Sinomenine synthase, preparation method thereof and use thereof in directly generating basic skeleton of morphinan alkaloids from S-annona base

Abstract

The present invention discloses sinomenine synthase, a preparation method thereof, and its use in directly generating the basic skeleton of morphinan alkaloids from S-reticuline, relating to the fields of gene and enzyme engineering, and solving the problem that the isomerization of existing S-reticuline to R-reticuline is a stumbling block in the synthesis of morphinan alkaloids. The sinomenine synthase is included, and the protease comprises an amino acid sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4. The present invention verifies the biological activity of sinomenine synthase and the uniqueness of the substrate (S-reticuline), laying a solid foundation for the synthetic biology research and industrial application of sinomenine, and then realizing the synthesis of sinomenine in Sinomenium acutum, and at the same time providing a new idea for the synthesis of morphinan alkaloids, establishing an efficient and convenient biosynthetic pathway, and also bringing new challenges to synthetic biology.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and enzyme engineering, and more particularly to the technical fields of sinomenine synthase, preparation thereof and application thereof. Background Art

[0002] Morphinan alkaloids refer to alkaloids with a benzylisoquinoline alkaloid as the parent nucleus and a hydrogenated phenanthrene nucleus structure, including alkaloids such as morphine, codeine, heroin, thebaine, sinomenine and sinococuline, etc., which have strong physiological activities and can be used as raw materials for drugs such as analgesics, anti-inflammatory agents, immunosuppressants and anti-cancer agents. However, most plants containing morphinan alkaloids are wild resources, sensitive to growth environmental conditions and have a long growth cycle, so it is difficult to be planted and collected on a large scale, and the production of such drugs from morphinan alkaloids extracted from plants is relatively expensive. In addition, it has always been a difficult point in chemical organic synthesis to establish the chiral center of the benzyl quaternary carbon molecule in its molecular structure. Although many chemists have done a lot of research on morphine synthesis in the past few decades, the costs of most chemical synthesis methods far exceed the costs of products isolated from natural plants. In the past decade, with the rise of synthetic biology, great progress has been made in the synthesis of morphinan alkaloids by microorganisms, and the production of morphinan alkaloids in yeast and Escherichia coli has been achieved. However, due to the long alkaloid synthesis pathway and complex reactions, the yield of the target product is still very low, far from meeting the requirements of industrial production at the technical level.

[0003] The synthesis of morphinan alkaloids has attracted the attention of several generations of scientists due to its complex and extremely challenging molecular structure and biological activity. After more than a century of in-depth research, a generally recognized metabolic pathway for the synthesis of morphine alkaloids in plants has been provided. Although the structures of morphinan alkaloids are complex and diverse, the upstream pathways of the biosynthetic pathways are the same. Tyrosine generates dopamine under the catalysis of tyrosine hydroxylase and tyrosine decarboxylase, and generates 4-hydroxyphenylacetaldehyde through tyrosine aminotransferase. These two compounds undergo a stereoselective P-S reaction under the catalysis of norcoclaurine synthase (NCS) to form S-norcoclaurine, and generate S-N-methylcoclaurine through two methyltransferases, 6-norcoclaurine-O-methyltransferase (6-OMT) and coclaurine-N-methyltransferase (CNMT); then, N-methylcoclaurine-3-hydroxylase (NMCH) generates S-3-hydroxy-N-methylcoclaurine, and 4-O-methyltransferase (4-OMT) catalyzes the generation of S-reticuline, and S-reticuline is converted into R-reticuline by epimerase (REPI).

[0004] In the morphine alkaloid synthesis pathway, S-reticuline must be epimerized by the epimerase REPI to generate R-reticuline. Then, through the action of the P450 enzyme SalSyn, it is coupled to form the basic skeleton of morphine alkaloids. The isomerization of S-reticuline to R-reticuline is a key step in the morphine alkaloid synthesis pathway and has been a stumbling block in morphine alkaloid synthesis for a long time in the past. Summary of the Invention

[0005] The object of the present invention is to solve the problem that in the above-mentioned prior art morphine alkaloid synthesis pathway, the isomerization of S-reticuline to R-reticuline is a stumbling block in morphine alkaloid synthesis. The present invention provides sinomenine synthase, a preparation method thereof, and uses thereof in directly generating the basic skeleton of morphine alkaloids from S-reticuline.

[0006] In order to achieve the above object, the present invention specifically adopts the following technical solutions: sinomenine synthase, the protease comprising an amino acid sequence selected from:

[0007] 1) the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence shown in SEQ ID NO: 3, or the amino acid sequence shown in SEQ ID NO: 4;

[0008] 2) an amino acid sequence obtained by substituting, deleting, or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4; or

[0009] 3) an amino acid sequence having 69%, 79%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0010] In the technical solution of the present application,

[0011] SEQ ID NO: 1

[0012] MEFHLLLQAIATALVTFFLYELWSLRKKITKIITKSKVIKPRYAPMPPGAWPIVGHLPLLVSAKQPHRVFAALAERYGPAFLVRMGKSPMLIVSSREVAKECFTAKDHAFATRPATTAGKLMAYDHAVMGFTPFGTYWRETRKIATVELFSARRLGMLRPVRQSEVSVWVKGLHDLWVQNGKNSVSVELKSQLEELTFNLLMQMVAGKRYYGGNVAKADEEMAGRFRNAVQQFNYHLGNSEMYDALPFLTWMDFKGDAKAMRKTQQDLDYIMQSWLDEHRLKAAEMDGDSNNTRDFLDVLVSMERNGQFSAIKDVDTTIKALALTQLVAGVDSMANTMVWVLALLLSNPEMLGKVQEEIDVNVGKERLVEESDIQNLKYLQAVLKETFRLYPVGPLLVPHEAMEDCHVAGYFVPRGTGLFINAWMIHRDPDVWTEPDRFLPERFLTTHADMEVKGQHYELLPFGAGRRSCPGVGLALQVMHLTLARILQAFELDTLPGAGVDLEESSGILLSMSHPLHVLVQPRLPCELYD

[0013] SEQ ID NO:2

[0014] MEFYSLIQAVATAVVTFFLYELWSLRKKITKILAKSGKITKPKYAPEPPGAWPIIGHLPLLVSANQPHRVFASLAKQYGPVFVLRMGMSPMLIVSSREVAKECFTAKDHAFATRPPTTAGKLMAYDHSVMGFTPFGTYWREIRKIATVELFSARRLGMLRPVRQSEVSVWVKGLHDMWVENGKSSVSVELNSQLEELTFNVLMQMVAGKRYYGGKVAKADEEMAGRFRHAVQQFNYHLGNSEMYDALPFLTWTDFKGDAKAMRKTQQDLDYIMQSWLDEHRLKAAEMGGDSNNNSKDFLDVLVMMEKNGQFSSAIKDVDTTIKALALTQLVAGVDSMANTMVWVLALLLSNPEMLAKVQEEIDVNVGKERLVEESDIPSLKYLQAVLKETFRLYPVGPLLVPHEAMEDCHVAGYFVPRGTGLFINAWMIHRDPDVWTEPDRFLPERFLTTHADMEVKGQHFELLPFGAGRRSCPGVGLALQVMHLTLARILQAFELNTLPGRCVDLEESSGILLSMSHPLHVLVQPRLPCELYD

