Application of xCas12a protein or related biomaterials

Abstract

The present invention discloses the application of xCas12a protein or its related biomaterial. The xCas12a protein is any of the following proteins: (a1) a protein having an amino acid sequence of SEQ ID No.1; (a2) a protein having the same function by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No.1; (a3) ​​a protein having more than 70% identity with any of the amino acid sequences defined in (a1)-(a2) and having the same function; (a4) a fusion protein obtained by connecting a tag to the end of any of the proteins defined in (a1)-(a3). The xCas12a protein exhibits high editing activity both in eukaryotic cells and in vitro.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to the application of xCas12a protein or related biomaterials thereof. Background Art

[0002] Gene editing is a genetic engineering technology that modifies specific target genes in the genome of an organism. The application of this technology has stimulated the vigorous development of various research fields in medicine and biology. The research on gene editing technology has been advancing, from homing nucleases, zinc finger nucleases (ZFN) to TALEN. These tools have shown their effectiveness in different genome editing applications. However, these tools are not only cumbersome and expensive to construct, but also have low editing efficiency. With the emergence of the revolutionary CRISPR-Cas system, the level and scope of application of gene editing tools have been greatly improved, making the concept of gene therapy possible.

[0003] CRISPR is a clustered regularly interspaced short palindromic repeat sequence in the genomes of bacteria and archaea, which constitutes their adaptive immune system and protects them from foreign mobile genetic elements. CRISPR-Cas immunity involves three major sequential steps: adaptation, expression / maturation, and interference, each of which requires a specific Cas protein encoded by the Cas gene near the CRISPR array, as well as other auxiliary proteins. When exogenous nucleic acids invade bacteria and archaea, they are recognized by the Cas protein and integrated into the CRISPR array. When exogenous nucleic acids infect again, the CRISPR adaptive immune system is activated, expressing CRISPRRNA (crRNA) and Cas protein, and forming an effector complex. After the effector complex recognizes the PAM (protospacer adjacent motif) sequence adjacent to the target DNA, complementarity is formed between the crRNA and the target sequence, ultimately achieving specific cutting of the target DNA.

[0004] CRISPR-Cas systems are divided into two categories (type 1 and type 2), which are further divided into six types (type I to type VI). Type 1 (type I, type III, and type IV) CRISPR-Cas systems use multiple Cas proteins to destroy exogenous nucleic acids, while type 2 systems (type II, type V, and type VI) only require a single Cas protein. Type 1 CRISPR-Cas systems are most commonly found in bacteria and archaea, accounting for about 90% of all identified CRISPR-Cas loci, and the remaining approximately 10% of type 2 CRISPR-Cas systems are almost entirely found in bacteria. Currently, the most widely studied and applied CRISPR-Cas9 system was discovered in Streptococcus pyogenes and belongs to type II-A of type 2. Cas9 is the first Cas protein used for gene editing. It has been widely used in different species such as animals, plants, and prokaryotes, and has derived many related biotechnologies. With the deepening of application and research, people have also discovered the shortcomings of the CRISPR-Cas9 system. First, the CRISPR-Cas9 system has obvious off-target effects. The effector complex formed by Cas9 and sgRNA can still cut when there is a single or multiple mismatch when recognizing the target sequence. The off-target effect of CRISPR-Cas9 seriously limits its clinical use. Secondly, the PAM sequence is limited. Since the Cas9 protein can only play a cutting role after recognizing a specific PAM sequence, the position that can be designed as a target sequence is limited, which directly affects the scope of application of the CRISPR-Cas9 system. A large number of studies have shown that the CRISPR-Cas9 system can cause instability in the cell genome and chromosomes. In addition, the Cas9 protein can also activate the p53 gene, thereby inducing cell apoptosis. These problems that need to be solved urgently have also promoted the development of new gene editing tools.

[0005] With the massive generation of microbial sequencing data, a new genome editing system has been identified in these data, such as the VA-encoded protein Cas12a (also known as Cpf1) belonging to Class 2. Cas12a has been successfully edited in mammals (humans, mice), plants (rice, tobacco) and prokaryotes. Compared with Cas9, Cas12a not only has high cutting efficiency, but also low off-target rate; Cas12a only needs a simple structure and short sequence crRNA to work. At the same time, connecting multiple crRNAs in series can achieve multiple editing, greatly reducing the difficulty of multiple editing. In addition, Cas12a recognizes T-rich PAM sequences, while Cas9 prefers G-rich PAM sequences, enriching the editable range of the CRISPR system. Although Cas12a has shown powerful functions, there is still room for performance improvement. Screening and identifying new Cas12a proteins with superior performance is of great significance to the field of gene editing. Summary of the invention

[0006] One of the purposes of the present invention is to provide an application of Cas12a protein.

