Use of excitatory amino acid transporter 2 in the preparation of a medicament for modulating inflammatory responses of immune cells

Abstract

The application provides application of excitatory amino acid transporter 2 (EAAT2) in preparation of a medicine for regulating inflammatory reactions of immune cells, and belongs to the technical field of medicines.The expression amount of EAAT2 in M1 type macrophages is increased, and the M1 type macrophage polarization can be inhibited when EAAT2 is inhibited; the Slc1a2 gene of macrophages is specifically knocked out to inhibit the M1 type macrophage polarization.It can be seen that EAAT2 has an important role in the macrophage activation process, and can be used as a research target of macrophage related diseases such as sepsis, obesity and diabetes.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of medicine, and particularly relates to application of excitatory amino acid transporter 2 (EAAT2) in preparation of a medicament for regulating inflammatory response of immune cells. BACKGROUND

[0002] The cells of the immune system can be mainly divided into lymphocytes (including T cells and B cells), neutrophils, dendritic cells, monocytes and macrophages. Macrophages are found in basically all tissues, such as Kupffer cells in hepatocytes, alveolar macrophages in the lung and microglia in the central nervous system. Macrophages phagocytose cell debris, microorganisms, cancer cells and foreign substances through the extension of filopodia. Macrophages usually polarize into two different subsets: classically activated (M1) and alternatively activated (M2) macrophages, which respectively play a key role in anti-inflammatory and pro-inflammatory functions. When exposed to T-helper 1 (Th 1) type cytokines or inflammatory mediators (such as IFN-γ and LPS), macrophages polarize into M1 phenotype to exert their function of clearing pathogens and tumor cells, or exposed to "alternative activation" of macrophages Th 2 cytokines such as IL-4 and IL-10 to exert their anti-inflammatory, wound healing and anti-tumor functions. Activated macrophages produce a variety of chemicals, such as complement proteins, cytokines and enzymes. In addition, macrophages have the ability of antigen presentation. As an important part of the immune system, the regulation of the function of macrophages is crucial for disease prevention and treatment.

[0003] Excitatory amino acid transporters (EAATs) transport glutamate and aspartate in the nerve synapses into cells in the central nervous system (CNS), and five forms of EAATs (EAAT1-5) have been identified, and EAAT2 undertakes most of the uptake and transport of glutamate in the CNS. EAAT2 is encoded by the Slc1a2 gene, and so far, the distribution and function of EAAT2 in macrophages are not clear. Some amino acid transporters have been proved to play an important role in the polarization process of macrophages, such as Slc6A8, Slc36A9, etc., and it is feasible to change the function of macrophages by regulating the expression of these transporters. There is no report about the participation of EAAT2 in the inflammatory response of immune cells. SUMMARY

[0004] Therefore, the purpose of the present application is to provide application of excitatory amino acid transporter 2 in preparation of a medicament for regulating inflammatory response of immune cells, which provides a new means for prevention and treatment of immune cell inflammation.

[0005] The application provides application of excitatory amino acid transporter 2 in preparation of a medicine for regulating inflammatory response of immune cells.

[0006] Preferably, the amino acid sequence of the excitatory amino acid transporter 2 is shown as SEQ ID NO: 1.

[0007] Preferably, the immune cells include macrophages.

[0008] Preferably, the macrophages include M1 type macrophages.

[0009] Preferably, the M1 type macrophages include one or more of peritoneal macrophages, bone marrow-derived macrophages and ANA.1 cell lines.

[0010] The application provides application of a reagent for inhibiting expression of excitatory amino acid transporter 2 or Slc1a2 gene or a reagent for knocking out the Slc1a2 gene in preparation of a medicine for inhibiting polarization of M1 type macrophages.

[0011] The application provides application of a reagent for inhibiting expression of excitatory amino acid transporter 2 or Slc1a2 gene or a reagent for knocking out the Slc1a2 gene in preparation of a medicine for preventing and / or treating diseases related to polarization of M1 type macrophages.

[0012] Preferably, the diseases related to polarization of M1 type macrophages include one or more of sepsis, obesity and diabetes.

[0013] Preferably, the reagent for inhibiting excitatory amino acid transporter 2 is WAY213613.