[0015] SEQ ID NO:3

[0016] MGRSTMLIVSSREVAKECFTAKDHAFATRPSTTAGKLMAYDHSVMGFTPFGTYWREIRKIATVELFSARRLGMLRPVRQSEVSVWVKGLHDMWVANGKSSVSVELKSQLEELTFNVLMQMVAGKRYYGGNVAKADEEMAGRFRHAVQQFNYHLGNSEMYDALPFLTWIDFKGDAKAMRNTQQDLDYIMQSWLDEHRLKAAETGDDSNNSRDFLDVLVSMERNGQFSSAIKDVNTTIKALALTQLVAGVDSMANTMVWVLALLLSNPEMLAKVQEEIDVNVGKKRLVEESDIPNLKYLQAVLKETFRLYPVGPLLVPHEAMEDCHVAGYFVPRGTGLFINAWMIHRDPDVWTEPDRFLPERFLTTHADMEVKGQHYELLPFGAGRRSCPGVGLALQVMHLTLARILQAFELDTLPGAGVDLEESSGILLSMSHPLHVLVQPRLPCELYDGRCVDLEESSGILLSMSHPLHVLVQPRLPCELYD

[0017] SEQ ID NO:4

[0018] MEFIYSLIQTVATAVVTFFLYELWSLRKKITKILAKFGKVTKPKYAPEPPGAWPIIGHLPLLVSANQPHRVFASLAKQYGPVFVLRMGMSPMLIVSSREVAKECFTAKDHAFATRPATTAGKLMAYDHSVMGFTPFGTYWREIRKIATVELFSARRLGMLKPVRQSEVSVWVKGLHDMWVQNGKSSVSVELKSQLEDLTFNVLMQMVAGKRYYGGNVAKADEEMAGRFRHAVQQFNYHLGNSEMYDALPFLTWMDFKGDAKAMRETQQDLDYIMQSWLDEHRLKGAEMGGDSSNNSRDFLDVLVTMERNGQFSSAIKDVDTTIKALALTQLVAGVDSMANTMVWVLALLLSNPEMLSKVQEEIDVNVGKERLVEESDIPNLKYLQAVLKETFRLYPVGPLLVPHEAMEDCHVAGYFVPRGTGLFINAWTIQRDPDVWAEPDRFLPERFLTTHADMDVKGQHYELLPFGAGRRSCPGVGLALQVMHLTLARILQAFELNTHPGVGVDLEESSGILLSMSHPLQVQVAPRLPSELYD

[0019] Due to the particularity of the amino acid sequence, any peptide or protein fragment or its variant containing the amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4, such as its conservative variant, bioactive fragment or derivative, as long as the homology between the peptide or protein fragment, or the peptide or protein variant and the aforementioned amino acid sequence is more than 69%, falls within the scope of protection of the present invention. Specific variants may include deletions, insertions or substitutions of amino acids in the amino acid sequence; among them, for conservative changes of the variant, the substituted amino acid has a structure or chemical property similar to the original amino acid, such as replacing isoleucine with leucine, and the variant may also have non-conservative changes, such as replacing glycine with tryptophan.

[0020] The fragment, derivative or analogue of the peptide or protein according to the present invention refers to a peptide or protein that substantially maintains the same biological function or activity as the carbon-carbon double bond reductase described in the present invention, and may be in the following situations: (I) one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the replaced amino acids may or may not be encoded by genetic codons; (II) a certain group on one or more amino acid residues is replaced by other groups; (III) the mature peptide or protein is fused with another compound (such as a compound that prolongs the half-life of the peptide or protein, for example, polyethylene glycol); (IV) a peptide or protein sequence formed by fusing an additional amino acid sequence to the mature peptide or protein (such as a sequence used to purify this peptide or protein or a proprotein sequence).

[0021] The protein may be a recombinant protein, a natural protein or a synthetic protein, and may be a product of pure natural purification, or a product of chemical synthesis, or produced by recombinant technology from a prokaryotic or eukaryotic host (such as: bacteria, yeast, higher plants, insects and mammalian cells). Depending on the host used in the recombinant production method, the peptide or protein of the present invention may be glycosylated. The peptide or protein of the present invention may also include or not include the starting methionine residue.

[0022] In the technical solution of the present application, the SinSyn gene of Sinomenium acutum is expressed in prokaryotic and eukaryotic expression systems, and the biological activity of sinomenine synthase and the uniqueness of the substrate (S-annonaine) are verified, laying a solid foundation for the synthetic biology research and industrial application of sinomenine and then sinomenine of Sinomenium acutum.

[0023] The present invention also provides an isolated polynucleotide encoding the above-mentioned sinomenine synthase;

[0024] It also includes a polynucleotide sequence with a homology of more than 70% to the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. Due to the particularity of the nucleotide sequence, any variant of the nucleotide sequence shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8, as long as it has a homology of more than 70% to this nucleotide sequence, belongs to the scope of protection of the present invention. The variant of the nucleotide sequence refers to a nucleotide sequence with one or more nucleotide changes. Such variants of the nucleotide sequence include substitution variants, deletion variants and insertion variants. As is known in the art, allelic variants are alternative forms of the nucleotide sequence, which may be substitution, deletion or insertion of the nucleotide sequence, but do not substantially change the function of the encoded peptide or protein.

[0025] In addition, polynucleotides that can hybridize with the nucleotide sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8 (with at least 50% homology, preferably 70% homology) are also within the scope of the present invention, especially polynucleotides that can hybridize with the nucleotide sequences of the present invention under stringent conditions. The "stringent conditions" refer to: (1) hybridization and washing at low ionic strength and high temperature, such as 0.2 SSC, 0.1% SDS, 60 °C; or (2) adding a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum, 0.1% Ficoll, 42 °C; or (3) hybridization occurs only when the homology between the two sequences is at least 95% or better, 97% or more. Moreover, the peptides or proteins encoded by the hybridizable polynucleotides have the same biological functions and activities as the peptides or proteins shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.

[0026] Preferably, the polynucleotide sequence is as shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.

