A-Raf, B-Raf, and C-Raf / RaF-1). Activated Raf kinases activate MAPK 1 / 2 (MKK1 / 2), which in turn catalyze the phosphorylation of threonine and tyrosine residues in the activation sequence Thr-Glu-Tyr of ERK1 / 2. For the JNK / p38 module ( Figure 1Yellow box in the figure), upstream kinases MAP3K (such as MEKK1 / 4, ASK1 / 2 and MLK1 / 2 / 3) activate MAP2K3 / 6 (MKK3 / 6), MAP2K4 (MKK4) and MAP2K7 (MKK7). These MAP2Ks then activate JNK protein kinases, including JNK1, JNK2 and JNK3, as well as p38α / β / γ / Δ. To perform its functions, JNK activates multiple transcription factors, including c-Jun, ATF-2, NF-ATc1, HSF-1 and STAT3. Regarding the ERK5 module ( Figure 1 The blue box in the figure), the kinases upstream of MAP2K5 (MKK5) are MEKK2 and MEKK3. The best characterized downstream target of MEK5 is ERK5, also known as big MAP kinase 1 (BMK1) because it is twice the size of other MAPKs.

[0189] Non-limiting examples of MAPK pathway inhibitors include RAS inhibitors, RAF inhibitors, MEK inhibitors, ERK1 / 2 inhibitors, pharmaceutically acceptable salts thereof, and combinations thereof.

[0190] As used herein, "RAS inhibitors" refer to those substances that (i) directly interact with RAS, for example, by binding to RAS and (ii) reduce the expression or activity of RAS. Non-limiting exemplary RAS inhibitors include, but are not limited to, farnesyl transferase inhibitors (e.g., tipifarnib and lonafarnib), small molecules containing farnesyl groups (e.g., salirasib and TLN-4601), DCAI disclosed by Maurer (Maurer et al., 2012), Kobe0065 and Kobe2602 disclosed by Shima (Shima et al., 2013), HBS 3 (Patgiri et al., 2011), and AIK-4 (Allinky).

[0191] As used herein, "RAF inhibitors" refers to those substances that (i) directly interact with RAF, such as by binding to RAF, and (ii) reduce the expression or activity of RAF, such as A-RAF, B-RAF, and C-RAF (Raf-1). Non-limiting exemplary RAF inhibitors include:

[0192]

[0193]

[0194]

[0195]

[0196]

[0197]

[0198] AAL881 (Novartis); AB-024 (Ambit Biosciences), ARQ-736 (ArQule), ARQ-761 (ArQule), AZ628 (Axon Medchem BV), BAY 43-9006 sorafenib, BaiGene-283 (BeiGene), BUB-024 (MLN 2480) (Sunesis & Takeda), b-raf inhibitor (Sareum), BRAF kinase inhibitor (Selexagen Therapeutics), BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg) (Liu et al., 2007), CHIR-265 (Novartis), CTT239065 (Institute of Cancer Research), dabrafenib (GSK2118436), DP-4978 (Deciphera Pharmaceuticals), HM-95573 (Hanmi), GDC-0879 (Genentech), GW-5074 (Sigma Aldrich), ISIS 5132 (Novartis), L779450 (Merck), LBT613 (Novartis), LXH254 (Novartis), LErafAON (NeoPharm, Inc.), LGX-818 (Nova rtis), pazopanib (GlaxoSmithKline), PLX3202 (Plexxikon), PLX4720 (Plexxikon), PLX5568 (Plexxikon), PLX3603 (Daiichi Sankyo), PLX8394 (Daiichi Sankyo), RAF-265 (Novartis), RAF-365 (Novartis), REDX0535 (RedXPharma Plc), regorafenib (Bayer Healthcare Pharmaceuticals, Inc.), RO 5126766 (Hoffmann-La Roche), SB-590885 (GlaxoSmithKline), SB699393 (GlaxoSmith Kline), sorafenib (Onyx Pharmaceuticals), TAK 632 (Takeda), TL-241 (Teligene), vemurafenib (RG7204 or PLX4032) (Daiichi Sankyo), XL-281 (Exelixis), ZM-336372 (AstraZeneca), pharmaceutically acceptable salts thereof, and combinations thereof.

[0199] According to some embodiments, RAF inhibitors include pan inhibitors; non-limiting examples of which include erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof.

[0200] As used herein, "MEK inhibitors" refers to those substances that (i) directly interact with MEK, such as by binding to MEK, and (ii) reduce the expression or activity of MEK. Therefore, inhibitors that act upstream of MEK, such as RAS inhibitors and RAF inhibitors, are not MEF inhibitors according to the present invention. Non-limiting examples of MEK inhibitors include anthrax toxin, anthraquinone (Golden Biotechnology), ARRY-142886 (6-(4-bromo-2-chloro-phenylamino)-7-fluoro-3-methyl-3H-benzimidazole-5-carboxylic acid (2-hydroxy-ethoxy)-amide) (Array BioPharma), ARRY-438162 (Array BioPharma), bemetinib (MEK162, ARRY-1662), AS-1940477 (Astellas), AS-703988 (Merck KGaA), bentapimod (Merck KGaA), BI-847325 (Boehringer Ingelheim), E-6201 (Eisai), GDC-0623 (Hoffmann-La Roche), GDC-0973 (cobimetinib) (Hoffmann-La Roche), L783277 (Merck), lethal factor portion of anthrax toxin, MEK162 (Array BioPharma), PD 098059 (2-(2'-amino-3'-methoxyphenyl)-oxonaphthalen-4-one) (Pfizer), PD 184352 (CI-1040) (Pfizer), PD-0325901 (Pfizer), pimasertib (Santhera Pharmaceuticals), RDEA119 (Ardea Biosciences / Bayer), remetinib (AstraZeneca), RG422 (Chugai Pharmaceutical Co.), R0092210 (Roche), R04987655 (Hoffmann-La Roche), R05126766 (Hoffmann-La Roche), selumetinib (AZD6244) (AstraZeneca), SL327 (Sigma), TAK-733 (Takeda), trametinib (Japan Tobacco), U0126 (1,4-diamino-2,3-dicyano-1,4-bis(2-aminophenylthio)butadiene) (Sigma), WX-554 (Wilex), YopJ polypeptide (Mittal et al., 2010), pharmaceutically acceptable salts thereof, and combinations thereof.

[0201] As used herein, "ERK1 / 2 inhibitors" refer to those substances that (i) directly interact with ERK1 and / or ERK2, for example by binding to ERK1 / 2, and (ii) reduce the expression or activity of ERK1 and / or ERK2 protein kinases. Therefore, inhibitors that act upstream of ERK1 / 2, such as MEK inhibitors and RAF inhibitors, are not ERK1 / 2 inhibitors according to the present invention. Non-limiting examples of ERK1 / 2 inhibitors include AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), pharmaceutically acceptable salts thereof, and combinations thereof.

[0202] As used herein, "HDAC inhibitors" refer to those substances that (i) directly interact with histone deacetylase (HDAC), such as by binding to HDAC, and (ii) reduce the expression or activity of HDAC. Non-limiting examples of HDAC inhibitors include Abexostat (PCI-24781), Ginustat, Entinostat, Fulinostat, CI-994, CUDC-101, Entinostat, BML-210, M344, NVP-LAQ824, Panobinostat, Pracinosat (SB939), Mocetinostat, Resminostat, Romidepsin, Belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0203] According to some embodiments, the HDAC inhibitor is selected from the group consisting of fulamistat, panobinostat, romidepsin, belinostat, pharmaceutically acceptable salts thereof, and combinations thereof.

[0204] In another aspect, the method further comprises administering to the subject at least one additional therapeutic agent effective to treat or ameliorate the effects of cancer. The additional therapeutic agent can be selected from antibodies, antibody fragments, antibody conjugates, cytotoxic agents, toxins, radionuclides, immunomodulators, photoactivated therapeutic agents, radiosensitizers, hormones, anti-angiogenic agents, and combinations thereof.

[0205] As used herein, "antibody" encompasses naturally occurring immunoglobulins as well as non-naturally occurring immunoglobulins, including, for example, single-chain antibodies, chimeric antibodies (e.g., humanized mouse antibodies), and heteroconjugate antibodies (e.g., bispecific antibodies). Antibody fragments include those that bind to antigens (e.g., Fab', F(ab')2, Fab, Fv, and rIgG). See also, for example, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill); Kuby, J., Immunology, 3rd Ed., WH Freeman & Co., New York (1998). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. The term "antibody" also includes polyclonal and monoclonal antibodies.