[0007] The application of the xCas12a protein or its related biomaterial provided by the present invention in any of the following:

[0008] (1) Gene editing, such as single gene knockout and / or simultaneous editing of multiple genes;

[0009] (2) Gene therapy;

[0010] (3) Nucleic acid testing;

[0011] (4) Disease diagnosis;

[0012] (5) Preparation of gene-edited products;

[0013] (6) Preparation of gene therapy products;

[0014] (7) Preparation of products for nucleic acid testing;

[0015] (8) Preparation of products for disease diagnosis;

[0016] The xCas12a protein is any of the following proteins:

[0017] (a1) a protein having an amino acid sequence of SEQ ID No. 1;

[0018] (a2) a protein having the same function as the amino acid sequence shown in SEQ ID No. 1 after one or more amino acid residues are substituted and / or deleted and / or added;

[0019] (a3) a protein having an amino acid sequence identity of 70% or more to any one of (a1) to (a2) and having the same function;

[0020] (a4) A fusion protein obtained by connecting a tag to the end of the protein defined in any one of (a1) to (a3).

[0021] Optionally, according to the above application, the related biological material is any one of the following:

[0022] c1) a nucleic acid molecule encoding the above-mentioned xCas12a protein;

[0023] c2) an expression cassette containing the nucleic acid molecule described in c1);

[0024] c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2);

[0025] c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).

[0026] Optionally, according to the above application, the nucleic acid molecule in c1) is any of the following DNA molecules:

[0027] d1) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.2, positions 1553-5386 in the sequence listing;

[0028] d2) a DNA molecule having 80% or more identity with the nucleotide sequence defined in d1) and encoding the xCas12a protein;

[0029] d3) hybridizes with the nucleotide sequence defined in d1) under stringent conditions and encodes a DNA molecule of the xCas12a protein.

[0030] Optionally, according to the above application, c2) the expression cassette is a DNA molecule whose nucleotide sequence is shown in positions 296-5386 of SEQ ID NO.2 in the sequence listing;

[0031] Optionally, according to the above application, c3) the recombinant vector also includes a nucleic acid molecule encoding crRNA and a promoter driving the expression of the nucleic acid molecule encoding crRNA.

[0032] c3) The recombinant vector can be driven by the EF-1α promoter to express XCas12a, and the U6 promoter to express crRNA, which can be used for mammalian cell gene editing. c3) The recombinant vector can also be driven by the EF-1α promoter to express XCas12a, and the triplex promoter to express multi-crRNA.

[0033] c3) The recombinant vector may be pcd-xCas12a constructed in the following example. The pcd-xCas12a sequence may be as shown in SEQ ID No. 2, wherein the target sequence at positions 270-289 may be replaced with a target sequence corresponding to any target sequence, such as the target sequence shown in SEQ ID No. 6, SEQ ID No. 7 or SEQ ID No. 8 in the following example.

[0034] The above-mentioned xCas12a protein belongs to the protection scope of the present invention.

[0035] The above-mentioned xCas12a protein-related biological materials also fall within the scope of protection of the present invention.

[0036] The present invention also provides a CRISPR / Cas12a gene editing system, comprising the above-mentioned xCas12a protein or the above-mentioned xCas12a protein-related biological material.

[0037] The present invention also provides a library for PAM sequence identification, comprising a double-stranded DNA molecule as shown in SEQ ID No.3.

[0038] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0039] In the above protein, the tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0040] Herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website.

[0041] Herein, the 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0042] Herein, the 70% or greater identity may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0043] Herein, the stringent conditions may be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

[0044] The present invention uses bioinformatics, biochemistry, molecular biology and cell biology techniques to screen out a new type of Cas12a protein with excellent editing performance from a microbial database, named xCas12a. xCas12a shows high editing activity both in eukaryotic cells and in vitro; the xCas12a PAM type is "NYYN", Y is the base "T" or "C", N is the base "A", "T", "G" or "C", rather than the typical "TTTN", which has low restrictions on the PAM sequence and expands the editable area. In addition, the present invention verifies the trans activity of xCas12a, which can be used for nucleic acid detection. The new xCas12a protein provided by the present invention provides efficient and accurate tools for research fields such as gene editing, gene therapy, and gene detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Phylogenetic tree of xCas12a homologous proteins.

