A method for detecting H5N1 avian influenza virus SERS based on immunomagnetic beads and aptamers

Abstract

This invention discloses a SERS detection method for avian influenza virus H5N1 based on immunomagnetic beads and aptamers, comprising the following steps: S1. Preparation of H5N1 aptamer-capturing immunomagnetic beads: Apt1 aptamer (10 μL, 1.847 μg / μL) is denatured at 95℃ for 15 min, then rapidly placed on ice for 15 min. While incubating, streptomycin affinity magnetic beads are resuspended in the original vial by rotation for 20 s. 0.2 mg of streptomycin affinity magnetic beads are placed in a centrifuge tube, placed on a magnetic rack, and incubated for 1 min. 500 μL of PBS is added for washing, and the washing is repeated 3 times. This invention, based on a streptomycin affinity magnetic bead capture system combined with SERS technology, establishes a method for in-situ reduction detection of avian influenza virus using SERS immunomagnetic beads. This method achieves in-situ, non-destructive, efficient, highly specific, highly sensitive, rapid, and low-concentration detection, solving the problem of the specificity of SERS itself and providing a new detection approach for H5N1 subtype avian influenza virus.

Description

Technical Field

[0001] This invention relates to the field of pathogen detection technology, specifically to a method for detecting H5N1 avian influenza virus SERS based on immunomagnetic beads-aptamers. Background Technology

[0002] Since the outbreak of the H5N1 subtype avian influenza virus, the poultry industry in China and even globally has been severely affected. my country, as a major poultry-producing country, has not only suffered enormous economic losses from the H5N1 subtype avian influenza virus, but more seriously, it is highly pathogenic to humans, causing a mortality rate of up to 100% in poultry and over 60% in humans. With the migration of birds and large-scale human activities, the H5N1 subtype avian influenza virus has been found in more than sixty countries worldwide. Commonly used virus detection or quantification methods can be subdivided into virus culture, serological detection, nucleic acid-based detection methods, and point-of-care detection systems based on biosensors. Currently, the gold standard for detecting the H5N1 influenza virus in laboratories is virus culture and reverse transcription polymerase chain reaction. However, these methods are time-consuming, complex to operate, and cannot achieve rapid on-site diagnosis. There is an urgent need for a new, simple, rapid, and highly sensitive virus detection method. However, existing rapid virus detection methods using Raman spectroscopy mostly rely on the principle of antigen-antibody binding and principal component analysis, which are expensive and difficult to widely implement.

[0003] Surface-enhanced Raman Spectroscopy (SERS), as an emerging molecular spectroscopy technique, enhances target signals by leveraging the localized electromagnetic fields generated by localized surface plasmon resonances in metal nanostructures and Raman-active indicator molecules. This can amplify target signals by millions or even tens of millions (10^10) of their potential magnitude. 7 -10 10 Furthermore, it can detect water samples regardless of the influence of water. And due to its advantages of being fast, accurate, in-situ, and non-destructive, SERS technology has been widely used in virus detection.

[0004] Our laboratory has long been dedicated to the detection of pathogenic microorganisms using Raman spectroscopy. Currently, there is a lack of effective rapid Raman spectroscopy detection methods for the H5N1 subtype avian influenza virus, both domestically and internationally. Therefore, there is an urgent need to establish a rapid SERS detection method for the H5N1 subtype avian influenza virus. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] To address the shortcomings of existing technologies, this invention provides a method for detecting H5N1 avian influenza virus SERS based on immunomagnetic beads and aptamers. This method involves preparing H5N1 subtype avian influenza virus immunocapture magnetic beads by coupling streptavidin magnetic beads with a specific aptamer for H5N1 subtype avian influenza virus. The immunocapture magnetic beads capture H5N1 subtype avian influenza virus and form a "dual-aptamer sandwich" complex with another specific aptamer for H5N1 subtype avian influenza virus. By modifying the surface of the complex with AgNPs, a method based on immunomagnetic beads and aptamer sandwich combined with surface-enhanced Raman spectroscopy is established. This method enables rapid, sensitive, efficient, and in-situ reduction detection of H5N1 subtype avian influenza virus through magnetic adsorption without centrifugation, providing a new approach for rapid virus detection in the future.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, the present invention provides the following technical solution: a method for detecting H5N1 avian influenza virus SERS based on immunomagnetic beads-aptamers, comprising the following steps:

