An InDel molecular marker tightly linked to cucumber plant type, its primers and applications

Abstract

The present invention discloses an InDel molecular marker tightly linked to cucumber plant type, the nucleotide sequence of which is shown in SEQ ID NO: 2. The InDel molecular marker is a 102 bp deletion present at the 2010th base from the 5' end of the sequence shown in SEQ ID NO: 1. Also disclosed are primers, a kit, and a method for identifying cucumber plant types for amplifying the InDel molecular marker, as well as the use of the InDel molecular marker, primer, kit, or identification method in cucumber plant type selection and breeding. The primers of the present invention can produce specific markers for dwarf cucumber materials with good repeatability and strong specificity. The InDel molecular markers and primers of the present invention are used to identify cucumber plant types, especially for rapid identification of cucumber plant types during the seedling stage. The methods have the advantages of accuracy, rapidity, low cost, short identification cycle, and ease of operation, and can assist in the selection and breeding of new cucumber varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker-assisted breeding, and in particular relates to an InDel molecular marker tightly linked to cucumber plant type, a primer thereof and an application thereof. Background Art

[0002] Cucumber (Cucumissativus L.) is an annual herbaceous plant of the genus Cucurbitaceae. Cucumber originated in the tropical rain forest area in the southern foothills of the Himalayas and northern India.

[0003] Currently, most cultivated cucumbers are creeping, requiring a large growing space. Pruning and trellising are necessary to prevent lodging, resulting in high inputs of agricultural materials and labor, making mechanized harvesting difficult. Therefore, breeding cucumbers for ideal plant types based on dwarf traits would facilitate dense planting, increase yield per unit area and space utilization, and facilitate mechanized harvesting, potentially revolutionizing the cucumber industry.

[0004] However, because the dwarf plant type of cucumbers only emerges in the middle and late stages of growth, traditional breeding requires waiting until the middle stage of growth before targeted selection can be carried out. This breeding method is not only time-consuming and labor-intensive, but also inefficient. Therefore, it is necessary to develop molecular markers that are closely linked to cucumber plant type traits to facilitate large-scale screening during the seedling stage, thereby reducing the breeding population and improving breeding efficiency. Summary of the Invention

[0005] The purpose of the present invention is to provide an InDel molecular marker tightly linked to cucumber plant type, primers and a kit thereof.

[0006] The present invention also aims to provide a method for identifying cucumber plant types.

[0007] The last object of the present invention is to provide the application of the above-mentioned InDel molecular markers, primers, kits or identification methods in cucumber plant type breeding.

[0008] The first object of the present invention can be achieved by the following technical solution: an InDel molecular marker tightly linked to the cucumber plant type, the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO: 2, and the InDel molecular marker is a 102 bp deletion at the 2010th base from the 5' end of the sequence shown in SEQ ID NO: 1.

[0009] Specifically, the deletion sequence, i.e., the InDel molecular marker or InDel site, is as follows:

[0010] ATTTGGCTAACAATTCTATTTTTGGAGGAGTGCCCACGTGTATTGCGTC ACTTCGTGCTTTGGTTCAGTTGAATCTATCATCCAATCATTTAACTTACAAG A (as shown in SEQ ID NO: 2).

[0011] The present invention also provides primers for amplifying the above-mentioned InDel molecular marker, wherein the primers include an upstream primer InDel1-F and a downstream primer InDel1-R. The nucleotide sequence of the upstream primer InDel1-F is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer InDel1-R is shown in SEQ ID NO: 4.

[0012] Specifically:

[0013] InDel1-F: 5'-TTGAACTCGACCTCTCTAAAGC'-3' (shown in SEQ ID NO: 3);

[0014] InDel1-R: 5'-TGTGAAAGGAACAATGCCTG'-3' (shown in SEQ ID NO: 4).

[0015] The present invention also provides a kit for identifying cucumber plant types, which comprises the above primers.

[0016] The second object of the present invention can be achieved by the following technical solution: A method for identifying cucumber plant types, comprising the following steps:

[0017] S1) using cucumber genomic DNA as a template, performing PCR amplification using the primers labeled with the above-mentioned InDel molecules, and analyzing the PCR amplification products by electrophoresis;

[0018] S2) When only the 470 bp specific marker B shown in SEQ ID NO: 5 is produced 470 When the cucumber is a creeping plant type; when the specific marker B of 470 bp as shown in SEQ ID NO: 5 is produced at the same time 470 and a 368 bp specific marker B shown in SEQ ID NO: 6 368 When only the 368bp specific marker B shown in SEQ ID NO: 6 is produced, the cucumber is a creeping plant type; when only the 368bp specific marker B shown in SEQ ID NO: 6 is produced 368 When the cucumber is grown, it is a dwarf plant.