[0027] SEQ ID NO:5

[0028]

[0029] SEQ ID NO:6

[0030]

[0031] SEQ ID NO:7

[0032]

[0033] SEQ ID NO:8

[0034]

[0035] The cloning and amplification primers for the polynucleotide sequence SEQ ID NO:5 of the sabinene synthase are SinSyn F and SinSyn R. The sequence of SinSyn F is shown as (SEQ ID NO:9), and the sequence of SinSyn R is shown as (SEQ ID NO:10). SEQ ID NO:9: ATGGAATTTCATCTGCTGCTGCAG, SEQ ID NO:10: TTAATCATACAGTTCACACGGCAGGC.

[0036] The cloning and amplification primers for the polynucleotide sequence SEQ ID NO:5 of the sabinene synthase are 1-F and 1-R. The cloning and amplification primers for the polynucleotide sequence SEQ ID NO:6 of the sabinene synthase are 2-F and 2-R. The cloning and amplification primers for the polynucleotide sequence SEQ ID NO:7 of the sabinene synthase are 3-F and 3-R. The cloning and amplification primers for the polynucleotide sequence SEQ ID NO:8 of the sabinene synthase are 4-F and 4-R. The sequence of 1-F is shown as SEQ ID NO:11, and the sequence of 1-R is shown as SEQ ID NO:12. The sequence of 2-F is shown as SEQ ID NO:13, and the sequence of 2-R is shown as SEQ ID NO:14. The sequence of 3-F is shown as SEQ ID NO:15, and the sequence of 3-R is shown as SEQ ID NO:16. The sequence of 4-F is shown as SEQ ID NO:17, and the sequence of 4-R is shown as SEQ ID NO:18.

[0037] SEQ ID NO:11: GAATTCATGGAATTTCACTTGCTGTTGCAGGC

[0038] SEQ ID NO:12: CGGCCGCAATCGTACAACTCACAT

[0039] SEQ ID NO:13: GAATTCATGGAATTTTACTCCCTG

[0040] SEQ ID NO:14: CGGCCGCGTCGTACAACTCACATG

[0041] SEQ ID NO:15: GAATTCATGGGTAGATCCACCATG

[0042] SEQ ID NO:16: GCGGCCGCGTCGTACAACTCACAT

[0043] SEQ ID NO:17 GAATTCATGAGGAAGAAGATCACC

[0044] SEQ ID NO:18 CGGCCGCGTCGTACAACTCAGATG。

[0045] The present invention also provides an expression vector, which contains the polynucleotide described above;

[0046] Preferably, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector; preferably, the expression vector is a plasmid vector for a cell-free protein synthesis system.

[0047] The present invention also provides a host cell, which contains the expression vector described above;

[0048] Preferably, the host cell is selected from eukaryotic cells or prokaryotic cells;

[0049] More preferably, the eukaryotic cell is a fungal cell, and even more preferably a yeast;

[0050] More preferably, the prokaryotic cell is selected from Escherichia coli, Mycobacterium, Pseudomonas, Rhodococcus, Arthrobacter, Bacillus subtilis or Actinomyces cells.

[0051] The present invention also provides an in vitro cell-free protein synthesis system, which contains the expression vector described above;

[0052] Preferably, the in vitro cell-free protein synthesis system is a prokaryotic system or a eukaryotic system;

[0053] More preferably, the prokaryotic in vitro cell-free protein synthesis system contains an Escherichia coli extract;

[0054] More preferably, the eukaryotic in vitro cell-free protein synthesis system contains rabbit reticulocyte lysate or malt extract.

[0055] A method for preparing the above-mentioned sinomenine synthase, the method comprising the following steps:

[0056] Culturing the host cell under conditions conducive to the production of the sinomenine synthase, and obtaining the sinomenine synthase from the resulting culture broth; or

[0057] Preparing the sinomenine synthase using the above-mentioned in vitro cell-free protein synthesis system.

[0058] The key point of the present invention is to provide the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4 and the nucleotide sequences shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8. Given the knowledge of these amino acid sequences and nucleotide sequences, the obtaining of these amino acid sequences and nucleotide sequences, as well as the obtaining of related vectors and host cells, will be obvious to those skilled in the art.

[0059] Use of the sinomenine synthase, the polynucleotide, the polynucleotide, the polynucleotide, the expression vector, the host cell or the cell-free protein synthesis system in vitro according to the present invention in the preparation of the basic skeleton of morphinan alkaloids.

[0060] The present invention also provides the use of the sinomenine synthase, the polynucleotide, the expression vector, the host cell or the cell-free protein synthesis system in vitro according to the present invention in the preparation of sinomenine.

[0061] A method for preparing the basic skeleton of morphinan alkaloids, which includes using the sinomenine synthase, the polynucleotide, the polynucleotide, the polynucleotide, the expression vector, the host cell or the cell-free protein synthesis system in vitro to catalyze the redox reaction of S-reticuline to generate the basic skeleton of morphinan alkaloids.

[0062] The present invention also provides a method for preparing sinomenine, which includes using the sinomenine synthase, the polynucleotide, the expression vector, the host cell or the cell-free protein synthesis system in vitro to catalyze the redox reaction of S-reticuline to generate sinomenine.

[0063] Sinomenine is the basic skeleton of morphinan alkaloids. Sinomenine synthase can catalyze S-reticuline to generate sinomenine. Subsequently, sinomenine can generate various morphinan alkaloids through chemical bond rearrangement, cleavage, addition and modification of functional groups, and various redox reactions (such as transfer of methyl, acetyl and carboxyl groups).

[0064] The present invention discovers that an oxidase can catalyze the direct formation of the basic skeleton of morphinan alkaloids from S-reticuline without going through R-reticuline, and the conversion efficiency is also higher than that of the formation of salutaridine from R-reticuline. Erwin reported that the yield of the conversion of reticuline to salutaridine was only 0.024%. After more than 10 years of research, Smolke et al. converted tyrosine to S-reticuline in yeast, analyzed the reasons for the low activity of SalSyn, and modified its N-terminal structure, increasing the conversion rate of R-reticuline to salutaridine by 6 times. The present invention discovers that an oxidase, sinomenine synthase, can directly catalyze the conversion of S-reticuline to sinomenine, and the catalytic efficiency is 3%, which is much higher than the catalytic efficiency of the conversion of R-reticuline to salutaridine.

[0065] The beneficial effects of the present invention are as follows:

[0066] 1. So far, sinomenine has been mainly extracted from Sinomenium acutum. The components of Sinomenium acutum are complex and there are many unknown substances. Using Sinomenium acutum as a raw material to extract sinomenine cannot enter the international market. Producing sinomenine through biosynthesis or chemical synthesis is the only way for world-class drugs. To synthesize sinomenine, sinomenine synthase needs to be obtained first. Ordinary catalysts are difficult to achieve a 180° rotation of the C ring of reticuline and then form sinomenine through ortho-para phenol free radical cyclization. More hope is placed on exploring the enzyme that catalyzes the cyclization of reticuline to form sinomenine. The present invention provides the key sites for the biosynthesis regulation of sinomenine synthase and the key enzyme gene for synthesis, laying a solid foundation for the synthetic biology research and industrial application of sinomenine and then the synthesis of sinomenine in Sinomenium acutum.