[0009] Preparation of S1 and H5N1 aptamer-captured immunomagnetic beads

[0010] Apt1 aptamer (10 μL, 1.847 μg / μL) was denatured at 95 °C for 15 min, then immediately placed on ice for 15 min. While incubating, streptomycin affinity beads were resuspended in the original vial by rotation for 20 s. 0.2 mg of streptomycin affinity beads were placed in a centrifuge tube, placed on a magnetic rack, and incubated for 1 min. 500 μL of PBS was added for washing, and the washing was repeated 3 times. The folded Apt1 aptamer was incubated at room temperature for 30 min. After magnetic separation, the unbound free aptamers were washed 3 times with PBS solution to prepare aptamer-capturing immunomagnetic beads. 200 μL of H5N1 virus was then added, and after thorough mixing, the mixture was incubated at 4 °C for 1 h. The beads were resuspended every 20 min to ensure they remained in suspension. Unconjugated virus was eluted by magnetic separation, thus preparing H5N1 aptamer-capturing immunomagnetic beads.

[0011] S2. Preparation of Immunomagnetic Bead-Amtamyx Sandwich Immunocomplexes (IMBSIs)

[0012] Based on H5N1 aptamer-captured immunomagnetic beads, 20 μL of folded Apt2 (20 μL, 1.847 μg / μL) was added. After thorough mixing, the mixture was incubated at 4°C for 30 min, during which time the magnetic beads were kept in suspension. Subsequently, the H5N1 aptamer-captured immunomagnetic beads were coupled with folded Apt2 to form conjugated sandwich IMBSIs. The IMBSIs were washed in PBS solution with a pipette and then magnetically separated.

[0013] Synthesis of S3, IMBSIs@AgNPs

[0014] AgNPs were synthesized by reducing AgNO3 with NaBH4 as a reducing agent using the Shamelli K method. The optimal AgNPs were synthesized by adjusting the ratio of NaBH4 and AgNO3 and the incubation time at room temperature. The prepared IMBSIs were dispersed in 50 μL of freshly prepared 10 mM AgNO3 solution, mixed thoroughly, and incubated at 4 °C for 10 min in the dark, keeping the solution in suspension throughout the incubation. Then, 50 μL of freshly prepared 10 mM NaBH4 solution was added at a uniform rate, and the mixture was mixed and reacted for 1 min. The mixture was then immediately centrifuged at 1000 rpm for 1 min, the supernatant was discarded, and the solution was resuspended in 50 μL of sterile deionized water to prepare IMBSIs@AgNPs.

[0015] Establishment of SERS detection methods for S4 and H5N1 subtype avian influenza viruses

[0016] Instrument calibration was performed using a silicon wafer at 520.7 cm⁻¹ before testing. -1 The Raman peak at a certain point was used as the reference peak, and the Raman spectrometer parameters were set as follows: Raman spectral scanning range 500-2000 cm⁻¹. -1 Excitation was performed using a 532 nm He-Ne laser with a laser power of 13.5 mW and a laser power density of 0.214 mW·µm. -2 The objective lens is set to 50x, the laser attenuation parameter to 1%, and the resolution to 1cm. -1 The exposure time was 1 minute and the integration was performed 3 times. To improve the signal-to-noise ratio, 15 to 30 points were randomly selected for testing. 10 μL of the sample was dropped onto the center of a quartz glass slide that had been soaked, washed and rinsed in acid solution for Raman signal acquisition. All data analysis was performed using Origin software 8.5.