[0019] In the identification method of the cucumber plant type:

[0020] Preferably, the cucumber genomic DNA in step S1) is genomic DNA from cucumber leaves.

[0021] Preferably, during PCR amplification in step S1), the PCR reaction system includes 1 μL genomic DNA, 2 μL Mg-containing 2+ 10× PCR buffer, 1.5 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer and 1 U Taq enzyme were added, and ddH2O was added to 20 μL.

[0022] Furthermore, during PCR amplification in step S1), the PCR reaction system includes 1 μL of 200 ng·μL -1 genomic DNA, 2 μL Mg 2+ 10× PCR buffer, 1.5 μL 2.5 mM dNTPs, 1 μL 10 mM upstream primer InDel1-F (SEQ ID NO. 3), 1 μL 10 mM downstream primer InDel1-R (SEQ ID NO. 4), 1 U Taq enzyme, and ddH2O were added to 20 μL.

[0023] Preferably, during PCR amplification in step S1), the amplification program is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 35 cycles, final extension at 72°C for 7 min, and storage at 4°C.

[0024] Preferably, in the electrophoresis analysis in step S1), agarose gel is used for electrophoresis, and the agarose gel has a mass percentage of 1%.

[0025] The present invention analyzes the electrophoresis results and finds that the primers used to amplify the InDel molecular marker can produce a 470bp creeping plant type parent specific marker B. 470 and dwarf plant type parent P2 specific marker B 368 Since this marker is a co-dominant marker, a single plant with both parent-specific bands is a heterozygote.

[0026] Therefore, when the InDel molecular marker primer only produces a 470 bp parent-specific marker B 470 When the molecular marker primer can simultaneously produce a 470bp parent-specific marker B 470 and 368 bp parent-specific marker B 368 When the molecular marker primer only produces a 368bp parent-specific marker B 368 When the cucumber is grown, it is a dwarf plant.

[0027] The last object of the present invention can be achieved by the following technical solution: application of the above-mentioned InDel molecular markers, primers, kits or methods in cucumber plant type breeding.

[0028] Compared with the prior art, the present invention has the following advantages:

[0029] (1) The present invention discloses an InDel molecular marker that is tightly linked to the plant type of cucumber. The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO: 2. The InDel molecular marker is a 102 bp deletion at the 2010th base from the 5' end of the sequence shown in SEQ ID NO: 1.

[0030] (2) The present invention also discloses primers for amplifying the above-mentioned InDel molecular markers. The InDel molecular marker primers can simultaneously produce specific markers for creeping plant types and specific markers for dwarf plant types, and have good reproducibility and strong specificity.

[0031] (3) The InDel molecular markers and primers developed by the present invention that are tightly linked to the cucumber plant type can be used to identify the cucumber plant type, especially for rapid identification of the height phenotype of the cucumber plant type during the seedling stage. They have the advantages of accuracy, speed, low cost, short identification cycle, and simple operation. They can assist in the breeding of new cucumber varieties and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0033] Figure 1 This is the agarose gel electrophoresis pattern of the PCR amplification product of the InDel molecular marker tightly linked to the cucumber plant type in Example 1 (M: 2000 bp Marker; P1: dwarf parent, P2: creeping parent, F1: first generation hybrid of P1 and P2);

[0034] Figure 2 The results of amplifying 22 individual plants (numbered 3-24) from the F2 family population using the InDel molecular marker tightly linked to cucumber plant type in Example 2 (M is a 2000 bp marker, lane 1 is P1, lane 2 is P2, and lanes 3-24 are 22 F2 individual plants);

[0035] Figure 3 These are the amplification results of the InDel molecular marker tightly linked to the cucumber plant type in Example 3 in different cucumber germplasms (M is a 2000 bp marker, and lanes 1-24 represent different cucumber plants). DETAILED DESCRIPTION

[0036] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0037] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0038] Example 1

[0039] Development of InDel Molecular Markers Tightly Linked to Cucumber Plant Type and Their Primers

[0040] The development and verification process of the InDel molecular markers tightly linked to cucumber plant type and the primers for amplifying the InDel molecular markers provided in this example are as follows:

[0041] (1) Materials

[0042] Source of parents: P1: dwarf cucumber parent, P2: climbing cucumber parent, and the hybrid offspring F1 of the two was provided by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences.

[0043] (2) Test method

[0044] A six-generation segregating population was constructed using the creeping cucumber P2 and the dwarf cucumber P1 as parents to investigate the inheritance of cucumber plant type. The results showed that creeping and dwarf plant type are a pair of genes controlling quality traits, with creeping being dominant over dwarf. Subsequently, using the F2 population, extreme trait pool resequencing (BSA-seq) combined with a genetic map-based gene mapping method, the cucumber dwarf gene was localized to the physical interval 30027575-30223770 on cucumber chromosome 1.