[0014] Preferably, the reagent for knocking out the Slc1a2 gene is a CRISPR / Cas9 system containing sgRNA.

[0015] The nucleotide sequence of the sgRNA is shown as SEQ ID NO: 18.

[0016] The application provides application of excitatory amino acid transporter 2 in preparation of a medicine for regulating inflammatory response of immune cells. Experiments show that LPS / IFN-gamma stimulates macrophages, and the expression amount of Slc1a2 gene of the macrophages is increased; further WB analysis results show that LPS improves the expression amount of EAAT2 through the NF-kappa B signal path; and by inhibiting the expression of EAAT2 or knocking out the Slc1a2 gene in the macrophages, the secretion of inflammasome is inhibited, the p65 subunit phosphorylation in the NF-kappa B signal path is inhibited, the protein expression of Caspase-1, IL-1beta and TNF-alpha is inhibited, the assembly of M1 type macrophage inflammasome is reduced, the polarization of immune cells is inhibited, and thus the inflammatory response of immune cells is inhibited. The application provides a theoretical basis for prevention and treatment of macrophage related diseases.

[0017] The application provides application of a reagent for inhibiting expression of excitatory amino acid transporter 2 or Slc1a2 gene or a reagent for knocking out the Slc1a2 gene in preparation of a medicine for preventing and / or treating diseases related to M1 type macrophage polarization. Animal experiments show that, compared with wild type mice, Slc1a2 gene knockout mice have a higher survival rate for a LPS induced sepsis model, and have a relieving effect on the body weight of obese and diabetic patients induced by a high-fat diet. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The expression and distribution of Slc1a2 gene and EAAT2 protein in M1 type macrophages are shown in Figures A to H. A: the expression amount of Slc1a2 gene encoding EAAT2 of peritoneal macrophages (PEM) of mice is increased after LPS / IFN-gamma stimulation; B: the mRNA expression of Slc1a2 of bone marrow derived macrophages (BMDM) and macrophage cell line ANA.1 is increased; C: the protein expression of EAAT2 of peritoneal macrophages is increased after LPS / IFN-gamma stimulation; D: EAAT2 mainly distributes in the cytoplasm of resting and M1 type macrophages, and the fluorescence intensity of EAAT2 of M1 type macrophages is higher; E: fluorescence co-localization analysis of EAAT2 protein and lysosome marker LAMP1 co-localization; F: WB detection finds that the lysosome of macrophages has EAAT2 expression, and the expression amount of EAAT2 in the lysosome of M1 type macrophages is increased; G: fluorescence co-localization results show that EAAT2 protein and mitochondrial marker HSP60 co-localize; H: WB detection finds that the mitochondria of macrophages have EAAT2 expression, and the expression amount of EAAT2 in the cytoplasmic protein of the mitochondria is increased; all data are analyzed by T test, and the results are represented as mean ± SEM; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0019] Figure 2 To explore the pathway of LPS / IFN-γ affecting EAAT2 expression in macrophages; A: By finding with related inhibitors, LPS increased the expression of Slcl a2 gene through NF-κΒ signaling pathway; B: WB experiment found that LPS increased the expression of NF-κΒ signaling pathway in macrophages, IL-1β and EAAT2, and the application of IKK inhibitor partially eliminated this phenomenon; C: chIP-qPCR results found that the use of LPS increased the abundance of Slcl a2 gene; D: Dual fluorescence reporter experiment results found that overexpression of p65 subunit of NF-κΒ increased the expression of Slcl a2 promoter, but could not increase the expression of mutant Slcl a2 promoter; All data were analyzed by T test, and the results were expressed as mean ± SEM; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001;

[0020] Figure 3 To explore the pathway of LPS / IFN-γ affecting EAAT2 expression in macrophages; A: By finding with related inhibitors, LPS increased the expression of Slcl a2 gene through NF-κΒ signaling pathway; B: WB experiment found that LPS increased the expression of NF-κΒ signaling pathway in macrophages, IL-1β and EAAT2, and the application of IKK inhibitor partially eliminated this phenomenon; C: chIP-qPCR results found that the use of LPS increased the abundance of Slcl a2 gene; D: Dual fluorescence reporter experiment results found that overexpression of p65 subunit of NF-κΒ increased the expression of Slcl a2 promoter, but could not increase the expression of mutant Slcl a2 promoter; All data were analyzed by T test, and the results were expressed as mean ± SEM; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001;