[0017] Preferably, the sequence of H5N1 subtype avian influenza virus aptamer 1 obtained by screening is GCAGAGGTCCGCTGACGGATGGATGGAACAGGGGTTTAGCAGCAGGAC CACTCTTGAGCG(Apt1), and the sequence of H5N1 subtype avian influenza virus aptamer 2 is ACCTggTTACTgggTggCTACAggggACACCACTCCgCTTCCTCCggCCCggggA gTggC(Apt2).

[0018] Preferably, the optimal concentrations of AgNO3 and NaBH4 are both 10 mM, and the optimal incubation times are 10 min and 1 min, respectively, which result in the strongest SERS enhancement effect of AgNPs.

[0019] (III) Beneficial Effects

[0020] Compared with existing technologies, this invention provides a method for detecting H5N1 avian influenza virus SERS based on immunomagnetic beads-aptamers, which has the following beneficial effects:

[0021] This invention establishes a method for in-situ reduction detection of avian influenza virus using SERS immunomagnetic beads based on a streptomycin affinity magnetic bead capture system combined with SERS technology. This method achieves in-situ, non-destructive, efficient, highly specific, sensitive, rapid, and low-concentration detection, overcoming the specificity issue inherent in SERS. It provides a new detection approach for H5N1 subtype avian influenza virus. SERS technology, as an emerging analytical method, is expected to become a low-cost, efficient, sensitive, and in-situ alternative for pathogen detection. Compared to traditional Raman detection, the method established in this invention, by introducing immunomagnetic beads, exhibits strong specificity, good repeatability, and higher sensitivity, with a virus dilution factor of up to 10. 9 It can quickly detect the H5N1 subtype avian influenza virus within 1 hour. Attached Figure Description

[0022] Figure 1 For the reproducibility evaluation of the IMBSIs@AgNPs detection method;

[0023] Figure 2 The intensity of the band at 1053 cm⁻¹ was determined using the IMBSIs@AgNPs detection method.

[0024] Figure 3 Sensitivity evaluation of the IMBSIs@AgNPs detection method;

[0025] Figure 4 The linear relationship between the band intensity at 1053 cm⁻¹ and the concentration of H5N1 subtype avian influenza virus was established using the IMBSIs@AgNPs detection method.

[0026] Figure 5 To evaluate the specificity of the IMBSIs@AgNPs detection method;

[0027] Figure 6 To improve the accuracy of sample analysis based on the IMBSIs@AgNPs detection method. Detailed Implementation

[0028] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Please see Figure 1-6 A method for detecting H5N1 avian influenza virus SERS based on immunomagnetic beads and aptamers includes the following steps:

[0030] Preparation of S1 and H5N1 subtype avian influenza virus aptamer-captured immunomagnetic beads

[0031] (1) Resuspend the streptomycin affinity magnetic beads (300nm, 10mg / ml) in the original bottle by rotating for 20s;

[0032] (2) Take 0.2 mg of streptomycin affinity magnetic beads into a centrifuge tube, place it on a magnetic rack and let it stand for 3 min. Discard the supernatant, add 500 μL of PBS solution to wash the magnetic beads, and repeat the washing 3 times by magnetic separation.

[0033] (3) Denature the Apt1 aptamer (10 μL, 1.847 μg / μL) at 95 °C for 15 min, and then quickly place it on ice for 15 min;

[0034] (4) Take the folded Apt1 aptamer and incubate it with streptomycin affinity magnetic beads at room temperature for 30 min;

[0035] (5) After magnetic separation, the unbound free aptamers were washed three times with PBS to prepare aptamer-capturing immunomagnetic beads;

[0036] (6) Then add 200 μL of H5N1 subtype avian influenza virus, mix thoroughly, and incubate at 4°C for 1 hour. Resuspend every 20 minutes to ensure that the magnetic beads are always in a suspended state;

[0037] (7) Uncoupled viruses were eluted by magnetic separation to prepare H5N1 subtype avian influenza virus aptamer capture immunomagnetic beads.