[0045] A candidate gene was obtained by comprehensive comparison of the localized intervals and named CsCLV2. By comparing the CsCLV2 sequences in the genomes of the creeping and dwarf materials, a 102 bp difference was found between the two.

[0046] The nucleotide sequence of the CsCLV2 gene is as follows:

[0047] ATTTGGCTAACAATTCTATTTTTGGAGGAGTGCC CACGTGTATTGCGTCACTTCGTGCTTTGGTTCAGTTGAATCTATCATCCAATCATTTAACTTACAAGA

[0048] The InDel is located at position 2010 of the CsCLV2 gene. The creeping parent is shown in SEQ ID NO.1 in the sequence listing, while the dwarf parent has a deletion of 102 bp, which is the InDel site. The deletion sequence is shown in SEQ ID NO:2.

[0049] A pair of specific primers were designed on both sides of the InDel site, including the upstream primer InDel1-F and the downstream primer InDel-R.

[0050] The specific nucleotide sequences of the upstream primer and the downstream primer are as follows:

[0051] InDel1-F: 5'-TTGAACTCGACCTCTCTAAAGC-3' (shown in SEQ ID NO: 3); InDel1-R: 5'-TGTGAAAGGAACAATGCCTG-3' (shown in SEQ ID NO: 4).

[0052] (3) Test verification

[0053] Based on the results of previous studies on cucumber dwarf gene positioning and candidate gene screening, this pair of specific InDel molecular marker primers was used to amplify the dwarf parent, creeping parent and their F1. The InDel molecular marker primers can produce a 470bp creeping parent specific marker B 470 and a 368bp dwarf parent-specific marker B 368 The results showed that the marker had clear band pattern and good repeatability.

[0054] The specific process of the above verification is: using cucumber genomic DNA as a template, using the above InDel molecular marker primers to perform PCR amplification, and then performing agarose gel electrophoresis on the PCR product. The results are as follows Figure 1 As shown. Figure 1 The results of the analysis showed that the marker can produce a 470bp creeping parent-specific marker B 470 and a 368 bp dwarf parent-specific marker B 368 , and F1 can also produce a 470bp creeping parent-specific marker B 470 and a 368 bp dwarf parent-specific marker B 368 .

[0055] Sequences amplified by PCR using primers for InDel molecular markers of creeping cucumber (specific marker B of creeping parent) 470 )as follows:

[0056] TTGAACTCGACCTCTCTAAAGCATTTGGATCTTCAAAATAACTATTTGAAGGGGAATGTTTATGATTTCCATCAGCCTTTAGTTTCACTCAATCTCATGTCGAATCGGTTTTCTGGAACTCTACCTTGTTTTTCAGCTTGCACACGGTCTCTCACAGTTCTTAATTTGGCTAACAATTCTATTTTTGGAGGAGTGCCCACGTGTATTGCGTCACTTCGTGCTTTGGTTCAGTTGAATCTATCATCCAATCATTTAACTTACAAGATGTCGCCTAGACTCCTGTTTGCAGAGCAGCTACTTGTGTTGGACTTGAGTAACAATGATCTATATGGCCCTCTTCCAAGCATGATTGTGGAGACGATAGAGAAATCAGGGCTTGTTCTCCTTGACTTGTCTCACAATCGATTTTCAGGTGGAATTCCATCAAAGATCACAGAACTGAGAAGTTTGCAGGCATTGTTCCTTTCACA (as shown in SEQ ID NO: 5).

[0057] Sequence amplified by PCR of primers for dwarf cucumber InDel molecular markers (dwarf parent-specific marker B 368 ) is as follows:

[0058] TTGAACTCGACCTCTCTAAAGCATTTGGATCTTCAAAATAACTATTTGAAGGGGAATGTTTATGATTTCCATCAGCCTTTAGTTTCACTCAATCTCATGTCGAATCGGTTTTCTGGAACTCTACCTTGTTTTTCAGCTTGCACACGGTCTCTCACAGTTCTTATGTCGCCTAGACTCCTGTTTGCAGAGCAGCTACTTGTGTTGGACTTGAGTAACAATGATCTATATGGCCCTCTTCCAAGCATGATTGTGGAGACGATAGAGAAATCAGGGCTTGTTCTCCTTGACTTGTCTCACAATCGATTTTCAGGTGGAATTCCATCAAAGATCACAGAACTGAGAAGTTTGCAGGCATTGTTCCTTTCACA (as shown in SEQ ID NO: 6).

[0059] Example 2

[0060] Identification method of cucumber plant type

[0061] The validation was conducted on 22 random individual plants (numbered 3-24) from the F2 family population. Each plant was numbered and DNA was extracted and tested. Plants that produced only the 470bp band were considered climbing cucumber plants, those that produced only the 368bp band were considered dwarf cucumber plants, and those that produced both the 470bp and 368bp bands were considered climbing cucumber plants.