[0067] 2. The isomerization of (S)-reticuline to (R)-reticuline must be catalyzed by 1,2-dehydroretidine synthase (DRS) and then converted to the intermediate 1,2-dehydroretidine through 1,2-dehydroreticalinereductase (DRR), which is a difficult and challenging step in the morphine biosynthesis pathway. Through the continuous improvement of the heterologous biosynthesis pathway by scientists, the yield of morphine has increased from 17 μg / L (21) to 55 μg / L, which is much lower than the concentration required for commercial production (5 g / L). Therefore, the isomerization of (S)-reticuline to (R)-reticuline severely limits the industrial production of morphine alkaloids. The sinomenine synthase discovered by the present invention can directly couple with (S)-reticuline instead of (R)-reticuline to form the basic skeleton, realizing the industrial production of morphinan alkaloids. Description of the Drawings

[0068] Figure 1The mechanism of formation of sinomenine from S-annonaine catalyzed by sinomenine synthase of the present invention;

[0069] Figure 2 It is the map of pEASY-Blunt E1-SinSyn vector in Example 2;

[0070] Figure 3 It is the map of pPICZA vector in Example 2;

[0071] Figure 4 It is the gel electrophoresis of amplified SinSyn gene;

[0072] Figure 5 It is the gel electrophoresis of SinSyn colony PCR;

[0073] Figure 6 It is the SDS-PAGE map of SinSyn recombinant protein;

[0074] Figure 7 It is the Western blot map of SinSyn recombinant protein;

[0075] Figure 8 It is the LC-MS detection map of the reaction product of SinSyn catalyzing S-annonaine;

[0076] Figure 9 It is the LC-MS detection map of the reaction product of SinSyn catalyzing R-annonaine. Detailed implementation mode

[0077] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments.

[0078] Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work belong to the scope of protection of the present invention.

[0079] Sinomenine synthase catalyzes the C-C phenol coupling of S-annonaine to form sinomenine, and the sequence similarity of SRS5 in the sinomenine synthase candidate gene supports the formation of methylenedioxy bridge and C-C phenol coupling. Currently, the mechanism of phenol coupling has not been established. The mechanism of formation of sinomenine from S-annonaine catalyzed by sinomenine synthase is shown in Figure 1 .

[0080] Example 1 Discovery and identification of sinomenine synthase SinSyn gene

[0081] 1.1 Gene synthesis of Sinomenine synthase SinSyn gene

[0082] Retrieve the information from the established Sinomenium alkaloid database, transcriptome database and metabolome database, infer the sinomenine synthesis pathway to obtain the candidate gene sequence of sinomenine synthase (shown as SEQ ID NO:1-4), and Anhui General Biology completed the gene synthesis and the construction of the cloning vector. The encoded amino acid sequences are shown as SEQ ID NO:5-8.

[0083] 1.2 Bioinformatics analysis of Sinomenium SinSyn gene

[0084] Analyze the physicochemical properties of the amino acid sequence of the protein encoded by the SinSyn gene through the ExPASy Protparam bioinformatics tool. The analysis results show that the SEQ ID NO:1 gene encodes 532 amino acids, the protein molecular mass is 60.074 kDa, and the predicted protein molecular formula is C 2713 H 4257 N 727 O 758 S 28 , the isoelectric point PI is 6.61; the instability coefficient is 37.44. Generally, a protein with a stability coefficient less than 40 is considered a stable protein. Therefore, SEQ ID NO:1 is a stable protein; the average hydrophilicity is -0.080, which is a hydrophilic protein.

[0085] The SEQ ID NO:2 gene encodes 534 amino acids, the protein molecular mass is 60.19 kDa, and the predicted protein molecular formula is C 2720 H 4259 N 721 O 761 S 30 , the isoelectric point PI is 6.61; the instability coefficient is 39.02. Generally, a protein with a stability coefficient less than 40 is considered a stable protein. Therefore, SEQ ID NO:2 is a stable protein; the average hydrophilicity is -0.069, which is a hydrophilic protein.

[0086] The SEQ ID NO:3 gene encodes 482 amino acids, the protein molecular mass is 54.24 kDa, and the predicted protein molecular formula is C 2418 H 3798 N 658O7 04S 28 , the isoelectric point PI is 5.69; the instability coefficient is 42.16. Generally, a protein with a stability coefficient less than 40 is considered a stable protein. Therefore, SEQ ID NO:3 is an unstable protein; the average hydrophilicity is -0.123, which is a hydrophilic protein.

[0087] The gene of SEQ ID NO:4 encodes 535 amino acids, the molecular mass of the protein is 60.164 kDa, and the deduced molecular formula of the protein is C 2717 H 4245 N 721 O 768 S 27 , the isoelectric point PI is 6.33; the instability coefficient is 38.14. Generally, a protein is considered stable when the stability coefficient is less than 40. Therefore, SEQ ID NO:4 is a stable protein; the average hydrophilicity is -0.083, which means it is a hydrophilic protein.

[0088] The proteins of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 belong to the cytochrome P450 family.

[0089] The signal peptides of Sinomenium acutum SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 proteins were predicted using the online software SignalP-5.0 Server. The C value, S value and Y value tend to be flat and are all less than 0.5. It can be seen that there is no signal peptide in the amino acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 proteins, and SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 proteins are non-secretory proteins.

[0090] Through the hydrophilicity analysis by the online program Prot Scale, it was found that the peptide chains of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 proteins are generally hydrophilic. Therefore, it can be considered that the Sinomenium acutum SinSyn protein belongs to hydrophilic proteins.

[0091] The amino acid sequences of the known P450 family enzymes were aligned with the Sinomenium acutum SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 proteins using DNAMAN. It was found that SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 proteins have similar conserved regions with the P450 family enzymes, and the sequence conservation is relatively high. The phylogenetic tree constructed using MEGA.X shows that SEQ ID NO:1 is closely related to salutaridine synthase (PsSAS) in Papaver somniferum.

[0092] Example 2 Expression, purification and functional verification of SinSyn protein

[0093] 2.1 Materials

[0094] 2.1.1 Expression vector

[0095] The prokaryotic expression vector is from TransGen Biotech Co., Ltd expression vector. The plasmid map of the expression vector is shown in Figure 2 ; The eukaryotic expression vector is the Pichia pastoris expression vector ppiczA. The plasmid map of the expression vector is shown in Figure 3 .