[0038] S2. Preparation of Immunomagnetic Bead-Amtamyx Sandwich Immunocomplexes (IMBSIs)

[0039] (1) Add folded Apt2 (20 μL, 1.847 μg / μL) to the H5N1 subtype avian influenza virus aptamer capture immunomagnetic beads prepared by S1, mix thoroughly and incubate at 4°C, ensuring that the magnetic beads remain in suspension during this period;

[0040] (2) The H5N1 subtype avian influenza virus aptamer-captured immunomagnetic beads coupled with the folded Apt2 complex, which is the conjugated IMBSIs, were washed in PBS solution with a pipette and then magnetically separated.

[0041] Synthesis of S3, IMBSIs@AgNPs

[0042] (1) Take the prepared IMBSIs, disperse them in a freshly prepared 10mM 50μL AgNO3 solution, mix thoroughly, and incubate at 4℃ for 10min in the dark, keeping the solution in suspension throughout the incubation period.

[0043] (2) Then add 50 μL of freshly prepared 10 mM NaBH4 solution at a constant rate and mix well for 1 min.

[0044] (3) Immediately centrifuge at 1000 rpm for 1 min and discard the supernatant;

[0045] (4) Resuspend in 50 μL of sterile deionized water to obtain the prepared IMBSIs@AgNPs.

[0046] Establishment of SERS detection methods for S4 and H5N1 subtype avian influenza viruses

[0047] (1) Before testing, the instrument was calibrated using a silicon wafer at 520.7 cm⁻¹. -1 The Raman peak at that location is used as the benchmark peak;

[0048] (2) Raman spectrometer parameters were set as follows: Raman spectral scanning range: 500-2000 cm⁻¹ -1 Excitation was performed using a 532 nm He-Ne laser with a laser power of 13.5 mW and a laser power density of 0.214 mW·µm. -2 The objective lens is set to 50x, the laser attenuation parameter to 1%, and the resolution to 1cm. -1 The exposure time is 1 minute, and the number of integration attempts is 3.

[0049] (3) To improve the signal-to-noise ratio, 15 to 30 points were randomly detected;

[0050] (4) Take 10 μL of the sample to be tested and drop it into the center of the quartz glass slide that has been soaked, washed and rinsed in acid solution, and collect the Raman signal.

[0051] (5) All data obtained were analyzed using Origin software 8.5.

[0052] S5. Repeatability of the IMBSIs@AgNPs detection method

[0053] (1) The aptamer-capturing magnetic beads prepared by S1 were thoroughly mixed with 10 batches of H5N1 subtype avian influenza virus (200 μL randomly aspirated) to prepare H5N1 subtype avian influenza virus aptamer-capturing immunomagnetic beads.

[0054] (2) Verify according to the experimental steps in S1-4 above.

[0055] The results are as follows Figure 1 As shown, the Raman spectra of the 10 batches of samples exhibit good repeatability, with uniform and stable peak intensity and shape. The Raman intensity reaches 1232 a.u. The 10 batches of IMBSIs@AgNPs samples were analyzed at 1053 cm⁻¹. -1 The spectral band intensity at that location was analyzed, and the results are as follows: Figure 2 As shown, the relative standard deviation formula was used to calculate the sample size at 1053 cm⁻¹ for 10 batches. -1 The RSD of the band intensity at that location is 0.1731, indicating that the method has good repeatability.

[0056] S6. Sensitivity of the IMBSIs@AgNPs detection method

[0057] (1) H5N1 subtype avian influenza virus (5.0 × 10⁻⁶) was isolated using 10 mM PBS solution. 6 TCID 50 Dilute each ml to 10 ml. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 and 10 -9 There are a total of 9 gradients;

[0058] (2) The aptamer-capturing magnetic beads prepared by S1 were thoroughly mixed with the stock solution and 9 gradient virus dilutions (200 μL randomly aspirated) to prepare H5N1 subtype avian influenza virus aptamer-capturing immunomagnetic beads.