[0062] The results of marker detection showed that there were 2 plants with 470bp banding (homozygous for creeping plants), 9 plants with 368bp banding (homozygous for dwarf plants), and 11 plants with heterozygous banding (heterozygous for creeping plants) (part of the results are shown in Figure 2 ).

[0063] The field trait identification results were highly consistent with the marker detection results, with an accuracy rate of 100%.

[0064] Example 3

[0065] Screening of Cucumber Germplasm Plant Types

[0066] The method of Example 2 was used to verify 39 cucumber germplasm resources (provided by the Vegetable Research Institute of Guangdong Academy of Agricultural Sciences) (Table 1). Mixed samples were taken from each resource, and DNA was extracted for testing. The test results showed that there were 39 strains with 470bp banding (climbing cucumbers), and no strains with 368bp banding (see Figure 3 ).

[0067] The field trait identification results were highly consistent with the marker detection results, with an accuracy rate of 100%.

[0068] Table 1 Information on 39 cucumber germplasm resources

[0069] serial number Material name Plant type serial number Material name Plant type 1 B1 creeping type 21 B21 creeping type 2 B2 creeping type 22 B22 creeping type 3 B3 creeping type 23 B23 creeping type 4 B4 creeping type 24 B24 creeping type 5 B5 creeping type 25 B25 creeping type 6 B6 creeping type 26 B26 creeping type 7 B7 creeping type 27 B27 creeping type 8 B8 creeping type 28 B28 creeping type 9 B9 creeping type 29 B29 creeping type 10 B10 creeping type 30 B30 creeping type 11 B11 creeping type 31 B31 creeping type 12 B12 creeping type 32 B32 creeping type 13 B13 creeping type 33 B33 creeping type 14 B14 creeping type 34 B34 creeping type 15 B15 creeping type 35 B35 creeping type 16 B16 creeping type 36 B36 creeping type 17 B17 creeping type 37 B37 creeping type 18 B18 creeping type 38 B38 creeping type 19 B19 creeping type 39 B39 creeping type 20 B20 creeping type creeping type

[0070] From the above examples, it can be seen that the InDel molecular markers and primers developed in the present invention can effectively distinguish creeping and dwarf cucumber materials, and can accurately and quickly detect the plant type of cucumber materials at the seedling stage.

[0071] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. It is apparent to those skilled in the art that various changes, modifications, substitutions, and variations of these embodiments may be made without departing from the principles and spirit of the present invention, and the changes still fall within the scope of protection of the present invention.

Claims

1. An InDel molecular marker tightly linked to cucumber plant type, characterized by: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO:

2. The InDel molecular marker is a 102 bp deletion at the 2010th base from the 5' end of the sequence shown in SEQ ID NO:

1. The InDel molecular marker is used to identify the cucumber plant type, and the cucumber plant type is a creeping plant type or a dwarf plant type.

2. A primer for amplifying the InDel molecular marker according to claim 1, characterized in that: The primers include an upstream primer InDel1-F and a downstream primer InDel1-R. The nucleotide sequence of the upstream primer InDel1-F is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer InDel1-R is shown in SEQ ID NO:

4.

3. A cucumber plant type identification kit, characterized by: The kit comprises the primers according to claim 2.

4. A method for identifying cucumber plant types, characterized in that The following steps are involved: S1) using cucumber genomic DNA as a template, performing PCR amplification using primers labeled with the InDel molecule according to claim 2, and analyzing the PCR amplification products by electrophoresis; S2) When only the 470 bp specific marker B shown in SEQ ID NO: 5 is produced 470 When the cucumber is a creeping plant type; when the specific marker B of 470 bp as shown in SEQ ID NO: 5 is produced at the same time 470 and a 368 bp specific marker B shown in SEQ ID NO: 6 368 When only the 368bp specific marker B shown in SEQ ID NO: 6 is produced, the cucumber is a creeping plant type; when only the 368bp specific marker B shown in SEQ ID NO: 6 is produced 368 When the cucumber is grown, it is a dwarf plant.

5. The method for identifying cucumber plant types according to claim 4, wherein: During PCR amplification in step S1), the PCR reaction system includes 1 μL genomic DNA, 2 μL Mg-containing 2+ 10× PCR buffer, 1.5 μL dNTPs, 1 μL upstream primer, 1 μL downstream primer and 1 U Taq enzyme were added, and ddH2O was added to 20 μL.

6. The method for identifying cucumber plant types according to claim 4, wherein: During PCR amplification in step S1), the amplification program is as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 35 cycles, final extension at 72°C for 7 min, and storage at 4°C.

7. Use of the InDel molecular marker according to claim 1, the primer according to claim 2, the kit according to claim 3, or any one of the methods according to claims 4 to 6 in cucumber plant type breeding.

Images