[0096] 2.1.2 Experimental reagents and instruments

[0097] The reagents and instruments used are shown in Table 1 in detail

[0098] Table 1 Main reagents and instruments

[0099]

[0100] 2.1.3 Preparation methods of main solutions

[0101] The preparation methods of the main solutions used in this example

[0102] LB medium: Weigh 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride, add 950 mL of deionized water to dissolve, adjust the pH to 7.0 with 1 M NaOH solution, make up the volume to 1 L with deionized water, and sterilize at 121 °C for 15 min by steam

[0103] LB resistant medium (Amp): Prepare it in the same way as LB medium. When the temperature of the medium drops below 55 °C, add 1 mL of filter-sterilized ampicillin solution (100 mg / mL) and mix well

[0104] LB resistant plate (Amp): Prepare it basically in the same way as LB medium, and also add 15 g of agar powder. When the temperature of the medium drops to about 55 °C, add 1 mL of filter-sterilized ampicillin solution (100 mg / mL), mix well and pour the plate

[0105] LLB resistant medium (Zeocin): Prepare it in the same way as LB medium except that the sodium chloride is halved. When the temperature of the medium drops below 55 °C, add 1 mL of filter-sterilized bleomycin solution (50 mg / mL) and mix well

[0106] LLB resistant plate (Zeocin): Prepare it in the same way as LB medium except that the sodium chloride is halved, and also add 15 g of agar powder. When the temperature of the medium drops to about 55 °C, add 1 mL of filter-sterilized bleomycin solution (50 mg / mL), mix well and pour the plate

[0107] YPD medium: Weigh 20 g of tryptone, 10 g of yeast extract, and 20 g of glucose, and sterilize by steam at 115 °C for 20 min. (Add bleomycin solution (100 mg / mL) to the Zeocin-resistant medium).

[0108] YPD plate: Prepare it in a similar way to the YPD medium, add 20 g of agar powder, and pour the plate when the medium temperature drops to about 60 °C. (Add bleomycin solution (100 mg / mL) to the Zeocin-resistant medium).

[0109] 3M sodium acetate: Weigh 246 g of sodium acetate and dissolve it in 1000 mL of deionized water.

[0110] Coomassie brilliant blue staining solution: Weigh 1 g of Coomassie brilliant blue R-250, add 250 mL of isopropanol, 100 mL of glacial acetic acid, and 650 mL of deionized water successively, and mix well.

[0111] Coomassie brilliant blue decolorizing solution: Measure 100 mL of glacial acetic acid, 50 mL of ethanol, and 850 mL of deionized water, and mix well.

[0112] Binding buffer: 20 mM Tris-HCl, 500 mM NaCl, 5 mM Imidazole, pH 8.0

[0113] Washing buffer: 20 mM Tris-HCl, 500 mM NaCl, 20 mM Imidazole, pH 8.0

[0114] Elution buffer: 20 mM Tris-HCl, 500 mM NaCl, 250 mM Imidazole, pH 8.0

[0115] 3 Experimental methods

[0116] 3.1 Prokaryotic expression of the SinSyn gene

[0117] 3.1.1 Optimization of the target gene codons

[0118] According to the codons preferred for high-level expression in Escherichia coli, optimize the codons of SinSyn and send it to Anhui General Biotechnology Co., Ltd. for sequence synthesis.

[0119] 3.1.2 Amplification of the target gene

[0120] According to the cDNA sequence of the SinSyn gene after codon optimization, design the SinSyn gene amplification primers SinSyn F and SinSyn R using Primer Premier 5.

[0121] SinSyn F: SEQ ID NO:9 ATGGAATTTCATCTGCTGCTGCAG

[0122] SinSyn R: SEQ ID NO:10 TTAATCATACAGTTCACACGGCAGGC

[0123] Using pUC57-SinSyn as a template, SinSyn F and SinSyn R as primers, the reaction system for amplifying SinSyn cDNA is shown in Table 1. The PCR amplification program: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 10 s, extension at 72°C for 30 s, final denaturation at 72°C for 2 min, and the number of cycles is 35.

[0124] Table 1 PCR reaction system

[0125] Table 1 PCR reaction volume

[0126]

[0127] After PCR, take 5 μL of the PCR product and perform electrophoresis using 1% agarose gel. The reaction time is 30 min at 120 V. Observe the electrophoresis results using a gel imaging system.

[0128] 3.1.3 Purification of the target gene

[0129] Take 50 μL of the PCR product, add 1 μL of DMT enzyme, mix well, and incubate at 37°C for 1 h. Purify using the TransGen Biotech purification kit. The specific steps of the PCR Purification Kit are as follows according to the instruction manual:

[0130] (1) Take 50 μL of the PCR product, add 250 μL of Binding buffer, mix well, add it to the centrifugal column, let it stand at room temperature for 1 min, centrifuge at 10000 rmp for 1 min, and discard the effluent.

[0131] (2) Add 650 μL of Wash buffer to the centrifugal column, centrifuge at 10000 rmp for 1 min, and remove the effluent.

[0132] (3) Centrifuge at 10000 rmp for 2 min to completely remove the residual Wash buffer, and open the lid in the laminar flow hood for 5 min to volatilize ethanol.

[0133] (4) Transfer the centrifugal column to a new centrifuge tube, add 40 μL of deionized water to the center of the centrifugal column, let it stand at room temperature for 1 min, centrifuge at 10,000 rmp for 1 min to elute the DNA, and store the eluted DNA at -20 °C for later use.

[0134] 3.1.4 Construction and transformation of E1-SinSyn expression vector

[0135] (1) Construction of expression vector

[0136] Measure the concentration of the purified target fragment with a micro-spectrophotometer, and add 1 μL to the expression vector E1 at a molar ratio of 1:7 into 1 μL E1 Expression Vector, make up the system to 5 μL with sterile water, and react at 25 °C for 15 min.

[0137] (2) Transformation

[0138] (1) Take 2 μL of the ligation product and put it into 50 μL of freshly thawed Trans1-T1 competent cells, gently mix and place on ice, and incubate on ice for 30 min.

[0139] (2) Place the EP tube in a 42 °C water bath for heat shock for 30 s, and then immediately transfer it to ice for 2 min.

[0140] (3) Add 250 μL of antibiotic-free LB medium, place it in a shaker at 200 rpm, and culture at 37 °C for 1 h.