[0206] Examples of therapeutic antibodies that can be used in the present invention include rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab tiuxetan (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzamab, atezolizumab (Tecentriq), avelumab (Bavencio), duluvazumab (Imfinzi), B-701, ofatumumab, atozumab (Gazyva), panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111, and combinations thereof.

[0207] According to some embodiments, the antibody, fragment thereof or conjugate thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab atezolizumab (Tecentriq), durvalumab (Imfinzi), ofatumumab, atezolizumab (Gazyva), panitumumab and combinations thereof.

[0208] Cytotoxic agents according to the present invention include DNA disruptors, antimetabolites, anti-microtubule agents, antibiotic agents, etc. DNA disruptors include alkylating agents, platinum-based agents, intercalating agents, and inhibitors of DNA replication. Non-limiting examples of DNA alkylating agents include cyclophosphamide, methylchloroethylamine, uracil nitrogen mustard, melphalan, methylchloroethylamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of platinum-based agents include cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of intercalating agents include doxorubicin, daunorubicin, idarubicin, mitoxantrone, pharmaceutically acceptable salts thereof, prodrugs, and combinations thereof. Non-limiting examples of inhibitors of DNA replication include irinotecan, topotecan, ammonia base, etoposide, etoposide phosphate, teniposide, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. Antimetabolites include folate antagonists such as methotrexate and pemetrexed (premetrexed); purine antagonists such as 6-mercaptopurine, dacarbazine, and fludarabine; and pyrimidine antagonists such as 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof. Antimicrotubule agents include, but are not limited to, vinca alkaloids, paclitaxel Docetaxel Isabepilone Antibiotic agents include, but are not limited to, actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts, prodrugs thereof, and combinations thereof.

[0209] According to some embodiments, the cytotoxic agent is selected from cyclophosphamide, mechlorethamine, uracil nitrogen mustard, melphalan, mechlorethamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixabepilone (Ixempra), actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0210] Cytotoxic agents according to the present invention also include inhibitors of the PI3K / Akt pathway. Non-limiting examples of inhibitors of the PI3K / Akt pathway include A-674563 (CAS#552325-73-2), AGL 2263, AMG-319 (Amgen, Thousand Oaks, Calif), AS-041164 (5-benzo[1,3]dioxazol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxazol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole series, Genentech (Roche Holdings Inc., South San Diego, CA). Francisco, Calif), BML-257 (CAS#32387-96-5), BVD-723, CAL-120 (Gilead Sciences, Foster City, Calif), CAL-129 (Gilead Sciences), CAL-130 (Gilead Sciences), CAL-253 (Gilead Sciences), CAL-263 (Gilead Sciences), CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681-41-0, CAS#98510-80-6, CCT12893 0(CAS#885499-61-6), CH5132799(CAS#1007207-67-1), CHR-4432(ChromaTherapeutics, Ltd., Abingdon, UK), FPA 124(CAS#902779-59-3), GS-1101(CAL-101)(Gilead Sciences), GSK 690693(CAS#937174-76-0), H-89(CAS#127243-85-0), Honokiol, IC87114(Gilead Science), IPI-145 (Intellikine Inc.)、KAR-4139 (Karus Therapeutics, Chilworth, UK), KAR-4141 (Karus Therapeutics), KIN-1 (Karus Therapeutics), KT 5720 (CAS#108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), naltrexone hydrochloride, OXY-111A (NormOxys Inc., Brighton, Mass.), perifosine, PHT-427 (CAS#1191951-57-1), PI3 kinase delta inhibitor, Merck KGaA (Merck & Co., Whitehouse Station, NJ), PI3 kinase delta inhibitor, Genentech (Roche Holdings Inc.), PI3 kinase delta inhibitor, Incozen (Incozen Therapeutics, Pvt. Ltd., Hydrabad, India), PI3 kinase delta inhibitor 2, Incozen (Incozen Therapeutics), PI3 kinase inhibitor, Roche-4 (Roche Holdings Inc.), PI3 kinase inhibitor, Roche (Roche Holdings Inc.), PI3 kinase inhibitor, Roche-5 (Roche Holdings Inc.), PI3-α / δ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd., South San Francisco, CA), PI3-δ inhibitor, Cellzome (Cellzome AG, Heidelberg, Germany), PI3-δ inhibitor, Intellikine (Intellikine Inc., La Jolla, CA), PI3-δ inhibitor, Pathway Therapeutics-1 (Pathway Therapeutics Ltd.), PI3-δ inhibitor, Pathway Therapeutics-2 (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Cellzome (Cellzome AG), PI3-δ / γ inhibitors, Intellikine (Intellikine Inc.)、PI3-δ / γ inhibitor, Intellikine (Intellikine Inc.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-δ / γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3-γ inhibitor, Evotec (Evotec), PI3-γ inhibitor, Cellzome (Cellzome AG), PI3-γ inhibitor, Pathway Therapeutics (Pathway Therapeutics Ltd.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), PI3Kδ / γ inhibitor, Intellikine-1 (Intellikine Inc.), pictilisib (Roche Holdings Inc.), PIK-90 (CAS#677338-12-4), SC-103980 (Pfizer, New York, NY), SF-1126 (Semafore Pharmaceuticals, Indianapolis, IN), SH-5, SH-6, tetrahydrocurcumin, TG100-115 (Targegen Inc., San Diego, Calif), triciribine, X-339 (Xcovery, West Palm Beach, F1a), XL-499 (Evotech, Hamburg, Germany), pharmaceutically acceptable salts thereof, and combinations thereof.

[0211] In the present invention, BVD-723 is a compound according to formula (II):

[0212]

[0213] and pharmaceutically acceptable salts thereof. BVD-723 is a selective inhibitor of PI3Kγ. BVD-723 can be synthesized according to, for example, U.S. Patent Application Publication No. 2016 / 0214980, the entire contents of which are incorporated herein by reference. Enantiomers and racemic mixtures of the two enantiomers of BVD-723 are also included within the scope of the present invention.

[0214] In the present invention, the term "toxin" refers to an antigenic poison or venom of plant or animal origin. An example is diphtheria toxin or a portion thereof.

[0215] In the present invention, the term "radionuclide" refers to a radioactive substance that is administered to a patient, for example, intravenously or orally, after which it penetrates into the target organ or tissue through the patient's normal metabolism, where it delivers local radiation for a short period of time. Examples of radionuclides include, but are not limited to, I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, and Y-90.

[0216] In the present invention, the term "immunomodulator" refers to a substance that changes an immune response by enhancing or reducing the ability of the immune system to produce antibodies or sensitized cells, which antibodies or sensitized cells recognize and react with the antigen that causes them to be produced. Immunomodulators can be recombinant, synthetic or natural preparations, and include cytokines, corticosteroids, cytotoxic agents, thymosins and immunoglobulins. Some immunomodulators are naturally present in vivo, and some of them can be obtained in drug preparations. Examples of immunomodulators include, but are not limited to, granulocyte colony stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and cell membrane fractions from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine phosphate guanosine (CpG), immune checkpoint inhibitors and combinations thereof.

[0217] In the present invention, the term "photoactivated therapeutic agent" refers to compounds and compositions that become active after exposure to light. Certain examples of photoactivated therapeutic agents are disclosed in, for example, US Patent Application Serial No. 2011 / 0152230A1 "Photoactive Metal Nitrosyls For Blood Pressure Regulation And Cancer Therapy".

[0218] In the present invention, the term "radiosensitizer" refers to a compound that makes tumor cells more sensitive to radiotherapy. Examples of radiosensitizers include misonidazole, metronidazole, tirapramine and sodium trans-syringate and combinations thereof.

[0219] In the present invention, the term "hormone" refers to a substance released by cells in one part of the body that affects cells in another part of the body. Examples of hormones include, but are not limited to, prostaglandins, leukotrienes, prostacyclins, thromboxanes, amylocellulose, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atrial peptide, brain natriuretic peptide, calcitonin, cholecystokinin, adrenocorticotropic hormone releasing hormone, enkephalin, endothelin, erythropoietin, follicle stimulating hormone, galanin, gastrin, growth hormone releasing peptide, glucagon, gonadotropin releasing hormone, growth hormone releasing hormone, human chorionic villus hormone, gonadotropin releasing ... Gonadotropin, human placental secretagogue, growth hormone, inhibin, insulin, somatomedin, leptin, lipotropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, and calcifediol.