[0021] Figure 4Overexpression of EAAT2 increased M1 macrophage polarization; A: Overexpression of EAAT2 increased IL-1β and TNF-α secretion of LPS / IFN-γ stimulated macrophages; B: Overexpression of EAAT2 increased Caspase-1, IL-1β, EAAT2 protein expression of LPS / IFN-γ stimulated macrophages; All data were analyzed using T test, results were expressed as mean ± SEM; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001;

[0022] Figure 5 Construction strategy and identification of CKO mice with macrophage-specific knockout of Slc1a2 gene; A: Construction strategy of CKO mice; B: Genotype identification results of CKO mice;

[0023] Figure 6 Inhibition of peritoneal M1 macrophage polarization after macrophage-specific knockout of Slc1a2 gene; A: Inhibition of IL-1β and TNF-α release of M1 macrophages after macrophage-specific knockout of Slc1a2; B: Inhibition of Caspase-1 and IL-1β protein expression and EAAT2 protein expression after macrophage-specific knockout of Slc1a2; C: Reduction of inflammasome assembly of LPS / IFN-γ stimulated macrophages after macrophage-specific knockout of Slc1a2; All data were analyzed using T test, results were expressed as mean ± SEM; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0024] Figure 7A: Survival rate of sepsis model mice after macrophage-specific knockout of Slc1a2 gene; B: Serum IL-1β and TNF-α levels of sepsis model mice after macrophage-specific knockout of Slc1a2 gene; C: Body weight change results of obese mice after macrophage-specific knockout of Slc1a2 gene; D: Body weight gain results of obese mice after macrophage-specific knockout of Slc1a2 gene; E: Glucose tolerance results of obese mice after macrophage-specific knockout of Slc1a2 gene; F: Insulin tolerance results of obese mice after macrophage-specific knockout of Slc1a2 gene; G: Subcutaneous fat IL-1β and TNF-α levels of obese mice after macrophage-specific knockout of Slc1a2 gene; H: Epididymal fat IL-1β and TNF-α levels of obese mice after macrophage-specific knockout of Slc1a2 gene; I: Perirenal fat IL-1β and TNF-α levels of obese mice after macrophage-specific knockout of Slc1a2 gene; All data were analyzed by T test, and the results were expressed as mean ± SEM; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. DETAILED DESCRIPTION

[0025] The application provides an application of excitatory amino acid transporter 2 in preparation of a medicine for regulating inflammatory reactions of immune cells.

[0026]

[0027] In the present application, the immune cells preferably include macrophages. The macrophages preferably include one or more of peritoneal macrophages, bone marrow-derived macrophages, and ANA.1 cell lines. In the embodiments of the present application, peritoneal macrophages, bone marrow-derived macrophages, and ANA.1 cell lines were respectively verified, and the results showed that the expression of the Slc1a2 gene was significantly increased after being stimulated by LPS / IFN-γ for 6h or 12h, and the expression of the Slc1a2 gene was most obviously increased after being stimulated for 6h. At the same time, at the protein level, the protein expression of EAAT2 was determined by Western-blot (WB) technology, and the results showed that the expression of EAAT2 protein in M1-type macrophages was also increased. By changing the expression of EAAT2 protein or its encoding gene, the function of M1-type macrophages was affected, specifically, the polarization of M1-type macrophages was inhibited by inhibiting or knocking out the expression of EAAT2 protein or its encoding gene. The inhibition of the polarization of M1-type macrophages includes inhibiting the expression of M1-type macrophage marker genes Il1b and Inos in M1-type peritoneal macrophages, inhibiting the secretion of IL-1β and TNF-α secreted by M1-type macrophages, inhibiting the secretion of inflammasomes by macrophages, inhibiting the phosphorylation of p65 subunit in the NF-κB signaling pathway, and the protein expression of Caspase-1 and IL-1β, and reducing the assembly of inflammasomes in M1-type macrophages. Overexpression of EAAT2 protein promotes the polarization of M1-type macrophages. Since the polarization of M1-type macrophages is directly related to the occurrence of inflammatory response, inhibiting the polarization of M1-type macrophages is beneficial to improve the inhibition of inflammatory response.