[0059] (3) Verify according to the experimental steps in S1-4 above.

[0060] The results are as follows Figure 3 As shown, 1053cm -1 The relationship between the intensity of the spectral band and the concentration of H5N1 subtype avian influenza virus is shown in the figure. Figure 4 It can be seen from this that 1053cm -1 The peak intensity at the Raman shift was concentration-dependent, and the detection limit for virus dilution reached 10. 9 times.

[0061] S7. Specificity of the IMBSIs@AgNPs detection method

[0062] (1) Take 200 μL each of H1N1, H3N2, H5N1 subtype avian influenza virus and MDCK cells and resuspend them in 4 tubes of aptamer capture magnetic beads prepared by S1. Mix them thoroughly to prepare H1N1 subtype avian influenza virus aptamer capture immunomagnetic beads, H3N2 subtype avian influenza virus aptamer capture immunomagnetic beads, H5N1 subtype avian influenza virus aptamer capture immunomagnetic beads and MDCK aptamer capture immunomagnetic beads respectively.

[0063] Verify according to the experimental steps in S1-4 above.

[0064] The results are as follows Figure 5 As shown, only the H5N1 subtype avian influenza virus showed a significant Raman signal, while other avian influenza viruses and MDCK cells did not show significant Raman signal intensity. The results indicate that this method can only directly detect the H5N1 subtype avian influenza virus and has good specificity.

[0065] S8. Accuracy Sample Analysis

[0066] To examine the accuracy and practical applicability of this invention, we used a spiked recovery method for verification. Specifically, we added a certain concentration of H5N1 subtype avian influenza virus to serum, skim milk, and mud-water-saliva mixtures, respectively, and enriched the H5N1 subtype avian influenza virus in different solutions by using the aptamer-capturing magnetic beads prepared in Example 1.

[0067] (1) Sample pretreatment: H5N1 subtype avian influenza virus (5.0 × 10⁻⁶) was separately pretreated with fetal bovine serum, skim milk, and a mixture of muddy water and saliva. 6 TCID 50 Dilute each ml to 10 ml. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 and 10 -9 There are a total of 9 gradients;

[0068] (2) The aptamer-capturing magnetic beads prepared by S1 were thoroughly mixed with the stock solution and 9 gradient virus dilutions (200 μL randomly aspirated) to prepare H5N1 subtype avian influenza virus aptamer-capturing immunomagnetic beads.

[0069] (3) Verify according to the experimental steps in S1-4 above.

[0070] The results showed that the recovery rate was 100% in all cases, indicating the accuracy and reliability of this invention for the detection of H5N1 subtype avian influenza virus. Figure 6 As shown, we were able to successfully detect the H5N1 subtype of avian influenza virus in fetal bovine serum, skim milk, and a mixture of muddy saliva.

[0071] Judgment criteria: 800-1400cm -1 Within the range, the H5N1 subtype avian influenza virus is present at 1058 cm⁻¹. -1 The method exhibits strong and well-symmetrical Raman peaks, and demonstrates good specificity, repeatability, and sensitivity.

[0072] The beneficial effects of this invention are: it establishes a method for the rapid, sensitive, efficient, and in-situ reduction detection of H5N1 subtype avian influenza virus through magnetic adsorption without centrifugation. The use of immunomagnetic beads-aptamer sandwich combined with surface-enhanced Raman spectroscopy provides a new approach for the rapid detection of viruses in the future.