[0220] Some compounds interfere with the activity of certain hormones or stop the production of certain hormones. These hormone-interfering compounds include, but are not limited to, tamoxifen Anastrozole Letrozole Fusavir These compounds are also included within the meaning of hormones in the present invention.

[0221] As used herein, "anti-angiogenic" agents refer to substances that reduce or inhibit the growth of new blood vessels, for example, inhibitors of vascular endothelial growth factor (VEGF) and inhibitors of endothelial cell migration. Anti-angiogenic agents include, but are not limited to, 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor 4, prolactin, SU5416, suramin, tacromonide, tegalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, zif-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

[0222] According to one aspect, the present disclosure provides a method for treating or ameliorating the effects of cancer in a subject, comprising: (a) identifying a subject with cancer carrying a non-V600E / K BRAF mutation; and (b) administering to the subject an effective amount of an ERK inhibitor or a pharmaceutically acceptable salt thereof.

[0223] According to one embodiment, the ERK inhibitor is selected from BVD-523, SCH-722984 (Merck & Co.), SCH-772984 (Merck & Co.), SCH-900353 (MK-8353) (Merck & Co.), LY3214996 (Lilly), AEZS-140 (Aeterna Zentaris), AEZS-131 (Aeterna Zentaris), AEZS-136 (Aeterna Zentaris), LTT-462 (Novartis), RG-7842 (Genentech), CC-90003 (Celgene), KIN-4050 (Kinentia) and combinations thereof. According to one embodiment, the ERK inhibitor is BVD-523. In one aspect of this embodiment, BVD-523 or a pharmaceutically acceptable salt thereof is administered in the form of a pharmaceutical composition further comprising a pharmaceutically acceptable carrier or diluent.

[0224] According to one aspect, the present disclosure provides a method of identifying a subject having cancer who carries a non-V600E / K BRAF mutation, comprising (i) obtaining a biological sample from the subject; and (ii) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation.

[0225] Suitable and preferred subject matter is as disclosed herein. In this embodiment, the method can be used to treat cancers disclosed above, including those cancers with mutation backgrounds identified above. Methods for identifying such mutations are also as described above.

[0226] In the present invention, biological samples include but are not limited to blood, plasma, urine, skin, saliva and biopsy samples. Biological samples are obtained from subjects by conventional procedures and methods known in the art. Non-limiting examples of methods for identifying mutations include PCR, sequencing, hybridization capture, capture in solution, molecular inversion probes, fluorescence in situ hybridization (FISH) assays and combinations thereof.

[0227] According to one embodiment, the method further comprises administering to the subject at least one additional therapeutic agent selected from a MEK inhibitor, a RAF inhibitor, an HDAC inhibitor, and a combination thereof. Suitable and preferred themes are as disclosed herein. In this embodiment, the method can be used to treat cancers disclosed above, including those cancers with mutation backgrounds identified above, using one or more additional therapeutic agents disclosed above. The method for identifying such mutations is also as described above.

[0228] According to one aspect, the present disclosure provides a method for identifying a subject with cancer who will benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from a subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of a non-V600E / K BRAF mutation confirms that the subject will benefit from therapy with an ERK inhibitor or a pharmaceutically acceptable salt thereof. According to some embodiments, the method further comprises administering an ERK inhibitor or a pharmaceutically acceptable salt thereof to the subject. According to some embodiments, the method further comprises administering at least one additional therapeutic agent to the subject. In this embodiment, the method can be used to identify the mutation background identified above in the above-mentioned cancer. The method for identifying such mutations is also as described above. In this embodiment, the identified patient will benefit from its ERK inhibitor as described above. The additional therapeutic agent is as described above. Suitable and preferred themes are as described above.

[0229] According to one aspect, the present disclosure provides a method for treating or alleviating the effects of cancer in a subject, comprising: (a) identifying a subject with cancer carrying a non-V600E / K BRAF mutation; and (b) administering an effective amount of BVD-523 or a pharmaceutically acceptable salt thereof to the subject. According to one aspect, the present disclosure provides a method for identifying a subject with cancer who will benefit from a therapy with BVD-523 or a pharmaceutically acceptable salt thereof, the method comprising: (a) obtaining a biological sample from a subject; and (b) screening the sample to determine whether the subject has a non-V600E / K BRAF mutation, wherein the presence of a non-V600E / K BRAF mutation confirms that the subject will benefit from a therapy with BVD-523 or a pharmaceutically acceptable salt thereof. In these embodiments, the method can be used to identify the mutation background identified above in the above-mentioned cancer. The method for identifying such mutations is also described above. Suitable and preferred subjects are as described above.

[0230] Another aspect of the disclosure provides a kit for treating or ameliorating the effects of cancer in a subject carrying a non-V600E / K BRAF mutation.According to some embodiments, the kit comprises an effective amount of an ERK inhibitor as described above, and optionally an additional therapeutic agent as described above.

[0231] The kit may also include suitable storage containers, such as ampoules, vials, test tubes, etc., for each anticancer agent of the invention (which may be, for example, in the form of a pharmaceutical composition) and other reagents (e.g., buffers, balanced salt solutions, etc.) for administering the anticancer agent to a subject. The anticancer agent of the invention and other reagents may be present in the kit in any convenient form, such as in solution or powder form. The kit may further include a packaging container, optionally with one or more compartments for containing pharmaceutical compositions and other optional reagents.

[0232] In the present invention, the "effective amount" or "therapeutically effective amount" of the anticancer agent of the present invention, including the pharmaceutical composition containing the anticancer agent disclosed herein, is the amount of such agent or composition that is sufficient to achieve the beneficial or desired results described herein when administered to a subject. Effective dosage forms, modes of administration, and dosages can be determined empirically, and such determinations are within the technical scope of the art. It will be understood by those skilled in the art that the dosage will vary with the route of administration, the rate of excretion, the duration of treatment, the characteristics of any other drug being administered, the age, size, and species of mammals, such as human patients, and similar factors well known in the medical and veterinary fields. Typically, the appropriate dosage of an agent or composition according to the present invention will be such an amount of the agent or composition that is the minimum dosage that effectively produces the desired effect. The effective dosage of an agent or composition of the present invention can be administered in two, three, four, five, six or more sub-doses at appropriate intervals throughout the day.

[0233] Non-limiting examples of dosages of BVD-523, RAF inhibitors, ERK inhibitors, or another anticancer agent disclosed herein are from about 1 mg / kg to about 2400 mg / kg per day, such as from about 1 mg / kg to about 1200 mg / kg per day, from 75 mg / kg to about 300 mg / kg per day, including from about 1 mg / kg to about 100 mg / kg per day. Other representative dosages of such agents include about 1 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg, 50 mg / kg, 60 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 90 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, In some embodiments, the present invention provides an effective dose of BVD-523, a RAF inhibitor, an ERK inhibitor, or another anticancer agent disclosed herein, which can be administered in two, three, four, five, six, or more sub-doses at appropriate intervals throughout the day.

[0234] BVD-523, RAF inhibitors, ERK inhibitors or other therapeutic agents of the present invention or pharmaceutical compositions comprising the same can be administered in any desired and effective manner: for oral ingestion, or as an ointment or drops for topical administration to the eye, or in any appropriate manner (e.g., intraperitoneal, intratumoral, subcutaneous, topical, intradermal, inhaled, intrapulmonary, rectal, vaginal, sublingual, intramuscular, intravenous, intraarterial, intrathecal or intralymphatic) for parenteral or other administration. In addition, BVD-523, RAF inhibitors or other therapeutic agents of the present invention or pharmaceutical compositions comprising the same can be administered in combination with other treatments. If desired, BVD-523, RAF inhibitors or other therapeutic agents of the present invention or pharmaceutical compositions comprising the same can be encapsulated or otherwise protected from gastric or other secretions.

[0235] The pharmaceutical composition of the present invention comprises one or more active ingredients, such as a therapeutic agent, mixed with one or more pharmaceutically acceptable diluents or carriers and optionally one or more other compounds, drugs, ingredients and / or materials. Regardless of the selected route of administration, the reagent / compound of the present invention is formulated into a pharmaceutically acceptable dosage form by conventional methods known to those skilled in the art. See, for example, Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa).