[0028] In the present application, in view of the increased expression of EAAT2 protein or its encoding gene in M1-type macrophages, in order to determine the distribution of EAAT2 protein, the distribution of EAAT2 protein was detected by immunofluorescence detection technology, and the results showed that EAAT2 was distributed in the cytoplasm of macrophages. Combined with co-localization analysis, it was shown that EAAT2 was distributed in lysosomes and mitochondria.

[0029] The present application provides a use of a reagent for inhibiting the expression of excitatory amino acid transporter 2 or Slc1a2 gene or a reagent for knocking out the Slc1a2 gene in the preparation of a medicine for inhibiting the polarization of M1-type macrophages.

[0030] The application does not have special restrictions on the agent for inhibiting excitatory amino acid transporter 2, and any known inhibitor of excitatory amino acid transporter 2 can be used, such as WAY213613. The inhibitory concentration of the WAY213613 is preferably 10 μM. The application does not have special restrictions on the agent for inhibiting Slc1a2 gene expression, and any known agent for inhibiting gene expression can be used, such as a plasmid containing sgRNA, siRNA or shRNA for inhibiting Slc1a2 gene expression. The prevention of M1 macrophage polarization is the same as the above-mentioned inhibition of M1 macrophage polarization, and will not be repeated here.

[0031] The application provides a use of an agent for inhibiting excitatory amino acid transporter 2 or Slc1a2 gene expression or an agent for knocking out Slc1a2 gene in the preparation of a drug for preventing and / or treating an M1 macrophage polarization-related disease.

[0032] In the application, the M1 macrophage polarization-related disease preferably includes one or more of the following: sepsis and obesity.

[0033] In the application, the agent for inhibiting excitatory amino acid transporter 2 is preferably WAY213613. The agent for knocking out Slc1a2 gene is preferably a CRISPR / Cas9 system containing sgRNA. The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 18 (sgRNA1 ATTCTGATGTCAATGGCAGC) and SEQ ID NO: 19 (sgRNA2 CAAGGATATCTCCGAATG).

[0034] In the application, mice with Slc1a2 gene knocked out in macrophages are used as experimental animals, and LPS is used to induce a sepsis mouse model, and a high-fat diet is used to induce an obesity model, to evaluate the effect of Slc1a2 gene knocked out in macrophages on the survival rate of sepsis mice, and the effect of Slc1a2 gene knocked out in macrophages on the body weight, glucose tolerance and insulin tolerance of obesity model mice. The results show that the specific knockout of Slc1a2 gene in macrophages significantly improves the survival rate of mice. The specific knockout of Slc1a2 gene in macrophages significantly reduces the body weight and weight gain of obese mice. The specific knockout of Slc1a2 gene in macrophages significantly improves the glucose tolerance and insulin tolerance of obese mice, indicating that the specific knockout of Slc1a2 gene in macrophages has a certain improvement effect on obesity in mice.

[0035] The above results show that EAAT2 plays an important role in the activation of macrophages and can be used as a research target for macrophage-related diseases such as sepsis, obesity and diabetes for drug research.

[0036] The application of the excitatory amino acid transporter 2 provided by the present application in preparing a medicine for regulating the inflammatory response of immune cells is described in detail below in combination with examples, but they cannot be understood as limiting the protection scope of the present application.

[0037] Example 1

[0038] Increased expression of Slc1a2 gene in M1 macrophages

[0039] In order to study the expression of the gene encoding the excitatory amino acid transporter in M1 macrophages, the peritoneal macrophages, bone marrow-derived macrophages and ANA.1 cell lines were stimulated by LPS / IFN-γ. The LPS concentration was 1 μg / mL, the IFN-γ was 20 ng / mL, and the treatment time was 6 h and 12 h. Then the expression of the three genes was detected by fluorescence quantitative PCR, and the specific primer sequences were as follows.