[0141] (4) Take 100 μL of the bacterial solution and spread it evenly on the LB resistant plate, and incubate it overnight at 37 °C in a constant temperature incubator

[0142] 3.1.5 Identification of positive clone vector

[0143] Use T7 F and SinSyn R primers for colony PCR to identify positive clones. The PCR identification program: pre-denaturation at 98 °C for 2 min, denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, final denaturation at 72 °C for 2 min, and the number of cycles is 30. The PCR identification reaction system is as follows:

[0144] Table 2 PCR reaction volume

[0145] Table 2 PCR reaction volume

[0146]

[0147]

[0148] After the PCR was completed, 5 μL of the PCR product was electrophoresed on a 1% agarose gel. The reaction time was 30 min at 120 V. The electrophoresis results were observed using a gel imaging system. The positive clones identified by PCR were inoculated into LB resistant medium and cultured in a constant temperature shaker at 200 rpm and 37 °C for 12 h. The bacterial solution was sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0149] 3.1.6 Extraction of Recombinant Plasmid

[0150] The bacterial solution that was sent for sequencing and matched with the SinSyn gene through Blast on NCBI was added to LB resistant medium and cultured in a constant temperature shaker at 200 rpm and 37 °C for 12 h. The specific steps for plasmid extraction are as follows:

[0151] (1) Take 2 mL of the overnight cultured bacterial solution, centrifuge at 10,000 rmp for 1 min, and aspirate the supernatant completely.

[0152] (2) Add 250 μL of RB (containing RNase A), shake to suspend the bacterial cell pellet.

[0153] (3) Add 250 μL of LB, invert and mix 4 - 6 times to fully lyse the bacterial cells.

[0154] (4) Add 350 μL of NB, mix gently 5 - 6 times until a firm yellow agglomerate is formed, and let it stand at room temperature for 2 min.

[0155] (5) Centrifuge at 12,000 rmp for 5 min, aspirate the supernatant and add it to the centrifugal column, centrifuge at 12,000 rmp for 1 min, and discard the effluent.

[0156] (6) Add 650 μL of WB, centrifuge at 12,000 rmp for 1 min, and discard the effluent.

[0157] (7) Centrifuge at 12,000 rmp for 2 min to completely remove the residual WB.

[0158] (8) Place the centrifugal column in a new centrifuge tube, add 50 μL of 60 °C preheated deionized water to the center of the centrifugal column, and let it stand at room temperature for 1 min.

[0159] (9) Centrifuge at 10,000 rmp for 1 min to elute the DNA, and store the eluted DNA at -20 °C for future use.

[0160] 3.1.7 Inductive Expression of SinSyn Prokaryotic Protein

[0161] For E1-SinSyn was transformed into E. coli BL21 competent cells. Take 100 μL of BL21 competent cells melted on ice, add the target plasmid (10-100 μg) and mix gently, and let it stand on ice for 30 minutes. Heat shock in a 42℃ water bath for 45 seconds, quickly put it back on ice and let it stand for 2 minutes. Add 500 μL of sterile culture medium (LB) without antibiotics to the centrifuge tube, mix well, and resuscitate at 37℃, 200rpm for 60 minutes. Take 100 μL and spread it on the resistant LB culture medium. Culture at 37℃ for 12 hours.

[0162] Pick the transformed monoclone and inoculate it in 3mL of resistant LB medium, and culture it at 200rpm and 37℃ for 12h. Take 500μL of the overnight culture solution and inoculate it in 10mL of resistant LB medium, and culture it at 200rpm and 37℃ until the optical density OD=600. Take 1mL of the culture solution as the pre-induction sample, and collect the precipitate by centrifugation at 10000rmp for 1min. Add 1mM IPTG to the culture solution, culture it at 200rpm and 37℃ for 5h, take 1mL of the culture solution as the post-induction sample, and collect the precipitate by centrifugation at 10000rmp for 1min. Resuspend the precipitate before and after induction with 40μL PBS, and add an equal volume of 2×SDS loading buffer. Heat in boiling water for 5min, and take 20μL of the sample for SDS-PAGE. After the electrophoresis, the gel is stained with Coomassie Brilliant Blue for 3h and decolorized, and observed with a gel imaging system.

[0163] 3.2 Eukaryotic expression of cephalosporin synthase gene

[0164] 3.2.1 Cloning of the cephalosporin synthase gene

[0165] According to the multiple cloning site of ppiczA and the nucleic acid sequence of the candidate gene of fennel synthase, primers 1-F, 1-R, 2-F, 2-R, 3-F, 3-R, 4-F, and 4-R were designed using PrimerPremier 5. The single lower line is an enzyme cutting site (divided into EcoRI and NotI enzyme cutting sites), the sequence of 1-F is shown in SEQ ID NO: 11, and the sequence of 1-R is shown in SEQ ID NO: 12; the sequence of 2-F is shown in SEQ ID NO: 13, and the sequence of 2-R is shown in SEQ ID NO: 14; the sequence of 3-F is shown in SEQ ID NO: 15, and the sequence of 3-R is shown in SEQ ID NO: 16; the sequence of 4-F is shown in SEQ ID NO: 17, and the sequence of 4-R is shown in SEQ ID NO: 18.

[0166] (1-F) SEQ ID NO: 11 GAATTC ATGGAATTTCACTTGCTGTTGCAGGC

[0167] (1-R) SEQ ID NO:12 CGGCCG CAATCGTACAACTCACAT

[0168] (2-F) SEQ ID NO:13 GAATTC ATGGAATTTTACTCCCTG

[0169] (2-R) SEQ ID NO:14 CGGCCG CGTCGTACAACTCACATG

[0170] (3-F) SEQ ID NO:15 GAATTC ATGGGTAGATCCACCATG

[0171] (3-R) SEQ ID NO:16 GCGGCC GCGTCGTACAACTCACAT

[0172] (4-F) SEQ ID NO:17 GAATTC ATGAGGAAGAAGATCACC

[0173] (4-R) SEQ ID NO:18 CGGCC GCGTCGTACAACTCAGATG

[0174] PCR amplification program: pre-denaturation at 98 °C for 2 min, denaturation at 98 °C for 10 s, annealing at 60 °C for 10 s, extension at 72 °C for 30 s, final denaturation at 72 °C for 2 min, and the number of cycles is 35.

[0175] After PCR, take 5 μL of the PCR product and perform electrophoresis on a 1% agarose gel. The reaction time is 30 min at 120 V. Observe the electrophoresis results using a gel imaging system.

[0176] 3.2.2 Vector digestion and purification of the target gene

[0177] Digest the purified target gene and the vector ppiczA with EcoRI and NotI enzymes. The reaction system is shown in Table 2. After mixing, incubate at 37 °C for 4 h. Take 5 μL of the digestion product and perform electrophoresis on a 1% agarose gel. The reaction time is 30 min at 120 V. Observe the electrophoresis results using a gel imaging system.

[0178] Table 2 Digestion reaction volume

[0179] Table 2 Digestion reaction volume

[0180]

[0181] After digestion, the target gene and the vector ppiczA were recovered using the TransGen Biotech kit. For the specific purification steps, see PCR Purification Kit.

[0182] 3.2.3 Construction of ppiczA Expression Vector

[0183] Using T4 DNA ligase, the molar ratio of the purified and recovered ppiczA with sticky ends to the target fragment was controlled between 1:3 and 1:9, and ligation was carried out overnight at 16°C. It was transformed into competent Escherichia coli DH5α, and 100 μL was taken and spread on an LLB plate with Zeocin resistance. Incubate overnight at 37°C.