[0236] Pharmaceutically acceptable diluents or carriers are well known in the art (see, for example, Remington, The Science and Practice of Pharmacy (21st Edition, Lippincott Williams and Wilkins, Philadelphia, Pa.) and The National Formulary (American Pharmaceutical Association, Washington, DC) and include sugars (e.g., lactose, sucrose, mannitol and sorbitol), starch, cellulose preparations, calcium phosphates (e.g., dicalcium phosphate, tricalcium phosphate and hydrogen calcium phosphate), sodium citrate, water, aqueous solutions (e.g., saline, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, lactated Ringer's injection), alcohols (e.g., ethanol, propanol and benzyl alcohol), polyols (e.g., glycerol, propylene glycol and polyethylene glycol), organic esters (e.g., ethyl oleate and triglycerides), biodegradable polymers (e.g., polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides)), elastic matrices, liposomes, microspheres, oils (e.g., corn, germ, olive, castor, sesame, cottonseed and peanut), cocoa butter, waxes (e.g., suppository wax), paraffin, silicones, talc, silicates, and the like. Each pharmaceutically acceptable diluent or carrier used in the pharmaceutical composition of the present invention must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject. Diluents or carriers suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable diluents or carriers for a selected dosage form and method of administration can be determined using ordinary techniques in the art.

[0237] The pharmaceutical compositions of the present invention may optionally contain other ingredients and / or materials commonly used in pharmaceutical compositions. These ingredients and materials are well known in the art and include (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, hydroxypropylmethylcellulose, sucrose, and acacia; (3) humectants, such as glycerol; (4) disintegrants, such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, sodium starch glycolate, cross-linked sodium carboxymethylcellulose, and sodium carbonate; (5) solubilizers, such as paraffin; (6) absorption enhancers, such as quaternary ammonium compounds. (7) wetting agents, such as cetyl alcohol and glyceryl monostearate; (8) absorbents, such as kaolin and bentonite; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols and sodium lauryl sulfate; (10) suspending agents, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar and tragacanth; (11) buffers; (12) excipients, such as lactose, milk sugar, polyethylene glycol, animal and vegetable fats, oils, waxes, paraffin, cocoa butter, starch, tragacanth, cellulose derivatives, polyethylene glycol, Silicone, bentonite, silicic acid, talc, salicylates, zinc oxide, aluminum hydroxide, calcium silicate and polyamide powder; (13) inert diluents, such as water or other solvents; (14) preservatives; (15) surfactants; (16) dispersants; (17) release control or absorption delaying agents, such as hydroxypropyl methylcellulose, other polymer matrices, biodegradable polymers, liposomes, microspheres, aluminum monostearate, gelatin and wax; (18) opacifiers; (19) adjuvants; (20) wetting agents; (21) emulsifying suspending agents; (22) solubilizing agents and emulsifiers, such as ethanol, isopropyl alcohol, ethyl carbonate, Esters, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, fatty acid esters of oils (especially cottonseed, peanut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuran alcohol, polyethylene glycol and sorbitan; (23) propellants, such as chlorofluorocarbons and volatile unsubstituted hydrocarbons, such as butane and propane; (24) antioxidants; (25) agents that render the formulation isotonic with the blood of the intended recipient, such as sugars and sodium chloride; (26) thickeners; (27) coating materials, such as lecithin; and (28) sweeteners, flavorings, colorings, aromas and preservatives. Each such ingredient or material must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Ingredients and materials suitable for a selected dosage form and intended route of administration are well known in the art, and acceptable ingredients and materials for a selected dosage form and method of administration can be determined using ordinary skills in the art.

[0238] The pharmaceutical compositions of the present invention suitable for oral administration may be capsules, cachets, pills, tablets, powders, granules, solutions or suspensions in aqueous or non-aqueous liquids, oil-in-water or water-in-oil liquid emulsions, elixirs or syrups, lozenges, boluses, elixirs or pastes. These formulations may be prepared by methods known in the art, for example, by conventional pan coating, mixing, granulation or lyophilization methods.

[0239] Solid dosage forms (capsules, tablets, pills, dragees, powders, granules, etc.) for oral administration can be prepared, for example, by mixing one or more active ingredients with one or more pharmaceutically acceptable diluents or carriers and optionally one or more fillers, extenders, binders, humectants, disintegrants, solution retardants, absorption promoters, wetting agents, absorbents, lubricants and / or colorants. Solid compositions of similar types can be used as fillers in soft and hard-filled gelatin capsules using suitable excipients. Tablets can be made by compression or molding, optionally with one or more auxiliary ingredients. Compressed tablets can be prepared using suitable binders, lubricants, inert diluents, preservatives, disintegrants, surfactants or dispersants. Molded tablets can be prepared by molding in a suitable machine. Tablets and other solid dosage forms, such as dragees, capsules, pills and granules, can be optionally scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the field of drug formulation. They can also be formulated to provide slow or controlled release of the active ingredient therein. They may be sterilized, for example, by filtration through a bacteria-retaining filter. These compositions may also optionally contain opacifying agents and may be of such composition that they release the active ingredient only or preferentially in a certain part of the gastrointestinal tract, optionally in a delayed manner. The active ingredient may also be in microencapsulated form.

[0240] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. Liquid dosage forms may include suitable inert diluents commonly used in the art. In addition to inert diluents, oral compositions may also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweeteners, flavoring agents, coloring agents, fragrances and preservatives. Suspensions may contain suspending agents.

[0241] The pharmaceutical composition of the present invention for rectal or vaginal administration may be in the form of a suppository, which may be prepared by mixing one or more active ingredients with one or more suitable non-irritating diluents or carriers, which are solid at room temperature but liquid at human body temperature, and thus melt in the rectum or vaginal cavity and release the active compound. Pharmaceutical compositions of the present invention suitable for vaginal administration also include vaginal suppositories, tampons, creams, gels, pastes, foams or spray formulations containing suitable pharmaceutically acceptable diluents or carriers known in the art.

[0242] Dosage forms for topical or transdermal administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, drops and inhalants. The active agent / compound can be mixed with a suitable pharmaceutically acceptable diluent or carrier under aseptic conditions. Ointments, pastes, creams and gels can contain excipients. Powders and sprays can contain excipients and propellants.

[0243] The pharmaceutical compositions of the present invention suitable for parenteral administration may comprise one or more agents / compounds in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders that may be reconstituted into sterile injectable solutions or dispersions just before use, which may comprise suitable antioxidants, buffers, solutes (making the preparation isotonic with the blood of the intended recipient), or suspending agents or thickening agents. Suitable fluidity may be maintained, for example, by using coating materials, in the case of dispersions, by maintaining the desired particle size and by using surfactants. These pharmaceutical compositions may also comprise suitable adjuvants, such as wetting agents, emulsifiers and dispersants. It may also be desirable to include isotonic agents. In addition, extended absorption of injectable drug forms may be caused by comprising agents that delay absorption.

[0244] In some cases, in order to prolong the effect of a drug (e.g., a pharmaceutical formulation), it is desirable to slow its absorption from subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of a crystalline or amorphous material with poor water solubility.

[0245] Then, the absorption rate of the active agent / drug depends on its dissolution rate, which in turn depends on crystal size and crystalline form. Alternatively, delayed absorption of the reagent / drug administered parenterally can be achieved by dissolving or suspending the active agent / drug in an oily vehicle. Injectable reservoir forms can be prepared by forming a microcapsule matrix of active ingredients in a biodegradable polymer. Depending on the ratio of active ingredient to polymer and the properties of the specific polymer used, the rate of release of the active ingredient can be controlled. The preparation of an injectable reservoir can also be prepared by trapping the drug in a liposome or microemulsion compatible with body tissues. The injectable material can be sterilized, for example, by filtering through a filter that retains bacteria.

[0246] The formulations may be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials, and may be stored in a lyophilized condition, requiring only the addition of a sterile liquid diluent or carrier, such as water for injection, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the type described above.

[0247] The following examples are provided to further illustrate the methods of the present invention. These examples are illustrative only and are not intended to limit the scope of the present invention in any way.

[0248] Example 1

[0249] The following examples show the results of a Phase 1b trial of BVD-523 in solid tumors. Figure 2 The waterfall plot depicted in provides a graphical representation of human clinical trial patient information, showing each individual patient's response to BVD-523 treatment, measured as % change in tumor burden. Patients typically received 600 mg twice daily (BID), with some patients receiving a stepped-down dose of 300 mg–400 mg BID if side effects could not be controlled with other palliative care.

[0250] like Figure 2 As shown, using Response Evaluation Criteria in Solid Tumors 1.1 version (RECIST v1.1), the tumor response to BVD-523 was assessed in 28 assessable patients. One patient did not receive two target lesion scans simultaneously, so it was not assessed. The horizontal axis on the figure is used as the baseline measurement for each patient. The vertical axis is the measurement of the maximum percentage change relative to baseline; That is, the growth or the percentage of reduction of the tumor burden measured by radiology according to RECIST v1.1. Radiological measurements include computed tomography (CT) scanning and rarely include magnetic resonance imaging (MRI).