[0040] β-actin (NM_007393):

[0041] F: GGT GGG AAT GGG TCA GAA GG (SEQ ID NO: 3);

[0042] R: GTA CAT GGC TGG GGT GTT GA (SEQ ID NO: 4);

[0043] Slc1a1 (NM_009199):

[0044] F: TCG CTG CAC TGG ATT CCA AT (SEQ ID NO: 5);

[0045] R: TCA GGT CCA ACA TGG CAT CC (SEQ ID NO: 6);

[0046] Slc1a2 (NM_001077514):

[0047] F: TCT AGC CTG GAT GCC TTC CT (SEQ ID NO: 7);

[0048] R: CCT GTT CAC CCA TCT TCC CC (SEQ ID NO: 8);

[0049] Slc1a3 (NM_148938):

[0050] F: AGA GAT TGC AGC AAG GGG TC (SEQ ID NO: 9);

[0051] R: AAG ACC AGC ATC TGC AGC AT (SEQ ID NO: 10);

[0052] Reaction system: 10 μl system, RT-PCR reaction was performed by SYBR Green on Quant Studio 6 Real-time PCR system, and the difference was calculated by 2 -ΔΔCt way and taking β-actin as internal reference.

[0053] The results showed that the expression of Slc1a2 gene in macrophages of the three sources was increased after being stimulated by LPS / IFN-γ for 6h or 12h, and the results of 6h were more obvious (Fig. 1A and Fig. 1B). These results showed that the expression of Slc1a2 gene in M1 type macrophages was increased. Figure 1 Figure 1

[0054] Example 2

[0055] Expression of EAAT2 protein in M1 type peritoneal macrophages was increased, and its distribution was analyzed

[0056] In order to verify the expression of EAAT2 protein encoded by Slc1a2 gene in M1 type peritoneal macrophages, Western-blot (WB) technology was used to determine the protein expression of EAAT2 in peritoneal macrophages treated by the method of Example 1.

[0057] The results showed that the expression of EAAT2 protein in M1 type macrophages was increased (Fig. 2C). Figure 1

[0058] Then it was found by immunofluorescence that EAAT2 was distributed in the cytoplasm of macrophages, and it was found by co-localization analysis that EAAT2 was distributed in lysosomes and mitochondria (Fig. 2D, Fig. 2E and Fig. 2G). Figure 1 Figure 1 Figure 1

[0059] Lysosomes were separated by lysosome separation kit (Cat NO. 89839, Thermo Fisher), mitochondria were separated by mitochondria separation kit (Cat NO. C3601, Biyun Tian Biotechnology Co., Ltd.), and the proteins were extracted for Western-blot test, and it was found that there was expression of EAAT2 protein.

[0060] Example 3

[0061] LPS improves the expression of Slc1a2 through NF-κB signaling pathway

[0062] ​​​​​​To investigate the pathway by which LPS / IFN-γ affects the expression of Slc1a2 gene and EAAT2 protein in M1 macrophages, IKK 16 (1.5 μM) was used to inhibit the IKK subunit of the NF-κB signaling pathway, and GLPG-0634 (10 μM) and CEP33779 (10 μM) were used to inhibit STAT1 / STAT2 of the JAK / STAT signaling pathway. The treatment method was as follows: after culturing cells in complete medium containing the inhibitors for 1 hour, the medium was replaced with complete medium containing LPS and / or IFN-γ.

[0063] Experimental results showed that LPS alone could increase the expression level of the Slc1a2 gene. Figure 2 In the case of A), inhibiting IKK eliminated this phenomenon, while using IFN-γ alone could not increase the expression level of the Slc1a2 gene.