[0046] Figure 2 For prokaryotic expression and purification of xCas12a.

[0047] Figure 3 In vitro functional verification of xCas12a.

[0048] Figure 4 Validation of single gene target editing by xCas12a in 293T cell line.

[0049] Figure 5 is the PAM sequence of xCas12a.

[0050] Figure 6 Detection of influenza A virus nucleic acid by xCas12a. DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0052] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0053] 293T cells (CRL-3216, ATCC) were obtained from the American Type Culture Collection.

[0054] All plasmids were obtained from the Cardiovascular Development Laboratory, Institute of Molecular Medicine, School of Future Technology, Peking University.

[0055] The synthesis of the xCas12a gene sequence was completed by Beijing Ruiboxingke Biotechnology Co., Ltd.

[0056] IPTG (A100487, Sangon), ampicillin (A100339, Sangon), kanamycin (A100408, Sangon), and oligo primers were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.

[0057] Rapid plasmid mini-preparation kit (DP105, Tiangen), endotoxin-free plasmid mini-preparation midi kit (DP118, Tiangen), DH5α competent cells (CB101, Tiangen), and BL21 (DE3) competent cells (CB105, Tiangen) were all purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0058] PCR product purification kit (28104, Qiagen) was purchased from Qiagen.

[0059] High-fidelity DNA polymerase (P515, Vazyme), Taq DNA polymerase (P222, Vazyme), directional cloning kit (C115, Vazyme), cell genome extraction kit (DC112, vazyme), transfection reagent (T101, Vazyme), and DNA library construction kit (ND617, Vazyme) were all purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0060] Monarch RNA purification kit (T2040L, NEB), HiScribe TM T7 rapid and efficient RNA synthesis kit (E2050S, NEB), T4 polynucleotide kinase (M0201S, NEB), T7 endonuclease I (M0302L, NEB), and restriction endonucleases were purchased from NEB (Beijing) Co., Ltd.

[0061] DNA Ligation Kit (6022, Takara) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0062] The RNA virus extraction kit was purchased from Changzhou Jinmaige Biotechnology Co., Ltd.

[0063] The RNA reverse transcription kit (1119ES60, Yeasen) was purchased from Yeasen Biotechnology (Shanghai) Co., Ltd.

[0064] Example 1. Preparation and functional verification of xCas12a protein

[0065] 1. Construct a phylogenetic tree of Cas12a.

[0066] Different Cas12a protein sequences were collected from existing databases, and the xCas12a protein sequence (sequence shown in SEQ ID No. 1) was added to construct a phylogenetic tree, and the parentage relationship between xCas12a and known Cas12a proteins was analyzed and compared. The results are shown in Figure 1 shown.

[0067] The results of protein amino acid sequence analysis showed that xCas12a is most closely related to AsCas12a (Acidaminococcus sp, AsCpf1), but the identity and similarity of the amino acid sequence of XCas12a and AsCas12a are 35.54% and 49.23%, respectively.

[0068] 2. Prokaryotic expression and purification of xCas12a

[0069] First, the xCas12a gene (sequence as shown in positions 1553-5386 of SEQ ID No. 2) was cloned into the pET28a vector to obtain the plasmid pET28a-xCas12a; the plasmid pET28a-xCas12a was chemically transformed into BL21 (DE3) competent cells to construct the xCas12a expression strain; the xCas12a expression strain was inoculated into ampicillin-resistant LB (final concentration 50 μg / mL) liquid culture medium, and the bacteria were cultured at a temperature of 37°C and a rotation speed of 220 rpm until the OD 600 The method comprises the following steps: adding IPTG (final concentration of 50 μg / mL) to induce protein expression of the strain, adjusting the culture conditions to 20°C and 120 rpm, and continuing to culture for 20 hours; collecting the bacteria using a high-speed refrigerated centrifuge at 4°C, 8000 rpm and 5 min, washing the bacteria once with pre-cooled PBS, and resuspending the bacteria with binding buffer; lysing the bacteria using a cell high-pressure crusher at 4°C and 700 Mp until clear; separating the supernatant and the precipitate using a high-speed refrigerated centrifuge at 4°C, 8000 rpm and 10 min; purifying the lysate supernatant using a nickel affinity chromatography column; purifying the purified protein using a dextran gel molecular sieve and replacing the buffer, adding glycerol (final concentration of 50%) and storing it in a -40°C refrigerator.