[0251] Depend on Figure 2 The tumor burden data represented are arranged from the worst value on the left side of the figure (i.e., the maximum progression of tumor burden) to the best value on the right side of the figure (i.e., the maximum reduction of tumor burden). The RECISTv1.1 response criteria for measuring target lesions have been described previously. (See Eisenhauer, EA et al., New response evaluation criteria insolid tumours: Revised RECIST guideline (version 1.1), European J. of Cancer 45, 228-247 (2009), incorporated herein by reference in their entirety). The response criteria are as follows:

[0252] Complete response (CR) - disappearance of all target lesions;

[0253] Partial response (PR) - a decrease of at least 30% in the sum of the diameters of target lesions relative to the baseline sum of the diameters; Figure 2 The 30% reduction threshold for partial response is indicated by a horizontal line as shown in FIG.

[0254] Progressive Disease (PD) - an increase of at least 20% in the sum of diameters of target lesions, using the smallest on-study sum (including the baseline sum if it is the smallest on-study value) as reference. In addition to a relative increase of 20%, the sum must also show an absolute increase of at least 5 mm (note: the appearance of one or more new lesions is also considered progression);

[0255] Stable disease (SD) – no sufficient shrinkage to qualify as PR or growth to qualify as PD, using the smallest overall diameter at the time of the study as reference.

[0256] Figure 2 Also shown are the type of cancer or organ for which each patient's tumor burden was measured, as well as the type of atypical BRAF mutations identified in the patient's tumor samples. Of the 28 patients represented, 13 patients' tumors contained BRAF D594 mutations (7 were D594G and 6 were D594N); 1 patient's tumor contained a BRAF F247L mutation; 1 patient's tumor included a fusion of the BRAF gene with the nuclear factor IC (NFIC) gene (i.e., a BRAF-NFIC fusion mutation); 1 patient's tumor contained a BRAF G466V mutation; 5 patient's tumors contained BRAF G469 mutations (1 was G469V and 4 were G469A); 3 patient's tumors contained BRAF K601E mutations; 1 patient's tumor contained a BRAF L485W mutation; 3 patient's tumors contained BRAF L597 mutations (1 was unclear and 2 were L597Q), and 2 patient's tumors contained T599 duplications. For each patient, the type of BRAF mutation is indicated by a color code and cancer type (see Figure 2 ).

[0257] Five patients with a PR had a 35% to 100% reduction in the total number of target lesions relative to baseline. These patients had: gallbladder tumors containing the L485W mutation; head / neck squamous cell tumors containing the G469A mutation; non-small cell lung cancer containing the BRAF L597Q mutation or the BRAFT599 duplication; and small bowel tumors containing the BRAF G469A mutation. 19 patients had stable disease. Three patients had progressive disease at the time of initial evaluation. (See Figure 2 Thus, BVD-523 treatment unexpectedly resulted in partial responses or stable disease in 24 of 28 patients with atypical (ie, non-V600E / K) BRAF mutations.

[0258] Figure 3The swimmer plots by group classification show the duration of treatment. Members of Group 1 are any patients with any BRAF mutation in any tumor type except colorectal cancer (CRC) and non-small cell lung cancer (NSCLC) who have not previously received treatment with a MAPK pathway inhibitor. Members of Group 2 are patients with any BRAF mutation in CRC who have not previously received treatment with a MAPK pathway inhibitor. Members of Group 3 are patients with tumors with BRAF V600E / K mutations who are refractory to MAPK inhibitor treatment. Members of Group 6 are patients with any BRAF mutation present in NSCLC. As Figure 3 As shown, all 28 patients are represented by horizontal lines, one for each subject. The treatment duration of each subject in each group is illustrated from the top (longest treatment duration) to the bottom (shortest treatment duration) of the group. The horizontal axis represents the duration (days) of the patient in the study. Figure 3 Also shown is the type of response achieved for each patient according to RECIST v1.1 (diamonds = partial response; circles = stable disease; vertical lines = progressive disease; triangles = not evaluable).

[0259] Figure 4 The duration of treatment in the waterfall diagram disrupted by BRAF mutation is shown. All 28 patients measured according to RECISTv1.1 response criteria are included, as well as other patients who were not evaluated by RECIST v1.1 (diamond = partial response; circle = stable disease; vertical line = progressive disease; triangle = not evaluated). For tumors carrying the same BRAF mutation, the average duration of BVD-523 treatment before interruption was: D594, 73.6 days; G469, 208.14 days; K601E, 50.25 days; L597, 73.3 days; T599 Dup, 63.5 days. For individual patients representing specific BRAF mutations, the duration of treatment was: L485W, 304 days; F247L, 84 days; G466V, 77 days; BRAF fusion, 65 days; BRAF-AGAP3 rearrangement, 43 days; BRAF exon 15 splice variant, 15 days. By genomic screening of cancer patients for BRAF mutations and treating them prior to complete in vitro characterization of these mutations as driver mutations, BVD-523 is shown to be useful for the study and discovery of effective treatment options for patients harboring mutations in BRAF. The clinical population of patients and efficacy are primarily determined not by tumor type, but rather by the mutational status of enzymes upstream of ERK 1 / 2 kinase activation such as BRAF.

[0260] In summary, the examples provided provide data from a solid tumor phase 1b trial of the novel ERK inhibitor BVD-523 for the treatment of patients with cancers harboring atypical BRAF mutations. Continuous twice-daily treatment with BVD-523 produced an anti-tumor effect in several patients and was not limited to any one specific cancer type or atypical BRAF mutation.

[0261] Documents

[0262] ABSALAN,Farnaz,Mostafa Ronaghi(2008).Molecular Inversion ProbeAssay.Methods in Molecular Biology 396.Humana Press.pp.315–330.

[0263] AHRONIAN LG, Sennott EM, Van Allen EM, Wagle N, Kwak EL, Faris JE, et al. Clinical acquired resistance to RAF inhibitor combinations in BRAF-mutantcolorectal cancer through MAPK pathway alterations. Cancer Discov 2015;5:358–67.

[0264] ARCILA ME, Drilon A, Sylvester BE, Lovly CM, Borsu L, Reva B, et al. MAP2K1(MEK1) mutations define a distinct subset of lung adenocarcinoma associated with smoking. Clin Cancer Res 2015;21:1935-43.

[0265] ARONOV AM, Baker C, Bemis GW, Cao J, Chen G, Ford PJ, et al. Flipped out: structure-guided design of selective pyrazolylpyrrole ERK inhibitors. J MedChem 2007;50:1280-7.

[0266] ARONOV AM,Tang Q,Martinez-Botella G,Bemis GW,Cao J,Chen G,etal.Structure-guided design of potent and selective pyrimidylpyrroleinhibitors of extracellular signal-regulated kinase(ERK)using conformationalcontrol.J Med Chem 2009;52:6362-8.

[0267] ARRINGTON AK,Heinrich EL,Lee W,Duldulao M,Patel S,Sanchez J,etal.Prognostic and predictive roles of KRAS mutation in colorectal cancer.IntJ Mol Sci 2012;13:12153-68.

[0268] CARGNELLO M,Roux PP.Activation and function of the MAPKs and theirsubstrates,the MAPK-activated protein kinases.Microbiol Mol Biol Rev 2011;75:50-83.

[0269] CARLINO MS,Fung C,Shahheydari H,Todd JR,Boyd SC,Irvine M,etal.Preexisting MEK1P124 mutations diminish response to BRAF inhibitors inmetastatic melanoma patients.Clin Cancer Res 2015;21:98-105.

[0270] CHAPMAN PB,Hauschild A,Robert C,Haanen JB,Ascierto P,Larkin J,etal.Improved survival with vemurafenib in melanoma with BRAF V600E mutation.NEngl J Med 2011;364:2507-16.

[0271] CORCORAN,R.B.,et al.BRAF gene amplification can promote acquiredresistance to MEK inhibitors in cancer cells harboring the BRAF V600Emutation.Sci Signal(2010);3(149):ra84.

[0272] DAI,B.,et al.STAT3 mediates resistance to MEK inhibitor throughmicroRNA miR-17.Cancer Res(2011);71:3658-3668.

[0273] DAVIES H,Bignell GR,Cox C,Stephens P,Edkins S,Clegg S,et al.Mutationsof the BRAF gene in human cancer.Nature 2002;417:949–54.