[0184] 3.2.4 Identification and Plasmid Extraction of Positive Cloning Vectors

[0185] Colony PCR was performed using 5′AOX and 3′AOX primers to identify positive clones. The PCR identification program: pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, final denaturation at 72°C for 2 min, and the number of cycles was 30. After PCR, 5 μL of the PCR product was electrophoresed on a 1% agarose gel. The reaction time was 30 min at 120 V. The electrophoresis results were observed using a gel imaging system. The positive clones identified by PCR were inoculated into an LLB resistant medium, placed in a constant temperature shaker at 200 rpm and cultured at 37°C for 12 h. The bacterial solution was sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. Plasmid extraction was carried out using the TransGen Biotech kit.

[0186] 3.2.5 Linearization of Recombinant Plasmids

[0187] The recombinant plasmid was linearized using SacI, and after mixing, it was incubated at 37°C for 4 h. Take 5 μL of the digested product and electrophorese it on a 1% agarose gel. The reaction time was 30 min at 120 V. The electrophoresis results were observed using a gel imaging system.

[0188] The linear plasmid was recovered by the method of ethanol precipitation and recovery.

[0189] (1) The volume of the digestion reaction solution was amplified to 500 μL with deionized water

[0190] (2) Add 250 μL of phenol and chloroform to it respectively, and invert the centrifuge tube to mix well. Centrifuge at 12000 rpm at 4°C for 2 min, and transfer the supernatant to another clean tube.

[0191] (3) Add an equal volume of chloroform, invert the centrifuge tube to mix well, centrifuge at 12000 rpm at 4°C for 2 min, and transfer the supernatant to another clean tube.

[0192] (4) Add an equal volume of absolute ethanol and one-tenth of NaAc, and precipitate at -20 °C for 1 h.

[0193] (5) Centrifuge at 12,000 rpm for 10 min at 4 °C to collect the precipitate.

[0194] (6) Wash the precipitate with 1 mL of ethanol at room temperature for several minutes, centrifuge at 12,000 rpm for 10 min at 4 °C, and collect the precipitate.

[0195] (7) Air-dry the precipitate naturally and dissolve it in 10 μL of 1×TE for standby.

[0196] 3.2.6 Transformation of recombinant plasmid into Pichia pastoris

[0197] Add 5 - 10 μg of the ppiczA empty vector plasmid and the recombinant plasmid linearized by SacI into 80 μL of GS115 competent cells respectively. After mixing, transfer them into an ice-precooled 0.2 cm electroporation cuvette. After placing on ice for 10 min, perform electroporation. The electroporation parameters are 1.5 kV, 25 μF, and 200 Ω. Immediately add 1 mL of ice-precooled 1 mol / mL sorbitol after electroporation. Pipette 200 μL of the transformation product and spread it on a Zeocin-resistant YPD plate. Incubate at 30 °C statically for 3 - 4 days until white single colonies grow. Select monoclonal colonies and perform colony PCR using 5′AOX and 3′AOX primers to identify positive clones.

[0198] 3.2.7 Induced expression of SinSyn eukaryotic protein

[0199] Respectively pick monoclonal colonies and inoculate them into 5 mL of BMGY medium. Culture overnight at 30 °C in a shaker at 300 rpm. Pipette 200 μL respectively and add them to 50 mL of BMGY. Shake and culture at 30 °C in a water bath shaker at 300 rpm until OD600 = 2 - 6; centrifuge at 1500 - 3000 rmp for 5 min at room temperature to collect the cells; resuspend the cells with BMMY to OD600 = 1.0; add the above culture to a 250 ml shake flask, seal the bottle mouth with two layers of sterilized gauze, place it in a shaker, and induce expression for 4 days. Add methanol to 0.5% at the same time every day. Centrifuge at 10,000 rpm to collect the supernatant and perform SDS-PAGE analysis on the preliminary expression situation.

[0200] After the original bacteria of the preliminary induced expression are activated and cultured, induce expression as above. Add methanol to a final concentration of 0.5% every 24 hours to continue the induction. Take 1 ml of the culture medium at 0 h, 24 h, 48 h, 72 h, and 96 h of the culture time and transfer it to a 1 - 5 ml centrifuge tube. Centrifuge to collect the supernatant for analyzing the expression level and determining the optimal induction time.

[0201] Add 100 μL of 1 M trichloroacetic acid to the collected cell-free expression supernatants, precipitate at 4°C for 30 min, centrifuge at 12,000 rpm to collect the protein precipitate, wash the precipitate twice with 1 mL of acetone each time, collect the protein precipitate and dry it. Dissolve the protein precipitate with 1× SDS-PAGE Loading Buffer, boil in boiling water for 5 min, and then load the sample for SDS-PAGE analysis.

[0202] 3.3 SinSyn Protein Purification and Verification of Its Catalytic Function in Vitro

[0203] 3.3.1 Protein Purification

[0204] Centrifuge the induced 200 mL of protein at 12,000 rpm for 5 min at 4°C, discard the supernatant, and resuspend the cells with 5 mL of 1× PBS. Centrifuge at 12,000 rpm for 5 min at 4°C, discard the supernatant, add 10 mL of Binding Buffer and PMSF with a final concentration of 1 mM, resuspend the cells, and lyse the cells by ultrasonic treatment in an ice bath (the fragmentation time is 15 min, on for 3 s and off for 5 s).

[0205] Both the constructed prokaryotic expression vector and eukaryotic expression vector have a 6×His tag in the constructed vector. The protein is purified by the method of magnetic beads for purifying His-tagged proteins. Use the His Monster Beeds Purification Protocol kit from Kangma Biotech.

[0206] (1) Place the metal ion chelating magnetic beads on a vortex mixer and mix well. Use a pipette to take 20 μL of the magnetic bead suspension into a 2 mL centrifuge tube, perform magnetic separation, discard the supernatant, and remove the centrifuge tube from the magnetic separator.

[0207] (2) Add 1 mL of Binding Buffer to the above centrifuge tube containing the magnetic beads, invert the centrifuge tube several times to resuspend the magnetic beads, perform magnetic separation, and remove the supernatant. Repeat the washing 3 times.

[0208] (3) Add 1 mL of the cell lysate supernatant to the above centrifuge tube and incubate at 4°C on a vortex mixer for 1 h.

[0209] (4) Place the centrifuge tube on the magnetic separator for magnetic separation, transfer the supernatant to a new centrifuge tube for subsequent detection.

[0210] (5) Add 1 mL of Washing Buffer to the centrifuge tube containing the magnetic beads, gently invert the centrifuge tube several times to suspend the magnetic beads, perform magnetic separation, transfer the washing solution to a new centrifuge tube for sampling and detection. Repeat the washing 3 times.