[0073] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. An immunomagnetic bead-aptamer based SERS detection method for avian influenza virus H5N1, characterized in that, Comprising the following steps: S1, preparation of H5N1 aptamer capture immunomagnetic beads Take 10 μL of Apt1 aptamer with a concentration of 1.847 μg / μL, denature at 95 ℃ for 15 min, then quickly place on ice for 15 min. During the standing, resuspend the streptomycin affinity magnetic beads in the original bottle by rotating for 20 s. Take 0.2 mg of streptomycin affinity magnetic beads in a centrifuge tube, place it on a magnetic stand for 1 min, add 500 μL of PBS for washing, repeat the washing for 3 times. Take the folded Apt1 aptamer and incubate at room temperature for 30 min. After magnetic separation, the unbound free aptamer is washed with PBS solution for 3 times to prepare the aptamer capture immunomagnetic beads. Then add 200 μL of H5N1 virus, mix well and incubate in the refrigerator at 4 ℃ for 1 h. Resuspend every 20 min to ensure that the magnetic beads are always in a suspended state. Through magnetic separation, the uncoupled virus is eluted to prepare H5N1 aptamer capture immunomagnetic beads; S2, preparation of immunomagnetic bead-aptamer sandwich immunocomplex On the basis of H5N1 aptamer capture immunomagnetic beads, add 20 μL of folded Apt2 with a concentration of 1.847 μg / μL. After mixing well, incubate in the refrigerator at 4 ℃ for 30 min. During this period, ensure that the magnetic beads are in a suspended state. Then, the H5N1 aptamer capture immunomagnetic beads are coupled with the folded Apt2 to form conjugated sandwich IMBSIs. Use a pipette to wash the IMBSIs in PBS solution and then perform magnetic separation; S3, synthesis of IMBSIs@AgNPs Synthesize AgNPs by reducing AgNO3 with NaBH4 as a reducing agent according to the method of Shameli K. Adjust the concentration ratio of the two and the incubation time at room temperature to synthesize the best AgNPs. Take the prepared IMBSIs and disperse them in 50 μL of freshly prepared 10 mM AgNO3 solution. Mix well, avoid light, and incubate at 4 ℃ for 10 min. Keep the solution in a suspended state during incubation. Then add 50 μL of freshly prepared 10 mM NaBH4 solution at a uniform speed. Mix well, react for 1 min, immediately centrifuge at 1000 rpm for 1 min, discard the supernatant, and resuspend with 50 μL of sterile deionized water to prepare IMBSIs@AgNPs; S4, establishment of H5N1 subtype avian influenza virus SERS detection method Before detection, the instrument was calibrated with silicon wafer using the Raman peak at 520.7 cm -1 as the reference peak. The Raman spectrometer was set as follows: the Raman spectral scanning range was 500-2000 cm -1 , the excitation was performed using a 532 nm He-Ne laser, the laser power was 13.5 mW, the laser power density was 0.214 mW⋅um -2 , the objective was selected as 50 times, the laser attenuation parameter was selected as 1%, the resolution was set as 1 cm -1 , the exposure time was 1 min, the integration times were 3, in order to improve the signal-to-noise ratio, 15 to 30 points were randomly detected, 10 μL of the sample to be detected was dropped to the center of the quartz slide soaked and rinsed clean with acid, the Raman signal was collected, and the final data analysis was performed using Origin software 8.

5.

2. The SERS detection method for avian influenza virus H5N1 based on immunomagnetic beads-aptamer according to claim 1, characterized in that: The sequences of the screened H5N1 subtype avian influenza virus APT1 aptamer and APT2 aptamer are GCAGAGGTCCGCTGACGGATGGATGGAACAGGGGTTTAGCAGCAGGACCACTCTTGAGCG and ACCTggTTACTgggTggCTACAggggACACCACTCCgCTTCCTCCggCCCggggAgTggC, respectively.

3. The SERS detection method for avian influenza virus H5N1 based on immunomagnetic beads-aptamer according to claim 1, characterized in that: The optimal concentration of AgNO3 and NaBH4 was 10 mM, and the optimal incubation time was 10 min and 1 min, respectively, and the SERS enhancement effect of AgNPs was the strongest.

Images