[0274] DESCHENES-SIMARD X,Kottakis F,Meloche S,Ferbeyre G.ERKs in cancer:friends or foes?Cancer Res 2014;74:412–9.

[0275] DOBRZYCKA B,Terlikowski SJ,Kowalczuk O,Niklinska W,Chyczewski L,Kulikowski M.Mutations in the KRAS gene in ovarian tumors.Folia HistochemCytobiol 2009;47:221–4.

[0276] EMERY,C.M.,et al.MEK1 mutations confer resistance to MEK and B-RAFinhibition.PNAS(2009);106(48):20411-6.

[0277] FEDOROV O,Niesen FH,Knapp S.Kinase inhibitor selectivity profilingusing differential scanning fluorimetry.Methods Mol Biol 2012;795:109-18.

[0278] -MEDARDE A,Santos E.Ras in cancer and developmentaldiseases.Genes Cancer 2011;2:344–58.

[0279] FLAHERTY KT,Infante JR,Daud A,Gonzalez R,Kefford RF,Sosman J,etal.Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations.NEngl J Med 2012;367:1694-703.

[0280] GOETZ EM,Ghandi M,Treacy DJ,Wagle N,Garraway LA.ERK mutations conferresistance to mitogen-activated protein kinase pathway inhibitors.Cancer Res2014;74:7079-89.

[0281] GOLLOB JA,Wilhelm S,Carter C,Kelley SL.Role of Raf kinase in cancer:therapeutic potential of targeting the Raf / MEK / ERK signal transductionpathway.Semin Oncol 2006;33:392-406.

[0282] GREGER,James G.,et al."Combinations of BRAF,MEK,and PI3K / mTORinhibitors overcome acquired resistance to the BRAF inhibitor GSK2118436dabrafenib,mediated by NRAS or MEK mutations."Molecular cancer therapeutics11.4(2012):909-920.

[0283] GROENENDIJK FH,Bernards R.Drug resistance to targeted therapies:dejavu all over again.Mol Oncol 2014;8:1067-83.

[0284] HALL RD,Kudchadkar RR.BRAF mutations:signaling,epidemiology,andclinical experience in multiple malignancies.Cancer Control 2014;21:221-30.

[0285] HARDENBOL,P.,et al.Multiplexed genotyping with sequence-taggedmolecular inversion probes.Nat.Biotechnol.2003,no.21,p.673-678.

[0286] HATZIVASSILIOU,Georgia,et al."RAF inhibitors prime wild-type RAF toactivate the MAPK pathway and enhance growth."Nature 464.7287(2010):431-435.

[0287] HATZIVASSILIOU G,Liu B,O'Brien C,Spoerke JM,Hoeflich KP,Haverty PM,etal.ERK inhibition overcomes acquired resistance to MEK inhibitors.Mol CancerTher 2012;11:1143-54.

[0288] HAUSCHILD A,Grob J-J,Demidov LV,Jouary T,Gutzmer R,Millward M,etal.Dabrafenib in BRAF-mutated metastatic melanoma:a multicentre,open-label,phase 3randomised controlled trial.Lancet 2012;380:358-65.

[0289] HAYES TK,Neel NF,Hu C,Gautam P,Chenard M,Long B,et al.Long-Term ERKInhibition in KRAS-Mutant Pancreatic Cancer Is Associated with MYCDegradation and Senescence-like Growth Suppression.Cancer Cell 2016;29:75-89.

[0290] HEZEL AF,Noel MS,Allen JN,Abrams TA,Yurgelun M,Faris JE,et al.PhaseII study of gemcitabine,oxaliplatin in combination with panitumumab in KRASwild-type unresectable or metastatic biliary tract and gallbladder cancer.BrJ Cancer 2014;111:430–6.

[0291] JHA S,Morris EJ,Hruza A,Mansueto MS,Schroeder G,Arbanas J,etal.Dissecting therapeutic resistance to ERK inhibition.Mol Cancer Ther 2016;15:548-59.

[0292] JOHANNESSEN,C.M.,et al.COT / MAP3K8 drives resistance to RAF inhibitionthrough MAP kinase pathway reactivation.Nature(2010);468(7326):968-972.

[0293] JOHNSON DB,Menzies AM,Zimmer L,Eroglu Z,Ye F,Zhao S,et al.AcquiredBRAF inhibitor resistance:A multicenter meta-analysis of the spectrum andfrequencies,clinical behaviour,and phenotypic associations of resistancemechanisms.Eur J Cancer 2015;51:2792-9.

[0294] KANDA M,Matthaei H,Wu J,Hong SM,Yu J,Borges M,et al.Presence ofsomatic Mutations in most early-stage pancreatic intraepithelialneoplasia.Gastroenterology 2012;142:730-733.

[0295] KHATTAK M,Fisher R,Turajlic S,Larkin J.Targeted therapy andimmunotherapy in advanced melanoma:an evolving paradigm.Ther Adv Med Oncol2013;5:105–18.

[0296] KING,Alastair J.,et al."Dabrafenib;preclinical characterization,increased efficacy when combined with trametinib,while BRAF / MEK toolcombination reduced skin lesions."PloS one 8.7(2013):e67583.

[0297] LARKIN J,Ascierto PA,Dréno B,Atkinson V,Liszkay G,Maio M,etal.Combined vemurafenib and cobimetinib in BRAF-mutated melanoma.N Engl J Med2014;371:1867-76.

[0298] LITTLE,A.S.,et al.,Amplification of the Driving Oncogene,KRAS orBRAF,Underpins Acquired Resistance to MEK1 / 2 Inhibitors in Colorectal CancerCells.Sci.Signal.4,ra17(2011).

[0299] LIU,Dingxie,et al."BRAF V600E maintains proliferation,transformation,and tumorigenicity of BRAF-mutant papillary thyroid cancer cells."Journal ofClinical Endocrinology&Metabolism 92.6(2007):2264-2271.

[0300] LIU B,Fu L,Zhang C,Zhang L,Zhang Y,Ouyang L,et al.Computationaldesign,chemical synthesis,and biological evaluation of a novel ERK inhibitor(BL-EI001)with apoptosis-inducing mechanisms in breast cancer.Oncotarget2015;6:6762-75.

[0301] LONG GV,Fung C,Menzies AM,Pupo GM,Carlino MS,Hyman J,et al.IncreasedMAPK reactivation in early resistance to dabrafenib / trametinib combinationtherapy of BRAF-mutant metastatic melanoma.Nat Commun 2014;5:5694.

[0302] LONG GV,Stroyakovskiy D,Gogas H,Levchenko E,de Braud F,Larkin J,etal.Dabrafenib and trametinib versus dabrafenib and placebo for Val600 BRAF-mutant melanoma:a multicentre,double-blind,phase 3 randomised controlledtrial.Lancet 2015;386:444-51.

[0303] MANANDHAR SP,Hildebrandt ER,Schmidt WK.Small-molecule inhibitors ofthe Rce1p CaaX protease.J Biomol Screen.2007;12(7):983–993.

[0304] MASSEY PR,Prasad V,Figg WD,Fojo T.Multiplying therapies and reducingtoxicity in metastatic melanoma.Cancer Biol Ther 2015;16:1014-8.

[0305] MAURER,T,Garrenton,LS,Oh,A,Pitts,K,Anderson,DJ,Skelton,NJ,Fauber,BP,Pan,B,Malek,S,Stokoe,D,Ludlam,MJC,Bowman,KK,Wu,J,Giannetti,AM,Starovasnik,MA,Mellman,I,Jackson,PK,Rudolph,J,Wang,W,Fang,G.Small-molecule ligands bind to adistinct pocket in Ras and inhibit SOS-mediated nucleotide exchangeactivity.PNAS.2012;109(14):5299-304.

[0306] MCARTHUR GA,Chapman PB,Robert C,Larkin J,Haanen JB,Dummer R,etal.Safety and efficacy of vemurafenib in BRAFv600E and BRAFv600K mutation-positive melanoma (BRIM-3):extended follow-up of a phase 3,randomised,open-label study.Lancet Oncol 2014;15:323–32.

[0307] MEKINIST[package insert].Research Triangle Park,NC:GlaxoSmithKline;2014.

[0308] METZKER,Emerging technologies in DNA sequencing Genome Res.2005.15:1767-1776.

[0309] MITTAL,Rohit et al."The acetyltransferase activity of the bacterialtoxin YopJ of Yersinia is activated by eukaryotic host cell inositolhexakisphosphate."Journal of Biological Chemistry 285.26(2010):19927-19934.