[0070] The primers used to construct the pET28a-xCas12a protein expression vector (underlined homology arms) are as follows:

[0071] Forward Primer:

[0072] 5'- CAAATGGGTCGCGGATCCGAATTC ATGCATAATCTGGAGCTGTTC-3' (SEQ ID NO: 4);

[0073] Reverse Primer:

[0074] 5'- GTGGTGGTGGTGGTGCTCGAG TTTGGCGGAGTTTCTTTCCTG-3'

[0075] (SEQ ID NO:5).

[0076] The results of the xCas12a prokaryotic expression and purification experiments are shown in Figure 2 As shown, lane 1 is a protein marker, lane 2 is an uninduced whole bacterial protein, lane 3 is a whole bacterial protein after IPTG induction, and lane 5 is an xCas12a protein purified by a nickel column. The results show that the xCas12a protein purified by the present invention has high purity and meets the use of the present invention.

[0077] 3. In vitro functional verification of xCas12a

[0078] First, the crRNA transcription template sequence was synthesized (the sequence was as shown in SEQ ID NO: 15, wherein positions 1-17 were T7 promoter, positions 21-39 were crRNA backbone, and positions 40-62 were EMX1-target), and then the crRNA was transcribed in vitro using T7 RNA synthesis reagent, and high-quality crRNA was obtained using RNA purification reagent; the target DNA fragment was amplified using high-fidelity DNA polymerase (the sequence was shown in SEQ ID No. 20), and a high-purity target DNA fragment was obtained by PCR product purification; xCas12a (100 nM), crRNA (100 nM), target DNA fragment (400 ng) and NEB buffer 2 were mixed, incubated at 37 ° C, and samples were taken at 0, 15, 30, and 60 min of incubation, inactivated at 65 ° C for 5 min, and 10 μL was taken for agarose gel analysis.

[0079] Agarose gel analysis results Figure 3 As shown, uncut is the band where the target DNA fragment is not cut, and cut is the band where the target DNA fragment is cut, indicating that xCas12a can effectively cut the target DNA fragment at 37°C.

[0080] Example 2: Verification of single gene target editing by xCas12a in 293T cell line

[0081] Validation of xCas12a editing function in 293T cell line, sequences of selected gene targets.

[0082] EMX1 gene (GenBank assembly accession: GCA_000001405.29Gene ID: 2016, sequence as shown in SEQ ID NO: 19) Target sequence: TCATCTGTGCCCCTCCCTCC (SEQ ID NO: 6)

[0083] GRIN2B gene (GenBank assembly accession: GCA_000001405.29Gene ID: 2904, sequence as shown in SEQ ID NO: 20) Target sequence: GTGCTCAATGAAAGGAGATA (SEQ ID NO: 7)

[0084] VEGFA gene (GenBank assembly accession: GCA_000001405.29Gene ID: 7422, sequence as shown in SEQ ID NO: 21) Target sequence: CCTGCCCCCTTCAATATTCC (SEQ ID NO: 8)

[0085] Primer sequences used to amplify the EMX1 gene fragment.

[0086] Forward primer: 5′-CCATCCCCTTCTGTGAATGT-3′ (SEQ ID NO: 9);

[0087] Reverse primer: 5'-ATCACTAAACTACAGTGGTGCCTG-3' (SEQ ID NO: 10).

[0088] Primer sequences used to amplify the GRIN2B gene fragment.

[0089] Forward primer: 5'-GCATACTCGCATGGCTACCT-3' (SEQ ID NO: 11);

[0090] Reverse primer: 5'-CTCCCTGCAGCCCCTTTTTA-3' (SEQ ID NO: 12).

[0091] Primer sequences used to amplify the VEGFA gene fragment.

[0092] Forward primer: 5′-CTCAGCTCCACAAACTTGGTGCC-3′ (SEQ ID NO: 13);

[0093] Reverse primer: 5'-AGCCCGCCGCAATGAAGG-3' (SEQ ID NO: 14).