[0211] (6) Add 50 - 100 μL of Elution Buffer, gently invert the centrifuge tube several times to suspend the magnetic beads, perform magnetic separation, and collect the eluate into a new centrifuge tube, which is the purified target protein sample.

[0212] 3.3.2 In vitro enzyme activity assay

[0213] Refer to the method reported by Fisher M and Gesell Andreas [1-2] For the enzyme-catalyzed reaction, take 10 μL of the purified SinSyn recombinant protein solution, add MES-NaOH buffer to a final concentration of 50 mmol / L, add 0.1 mmol / L NADPH, and finally add 0.1 mmol / L of the substrates ((S)-reticuline and (R)-reticuline), and incubate at 37 °C for 3 h. The enzyme-catalyzed product (Sinoacutine) was detected by LC-MS.

[0214] 3.3.3 Detection of the catalytic product

[0215] The catalytic product using S-sinoacutine as the substrate was detected by LC-MS / MS. Chromatographic conditions: Chromatographic column: Agilent Poroshell 120 EC-C18 3.0×100 mm, 2.7 μm; Mobile phase A: 0.1% formic acid in water, Mobile phase B: methanol, Detector DAD parameters: 210 nm; Column temperature: 30 °C; Injection volume: 10 μL; Elution program: 5 min A: 95%; 5 - 20 min A: 95% - 5%; 20 - 30 min A: 5%. Mass spectrometry conditions: Electrospray ionization source (ESI); Capillary voltage: 3.5 kV; Dry gas temperature: 300 °C; Dry gas flow rate: 11 L / min; Fragmentation voltage: 500 V; Positive ion mode scanning detection, First-stage mass spectrometry scanning range: m / z 100 - 1000;

[0216] 4 Results and analysis

[0217] 4.1 SinSyn gene PCR amplification

[0218] Using the SinSyn gene cloning vector plasmid as a template, PCR amplification was performed with the SinSyn F and SinSyn R amplification primers of SinSyn. The agarose gel electrophoresis pattern is as shown in Figure 4 ( Figure 4 in, Line 1: Marker; Line2 - 4: SinSyn), and the length of the target fragment was 1596 bp after sequencing and identification.

[0219] 4.2 Expression vector construction and identification

[0220] SinSyn Gene and Expression Vector After ligation with E1, the recombinant vector was transformed into Escherichia coli Trans1-T1 competent cells, and screened using Amp-resistant plates. Single colonies were picked for colony PCR detection, and the results of colony PCR were detected by 1% agarose gel electrophoresis as shown in Figure 5 ( Figure 5 In it, Line 1: Marker; Line 2-5: SinSyn;). The correctly identified recombinant plasmid was sent to Tsingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the SinSyn gene was successfully inserted into the E1 expression vector.

[0221] 4.3 SDS-PAGE Detection and Western Blot of SinSyn Protein

[0222] The broken protein induced by IPTG was analyzed by SDS-PAGE. The SDS-PAGE results are as shown in Figure 6 ( Figure 6 In it, M: Marker; Line 1: crude protein; Line 2: supernatant of broken protein; Line 3: negative control), showing that the SinSyn recombinant protein was successfully expressed, with a molecular weight of approximately 60.0 KDa. Protein was obtained from the supernatant of the broken protein, and SinSyn was a soluble protein. The results of Western blot of the recombinant protein are as shown in Figure 7 ( Figure 7 In it, M: Marker; Line 1: crude protein; Line 2: supernatant of broken protein; Line 3: negative control).

[0223] 4.4 Catalytic Experiment and Detection of SinSyn Protease

[0224] To verify whether the recombinant protein of the candidate gene of sinomenine synthase generates sinomenine through S-annonaine or R-annonaine, S-annonaine and R-annonaine were used as catalytic substrates respectively, NADPH and MES buffer were added, and the reaction was carried out at 37 °C for 3 h. The enzyme-catalyzed products were detected by LC-MS. The results showed that it could catalyze S-annonaine to generate sinomenine. As shown in Figure 8 , Figure 9, in the liquid chromatography-mass spectrometry chromatogram of the catalytic product, a characteristic peak of the catalytic substrate S-annonaine appeared at 12.259 min, and a characteristic peak of the expected product sinomenine appeared at 11.430 min. The mass spectrometry of sinomenine in the catalytic product showed that the corresponding characteristic ions (m / z) were 328.3 respectively. However, R-annonaine did not generate sinomenine. It was verified that the basic firmware of morphine alkaloids could be synthesized directly from S-annonaine without passing through R-annonaine.

Claims

1. Sinomenine synthase, characterized in that, The amino acid sequence of the synthase: The amino acid sequence shown in SEQ ID NO:

1.

2. An expression vector comprising a polynucleotide encoding the sinomenine synthase according to claim 1; The expression vector is a eukaryotic expression vector or a prokaryotic expression vector; the expression vector is a plasmid vector for a cell-free protein synthesis system.

3. A host cell comprising the expression vector according to claim 2; The host cell is selected from fungal cells or prokaryotic cells.

4. A host cell according to claim 3, characterized in that: The fungal cell is yeast.

5. A host cell according to claim 3, characterized in that: The prokaryotic cell is selected from Escherichia coli, Mycobacterium, Pseudomonas, Rhodococcus, Arthrobacter, Bacillus subtilis or Actinomyces cells.

6. An in vitro cell-free protein synthesis system comprising the expression vector according to claim 2.

7. An in vitro cell-free protein synthesis system according to claim 6, characterized in that: The in vitro cell-free protein synthesis system is a prokaryotic system or a eukaryotic system.

8. An in vitro cell-free protein synthesis system according to claim 7, wherein: The prokaryotic in vitro cell-free protein synthesis system comprises an Escherichia coli extract; or The eukaryotic in vitro cell-free protein synthesis system comprises rabbit reticulocyte lysate or malt extract.

9. A method for preparing the sinomenine synthase according to claim 1, the method comprising the following steps: Culturing the host cell according to any one of claims 3-5 under conditions conducive to the production of the sinomenine synthase, and obtaining the sinomenine synthase from the resulting culture broth; or Preparing the sinomenine synthase using the in vitro cell-free protein synthesis system according to any one of claims 6-8.

10. Use of the sinomenine synthase according to claim 1, the expression vector according to claim 2, the host cell according to any one of claims 3-5, or the in vitro cell-free protein synthesis system according to any one of claims 6-8 in the preparation of sinomenine.

11. A method for preparing sinomenine, which comprises using the sinomenine synthase according to claim 1, the expression vector according to claim 2, the host cell according to any one of claims 3-5, or the in vitro cell-free protein synthesis system according to any one of claims 6-8 to catalyze the redox reaction of S-annonaine to produce sinomenine.

Images