[0310] MORRIS EJ,Jha S,Restaino CR,Dayananth P,Zhu H,Cooper A,etal.Discovery of a novel ERK inhibitor with activity in models of acquiredresistance to BRAF and MEK inhibitors.Cancer Discov 2013;3:742-50.

[0311] NAZARIAN,R.,et al.Melanomas acquire resistance to B-RAF(V600E)inhibition by RTK or N-RAS upregulation.Nature.2010;468(7326):973-977.

[0312] NIKOLAEV SI,Rimoldi D,Iseli C,Valsesia A,Robyr D,Gehrig C,et al.Exomesequencing identifies recurrent somatic MAP2K1 and MAP2K2 mutations inmelanoma.Nat Genet 2012;44:133–9.

[0313] NILSSON,M.,et al.Padlock probes:circularizing oligonucleotides forlocalized DNA detection.Science.1994,no.265,p.2085-2088.

[0314] O'HARA AJ,Bell DW.The genomics and genetics of endometrial cancer.AdvGenomics Genet 2012;2012:33–47.

[0315] OJESINA AI,Lichtenstein L,Freeman SS,Pedamallu CS,Imaz-Rosshandler I,Pugh TJ,et al.Landscape of genomic alterations in cervical carcinomas.Nature2014;506:371-5.

[0316] OTA et al.,Single nucleotide polymorphism detection by polymerasechain reaction-restriction fragment length polymorphism.Nat Protoc.2007;2(11):2857-64.

[0317] PARAISO KHT,Fedorenko IV,Cantini LP,Munko AC,Hall M,Sondak VK,etal.Recovery of phospho-ERK activity allows melanoma cells to escape from BRAFinhibitor therapy.Br J Cancer 2010;102:1724–30.

[0318] PATGIRI A,Yadav,KK,Arora,PS,Bar-Sagi,D.An orthosteric inhibitor ofthe Ras-Sos interaction.Nat Chem Biol.2011;7:585-587.

[0319] PENNYCUICK A,Simpson T,Crawley D,Lal R,Santis G,Cane P,et al.RoutineEGFR and KRAS mutation analysis using COLD-PCR in non-small cell lungcancer.Int J Clin Pract 2012;66:748–52.

[0320] PORTER SB,Hildebrandt ER,Breevoort SR,Mokry DZ,Dore TM,SchmidtWK.Inhibition of the CaaX proteases Rce1p and Ste24p by peptidyl(acyloxy)methyl ketones.Biochim Biophys Acta.2007;1773(6):853–862.

[0321] POULIKAKOS PI,Persaud Y,Janakiraman M,Kong X,Ng C,Moriceau G,etal.RAF inhibitor resistance is mediated by dimerization of aberrantly splicedBRAF(V600E).Nature 2011;480:387-90.

[0322] QUEIROLO P,Picasso V,Spagnolo F.Combined BRAF and MEK inhibition forthe treatment of BRAF-mutated metastatic melanoma.Cancer Treat Rev 2015;41:519-26.

[0323] RASOLA A,Sciacovelli M,Chiara F,Pantic B,Brusilow WS,BernardiP.Activation of mitochondrial ERK protects cancer cells from death throughinhibition of the permeability transition.Proc Natl Acad Sci U S A 2010;107:726–31.

[0324] RIZOS H,Menzies AM,Pupo GM,Carlino MS,Fung C,Hyman J,et al.BRAFinhibitor resistance mechanisms in metastatic melanoma:spectrum and clinicalimpact.Clin Cancer Res 2014;20:1965-77.

[0325] ROBERT C,Karaszewska B,Schachter J,Rutkowski P,Mackiewicz A,Stroiakovski D,et al.Improved overall survival in melanoma with combineddabrafenib and trametinib.N Engl J Med 2015;372:30-9.

[0326] ROMEO Y,Zhang X,Roux PP.Regulation and function of the RSK family ofprotein kinases.Biochem J 2012;441:553–69.

[0327] RUDOLPH J,Xiao Y,Pardi A,Ahn NG.Slow inhibition and conformationselective properties of extracellular signal-regulated kinase 1 and 2inhibitors.Biochemistry 2015;54:22-31.

[0328] SHAUL YD,Seger R.The MEK / ERK cascade:from signaling specificity todiverse functions.Biochim Biophys Acta 2007;1773:1213–26.

[0329] SHI H,Hugo W,Kong X,Hong A,Koya RC,Moriceau G,et al.Acquiredresistance and clonal evolution in melanoma during BRAF inhibitortherapy.Cancer Discov 2014;4:80-93.

[0330] SHIMA,F,Yoshikawa,Y,Ye,M,Araki,M,Matsumoto,S,Liao,J,Hu,L,Sugimoto,T,Ijiri,Y,Takeda,A,Nishiyama,Y,Sato,C,Muraoka,S,Tamura,A,Osoda,T,Tsuda,K-I,Miyakawa,T,Fukunishi,H,Shimada,J,Kumasaka,Yamamoto,M,Kataoka,T.In silicodiscovery of small-molecule Ras inhibitors that display antitumor activity byblocking the Ras-effector interaction.PNAS.2013;110(20):8182-7.

[0331] SCHUBBERT S,Shannon K,Bollag G.Hyperactive Ras in developmentaldisorders and cancer.Nat Rev Cancer 2007;7:295–308.

[0332] SUN C,Hobor S,Bertotti A,Zecchin D,Huang S,Galimi F,et al.Intrinsicresistance to MEK inhibition in KRAS mutant lung and colon cancer throughtranscriptional induction of ERBB3.Cell Rep 2014;7:86-93.

[0333] TAFLINAR[package insert].Research Triangle Park,NC:GlaxoSmithKline;2015.

[0334] TRUNZER K,Pavlick AC,Schuchter L,Gonzalez R,McArthur GA,Hutson TE,etal.Pharmacodynamic effects and mechanisms of resistance to vemurafenib inpatients with metastatic melanoma.J Clin Oncol 2013;31:1767-74.

[0335] VILLANUEVA,J.,et al.Acquired resistance to BRAF inhibitors mediatedby a RAF kinase switch in melanoma can be overcome by cotargeting MEK andIGF-1R / PI3K.Cancer Cell.2010;18:683-695.

[0336] WAGLE,N.,et al.Dissecting therapeutic resistance to RAF inhibition inmelanoma by tumor genomic profiling.Journal of Clinical Oncology 2011;29(22):3085-3096.

[0337] WAGLE N,Van Allen EM,Treacy DJ,Frederick DT,Cooper ZA,Taylor-WeinerA,et al.MAP kinase pathway alterations in BRAF-mutant melanoma patients withacquired resistance to combined RAF / MEK inhibition.Cancer Discov 2014;4:61-8.

[0338] Wainstein E,Seger R.The dynamic subcellular localization of ERK:mechanisms of translocation and role in various organelles.Curr Opin CellBiol 2016;39:15-20.

[0339] WANG,H.,et al.Identification of the MEK1(F129L)activating mutation asa potential mechanism of acquired resistance to MEK inhibition in humancancers carrying the B-RAF V600E mutation.Cancer Res(2011);71(16):5535-45.

[0340] YANG W,Soares J,Greninger P,Edelman EJ,Lightfoot H,Forbes S,etal.Genomics of Drug Sensitivity in Cancer(GDSC):a resource for therapeuticbiomarker discovery in cancer cells.Nucleic Acids Res 2013;41:D955-D961.

[0341] YAO Z,Torres NM,Tao A,Gao Y,Luo L,Li Q,et al.BRAF Mutants Evade ERK-Dependent Feedback by Different Mechanisms that Determine Their Sensitivity to Pharmacologic Inhibition.Cancer Cell 2015;28:370-83.

[0342] YOHE S. Molecular genetic markers in acute myeloid leukemia. J Clin Med2015;4:460–78.

[0343] ZELBORAF[package insert]. South San Francisco, CA: Genentech USA, Inc.; 2015.

[0344] All documents cited in this application are incorporated herein by reference as if fully incorporated herein.

[0345] Although exemplary illustrative embodiments of the present invention have been described herein, it should be understood that the present invention is not limited to the described embodiments and that various other changes or modifications may be made by one skilled in the art without departing from the scope or spirit of the present invention.