[0094] 293T cells were evenly spread in a 12-well cell plate, and plasmid transfection was performed when the cell density grew to 80%; the pcd-xCas12a eukaryotic expression plasmid and the empty plasmid (negative control) were packaged with a transfection reagent according to the recommended ratio, and then evenly added to the cells after completion; after the cells grew for 24 hours, the culture medium was discarded, the cells were washed once with PBS, and the cells were resuspended and dispersed by blowing; positive cells expressing xCas12a were picked out using a flow sorter, and the genomes of positive cells and negative control cells were extracted respectively; the genome of the cell was used as a template, and the above-mentioned primers were used to amplify the target gene DNA fragment; the target gene DNA fragment was denatured, annealed and hybridized, and the editing efficiency was detected with T7EN1 enzyme.

[0095] The pcd-xCas12a eukaryotic expression plasmid comprises an EF-1α promoter driving the expression of XCas12a, and a U6 promoter driving the expression of crRNA, and its sequence is shown in SEQ ID No. 2, wherein positions 1-241 are U6 promoters (U6 promoter), positions 251-269 are repeat sequences (Direct Repeats, DR), positions 270-289 are target sequences, and N is a base A, T, G or C. (The pcd-xCas12a eukaryotic expression plasmid corresponding to the EMX1 gene is obtained by replacing positions 270-289 N with the sequence shown in SEQ ID No. 6, the pcd-xCas12a eukaryotic expression plasmid corresponding to the GRIN2B gene is obtained by replacing positions 270-289 N with the sequence shown in SEQ ID No. 7, and the pcd-xCas12a eukaryotic expression plasmid corresponding to the VEGFA gene is obtained by replacing positions 270-289 N with SEQ ID No.8), positions 296-1469 are EF-1α promoter, positions 1499-1546 are nuclear localization signal sequence (NLS sequence), positions 1553-5386 are XCas12a gene, and positions 5399-5446 are NLS sequence. pcd-xCas12a expresses xCas12a and crRNA.

[0096] Agarose gel analysis results Figure 4 As shown, uncut is the band where the target DNA fragment is not cut, cut is the band where the target DNA fragment is cut, "+" is the XCas12a gene editing experimental group, and "-" is the negative control group. The results show that xCas12a can effectively perform gene editing in the 293T cell line.

[0097] Example 3, PAM sequence identification of xCas12a

[0098] In order to identify the PAM sequence recognizable by xCas12a, the PAM region sequence of the target DNA fragment was randomly mutated, and the mutated target DNA fragment was subjected to second-generation sequencing to construct a library.

[0099] The DNA library is shown in SEQ ID No. 3, wherein positions 1-65 are Adapter-for Illumina, N at positions 165-168 is base A, T, G or C, positions 169-188 are target DNA (target), and positions 298-358 are Adapter-for Illumina.

[0100] Under in vitro reaction conditions, xCas12a (200 nM), crRNA (200 nM), DNA library (500 ng) and NEBbuffer2 were mixed, incubated at 37 ° C for 60 min, and inactivated at 65 ° C for 5 min; all the reaction products were added to agarose gel, and after electrophoresis, the uncut fragments were recovered; the uncut fragments were subjected to second-generation sequencing, with a total data volume of 2G; the second-generation sequencing data were analyzed to compare the cutting efficiency of different types of PAM; and a PAM sequence motif map recognizable by XCas12a was drawn.

[0101] Motif picture Figure 5 As shown, it shows that the PAM sequence of XCas12a is of the "NYYN" type.

[0102] Example 4: xCas12a is used for influenza A virus detection

[0103] First, the RNA of influenza A virus was extracted by magnetic bead method. 10 μL proteinase K, 4 μL precipitation aid, 300 μL lysis solution, 20 μL magnetic beads were added to a 1.5 mL nuclease-free centrifuge tube, and 200 μL inactivated influenza A virus was added. Each centrifuge tube was shaken and mixed, and then inverted and mixed at room temperature for 10 minutes to allow the magnetic beads and nucleic acid to fully combine. The liquid in the tube cover was collected by brief centrifugation, and then the centrifuge tube was placed on a magnetic rack for 30 seconds. After the magnetic beads were completely adsorbed, the liquid inside was aspirated with a pipette, and then 500 μL washing solution was added to wash the magnetic beads twice. The centrifuge tube was placed on a magnetic rack, the liquid inside was aspirated, and it was dried at room temperature for 10 to 15 minutes. Finally, 50 μL RNase free water was added to elute the RNA, and the extracted RNA concentration and purity were detected using NanoDrop One instrument.