Claims

1. Use of BVD-523 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for slowing the growth of a solid tumor in a subject having cancer, wherein the subject carries a non-V600E / K BRAF mutation, wherein the medicament further comprises a RAF inhibitor, and wherein (1) The non-V600E / K BRAF mutation is a D594 mutation, and the cancer is selected from salivary duct carcinoma, vaginal cancer, and non-small cell lung cancer; (2) the non-V600E / K BRAF mutation is a G469 mutation, and the cancer is selected from adenoid cystic carcinoma, appendix cancer, small intestine cancer, squamous cell carcinoma, and angiosarcoma; (3) the non-V600E / K BRAF mutation is a K601E mutation, and the cancer is prostate cancer; (4) the non-V600E / K BRAF mutation is L597 mutation, and the cancer is selected from non-small cell lung cancer and colorectal cancer; (5) The non-V600E / K BRAF mutation is T599 duplication, and the cancer is non-small cell lung cancer; (6) The non-V600E / K BRAF mutation is L485W mutation, and the cancer is gallbladder cancer; (7) the non-V600E / K BRAF mutation is F247L mutation, and the cancer is colorectal cancer; or (8) The non-V600E / K BRAF mutation is a G466V mutation, and the cancer is non-small cell lung cancer.

2. The use according to claim 1, wherein the subject is a mammal.

3. The use according to claim 2, wherein the mammal is selected from primates, farm animals and domestic animals.

4. The use according to claim 2, wherein the mammal is a human.

5. The method according to claim 1, wherein the RAF inhibitor is selected from the group consisting of AAL881, AB-024, ARQ-736, ARQ-761, AZ628, BeiGene-283, BUB-024 (MLN 2480), b-raf inhibitors, BRAF kinase inhibitors, BRAF siRNA 313 (tacaccagcaagctagatgca) and 523 (cctatcgttagagtcttcctg), CHIR-265, CTT239065, dabrafenib (GSK2118436), DP-4978, HM-95573, GDC-0879, GW-5074, ISIS 5132, L779450, LBT613, LXH254, LErafAON, LGX-818, pazopanib, PLX3202, PLX4720, PLX5568, PLX3603, PLX8394, RAF-265, RAF-365, REDX0535, regorafenib, RO 5126766, SB-590885, SB699393, sorafenib, TAK 632, TL-241, vemurafenib (RG7204 or PLX4032), XL-281, ZM-336372, pharmaceutically acceptable salts thereof, and combinations thereof.

6. The use according to claim 1, wherein the RAF inhibitor is selected from erlotinib (Tarceva), gefitinib (Iressa), imatinib mesylate (Gleevec), lapatinib (Tyverb), sunitinib malate (Sutent), pharmaceutically acceptable salts thereof, and combinations thereof.

7. The method according to claim 1, wherein the medicament further comprises at least one additional therapeutic agent selected from antibodies, antibody fragments, antibody conjugates, cytotoxic agents, toxins, radionuclides, immunomodulators, photoactivated therapeutic agents, radiosensitizers, hormones, anti-angiogenic agents and combinations thereof.

8. The use according to claim 7, wherein the antibody, fragment thereof or conjugate thereof is selected from rituximab (Rituxan), brentuximab vedotin (Adcetriz), adotrastuzumab emtansine (Kadcyla), cetuximab (Erbitux), bevacizumab (Avastin), ibritumomab tiuxetan (Zevalin), vedolizumab (Entyvio), ipilimumab (Yervoy), nivolumab (Opdivo), pembrolizumab (Keytruda), alemtuzumab, atezolizumab (Tecentriq), avelumab (Bavencio), duluvazumab (Imfinzi), B-701, ofatumumab, atezolizumab (Gazyva), panitumumab, plozalizumab, BI-754091, OREG-103, COM-701, BI-754111 and combinations thereof.

9. The method according to claim 7, wherein the cytotoxic agent is selected from the group consisting of cyclophosphamide, mechlorethamine, uracil nitrogen mustard, melphalan, mechlorethamine phenylbutyrate, ifosfamide, carmustine, lomustine, streptozotocin, busulfan, temozolomide, cisplatin, carboplatin, oxaliplatin, nedaplatin, satraplatin, tetraplatin trinitrate, doxorubicin, daunorubicin, idarubicin, mitoxantrone, methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosylcytosine, capecitabine, gemcitabine, decitabine, vinca alkaloids, paclitaxel (Taxol), docetaxel (Taxotere), ixambepilone (Ixempra), actinomycin, anthracyclines, valfloxacin, epirubicin, bleomycin, plicamycin, mitomycin, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

10. Use according to claim 7, wherein the toxin is diphtheria toxin or a portion thereof.

11. The use according to claim 7, wherein the radionuclide is selected from the group consisting of I-125, At-211, Lu-177, Cu-67, I-131, Sm-153, Re-186, P-32, Re-188, In-114m, Y-90 and combinations thereof.

12. The use according to claim 7, wherein the immunomodulator is selected from granulocyte colony stimulating factor (G-CSF), LAG-3, IMP-321, JCAR-014, ASLAN-002 (BMS-777607), interferon, imiquimod and cell membrane components from bacteria, IL-2, IL-7, IL-12, CCL3, CCL26, CXCL7, synthetic cytosine monophosphate guanosine (CpG), immune checkpoint inhibitors and combinations thereof.

13. The use according to claim 7, wherein the radiosensitizer is selected from misonidazole, metronidazole, tirapramine, sodium trans-syringate and combinations thereof.

14. The method according to claim 7, wherein the hormone is selected from the group consisting of prostaglandins, leukotrienes, prostacyclins, thromboxanes, starch cellulose, anti-mullerian hormone, adiponectin, adrenocorticotropic hormone, angiotensinogen, angiotensin, vasopressin, atrial peptide, brain natriuretic peptide, calcitonin, cholecystokinin, adrenocorticotropic hormone-releasing hormone, enkephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastrin, growth hormone-releasing peptide, glucagon, gonadotropin-releasing hormone, growth hormone-releasing hormone, human chorionic gonadotropin, human placental secretagogue, growth hormone, inhibin, insulin. , somatomedin, leptin, lipotropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, prolactin, prolactin-releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid stimulating hormone, testosterone, dehydroepiandrosterone, androstenedione, dihydrotestosterone, aldosterone, estradiol, estrone, estriol, cortisol, progesterone, calcitriol, calcifediol, tamoxifen (Nolvadex), anastrozole (Arimidex), letrozole (Femara), fulvestrant (Faslodex), and combinations thereof.

15. The use according to claim 7, wherein the anti-angiogenic agent is selected from 2-methoxyestradiol, angiostatin, bevacizumab, cartilage-derived angiogenesis inhibitor, endostatin, IFN-α, IL-12, itraconazole, linomide, platelet factor 4, prolactin, SU5416, suramin, tacromonide, tegalan, tetrathiomolybdate, thalidomide, thrombospondin, thrombospondin, TNP-470, zif-aflibercept, pharmaceutically acceptable salts thereof, prodrugs thereof, and combinations thereof.

16. Use according to claim 7, wherein the additional therapeutic agent is an inhibitor of the PI3K / Akt pathway.

17. The use according to claim 16, wherein the inhibitor of the PI3K / Akt pathway is selected from A-674563 (CAS#552325-73-2), AGL 2263, AMG-319, AS-041164 (5-benzo[1,3]dioxazol-5-ylmethylene-thiazolidine-2,4-dione), AS-604850 (5-(2,2-difluoro-benzo[1,3]dioxazol-5-ylmethylene)-thiazolidine-2,4-dione), AS-605240 (5-quinoxaline-6-methylene-1,3-thiazolidine-2,4-dione), AT7867 (CAS#857531-00-1), benzimidazole series, BML-257 (CAS#32387-96-5), BVD-723, CAL-120, CAL- 129. CAL-130, CAL-253, CAL-263, CAS#612847-09-3, CAS#681281-88-9, CAS#75747-14-7, CAS#925681- 41-0, CAS#98510-80-6, CCT128930 (CAS#885499-61-6), CH5132799 (CAS#1007207-67-1), CHR-4432, FPA 124 (CAS#902779-59-3), GS-1101 (CAL-101), GSK 690693 (CAS#937174-76-0), H-89 (CAS#127243-85-0), Honokiol, IC87114, IPI-145, KAR-4139, KAR-4141, KIN-1, KT 5720 (CAS#108068-98-0), miltefosine, MK-2206 dihydrochloride (CAS#1032350-13-2), ML-9 (CAS#105637-50-1), naltrexone hydrochloride, OXY-111A, perifosine, PHT-427 (CAS#1191951-57-1), pictilisib, PIK-90 (CAS#677338-12-4), SC-103980, SF-1126, SH-5, SH-6, tetrahydrocurcumin, TG100-115, triciribine, X-339, XL-499, and pharmaceutically acceptable salts thereof, and combinations thereof.

Images