[0104] The viral RNA was reverse transcribed into cDNA using a reverse transcriptase kit. The reverse transcription reaction system is: viral RNA (no more than 1 μg), 5× reverse transcription buffer (4 μL), FluA Primers (2 μM), reverse transcriptase (2 μL). React at 42°C for 20 minutes to obtain the viral cDNA. cDNA was used as the positive template and nuclease-free water as the negative template (NC). After PCR amplification, it was added to the xCas12a detection system. The specific PCR amplification primer sequences used for influenza A virus detection are as follows:

[0105] Forward primer: 5'-GACAAGACCAATYYTGTCAC-3' (SEQ ID NO: 16);

[0106] Reverse primer: 5'-CGTCTACGCTGCAGTCCTCG-3' (SEQ ID NO: 17).

[0107] In the xCas12a detection system, DNA fragments (not exceeding 1 / 5 of the total reaction volume), Xcas12a (100 nM), crRNA (100 nM), and CutSmart Buffer (1×) were added and mixed, incubated at 37°C for 5 min, ssDNAReporter (100 nM) was added, and detection was performed using the ABI 7500 Real-Time PCR System at 37°C.

[0108] crRNA sequences used for influenza A virus detection:

[0109] 5'-AAUUUCUACUAUGGUAGAUACUAAGGGGAUUUUAGGGUU-3' (SEQ ID NO: 18).

[0110] ssDNA reporter sequence: 5'-FAM-TTTTTT-BHQ1-3'

[0111] The results are as follows Figure 6 As shown, xCas12a has trans activity, can cut ssDNA Reporter to stimulate fluorescence, and can detect influenza A virus, which also shows that xCas12a can be used for nucleic acid detection.

[0112] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of xCas12a protein or its related biomaterials for non-disease diagnosis and treatment purposes in any of the following: (1) Gene editing; (2) Nucleic acid testing; (3) Preparation of gene-edited products; (4) Preparation of gene therapy products; (5) Preparation of products for nucleic acid testing; (6) Preparation of products for disease diagnosis; The xCas12a protein is any of the following proteins: (a1) a protein having an amino acid sequence of SEQ ID No. 1; (a2) A fusion protein obtained by connecting a tag to the end of the protein defined in (a1); The relevant biological material is any of the following: c1) a nucleic acid molecule encoding the xCas12a protein; c2) an expression cassette containing the nucleic acid molecule described in c1); c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).

2. The use according to claim 1, characterized in that: c1) The nucleic acid molecule is any of the following DNA molecules: d1) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.2, positions 1553-5386 in the sequence listing; d2) a DNA molecule having 80% or more identity with the nucleotide sequence defined in d1) and encoding the xCas12a protein; d3) hybridizes with the nucleotide sequence defined in d1) under stringent conditions and encodes a DNA molecule of the xCas12a protein.

3. The use according to claim 1, characterized in that: c2) The expression cassette is a DNA molecule whose nucleotide sequence is shown in positions 296-5386 of SEQ ID NO.2 in the sequence listing.

4. The use according to claim 1, characterized in that: c3) The recombinant vector also includes a nucleic acid molecule encoding crRNA and a promoter driving the expression of the nucleic acid molecule encoding crRNA.

5. The xCas12a protein described in claim 1.

6. Biomaterials related to xCas12a protein; characterized in that: The relevant biological material is any of the following: c1) a nucleic acid molecule encoding the xCas12a protein of claim 5; c2) an expression cassette containing the nucleic acid molecule described in c1); c3) a recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) a recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3).

7. The related biological material according to claim 6, characterized in that: c1) The nucleic acid molecule is any of the following DNA molecules: d1) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.2, positions 1553-5386 in the sequence listing; d2) a DNA molecule having 80% or more identity with the nucleotide sequence defined in d1) and encoding the xCas12a protein; d3) hybridizes with the nucleotide sequence defined in d1) under stringent conditions and encodes a DNA molecule of the xCas12a protein.

8. The related biological material according to claim 6, characterized in that: c2) The expression cassette is a DNA molecule whose nucleotide sequence is shown in positions 296-5386 of SEQ ID NO.2 in the sequence listing.

9. The related biological material according to claim 6, characterized in that: c3) The recombinant vector also includes a nucleic acid molecule encoding crRNA and a promoter driving the expression of the nucleic acid molecule encoding crRNA.

10. A CRISPR / Cas12a gene editing system, characterized in that: A biomaterial comprising the xCas12a protein of claim 5 or the xCas12a protein of any one of claims 6 to 9.

Images