[0064] Western blot analysis was used to detect the expression levels of NF-κB signaling pathway-related proteins and EAAT2 in M1 macrophages stimulated with LPS and LPS+IIK16. The results further validated that LPS increases EAAT2 expression through the NF-κB signaling pathway. Figure 2 (B)

[0065] Chromatin co-precipitation-quantitative PCR (chIP-qPCR) and dual-luciferase reporter assays verified that the p65 subunit in the NF-κB signaling pathway can bind to the Slc1a2 gene promoter and promote Slc1a2 gene expression. The kit used was: chIP: Plus Enzymatic Chromatin IP Kit (Cell signaling technology, #9005); Dual luciferase reporter assay kit (Promega, E1910). p65 binding site predicted by chIP-qPCR: TGGACTCTCC (SEQ ID NO:11); chIP-qPCR primers: F: CAC GAT TTC CCA GAC AAC CG (SEQ ID NO:12); R: TTC TGC CTT GCA ACC TTC CA (SEQ ID NO:13); amplification method as described in Example 1.

[0066] The results showed that overexpression of the p65 subunit in the NF-κB signaling pathway could increase the promoter abundance of Slc1a2. Figure 2 (C and D). The above results indicate that LPS can promote the expression of Slc1a2 by binding to the promoter in macrophages.

[0067] Example 4

[0068] Inhibition of EAAT2 suppresses M1 macrophage polarization

[0069] To verify the role of EAAT2 in M1 peritoneal macrophage polarization. M1 peritoneal macrophages were treated with 10 μM WAY213613 (a selective inhibitor of EAAT2), and the gene expression of M1 macrophage marker genes Il1b and Inos were detected by fluorescent quantitative PCR.

[0070] The primers used in fluorescent quantitative PCR are as follows:

[0071] Inos (M87039.1):

[0072] F: GCAGAGATTGGAGGCCTTGT (SEQ ID NO: 14)

[0073] R: CCTGATCCAAGTGCTGCAGA (SEQ ID NO: 15)

[0074] Il1b (NM_013693):

[0075] F: CAC AGA AAG CAT GAT CCG CG (SEQ ID NO: 16)

[0076] R: ACT GAT GAG AGG GAG GCC AT (SEQ ID NO: 17). The amplification method is the same as described in Example 1.

[0077] The results show that the use of 10 μM WAY213613 suppresses the gene expression of M1 macrophage marker genes Il1b and Inos in M1 peritoneal macrophages Figure 3 A).

[0078] At the same time, it was found that the inhibition of EAAT2 suppressed the secretion of IL-1β and TNF-α by M1 macrophages Figure 3 B).

[0079] Inhibition of EAAT2 can also inhibit the secretion of IL-1β and TNF-α by LPS Figure 3 C) and Nigermycin-stimulated macrophages Figure 3 D).

[0080] Inhibition of EAAT2 can also inhibit the secretion of inflammatory factors in ANA.1 cell line Figure 3 E) and bone marrow-derived macrophages Figure 3 F).

[0081] Subsequently, Western-Blot detection results showed that inhibiting EAAT2 inhibited the phosphorylation of p65 subunit in the NF-κB signaling pathway, and the protein expression of Caspase-1 and IL-1β Figure 3 Medium G).

[0082] Immunofluorescence results showed that inhibiting EAAT2 reduced the inflammasome assembly in M1 macrophages Figure 3 Medium H).

[0083] Example 5

[0084] Overexpression of EAAT2 promotes M1 macrophage polarization

[0085] Lipofectamine TM 3000 (Invitrogen) was used to transfer the EAAT2 overexpression plasmid into macrophages, and Western-blot technology was used to detect the expression amount of EAAT2 protein to verify whether the overexpression was successful. The overexpression plasmid was commissioned to Wuhan Genecreate Biotechnology Co., Ltd. (Genecreate.cn) for production. The successfully overexpressed macrophages were stimulated with LPS and IFN-γ, and then the levels of IL-1β and TNF-α in the macrophage culture medium were verified by ELISA.

[0086] The results showed that overexpression of EAAT2 can make resting macrophages secrete more IL-1β and TNF-α, and make LPS / IFN-γ stimulated macrophages release more IL-1β, but have little effect on the release of TNF-α Figure 4 Medium A).

[0087] WB results showed that overexpression of EAAT2 can increase the expression of Caspase-1 protein and IL-1β protein Figure 4 Medium B). The above results show that overexpression of EAAT2 has the function of promoting M1 macrophage polarization.

[0088] Example 6

[0089] Macrophage-specific knockout of Slc1a2 gene affects M1 peritoneal macrophage polarization.

[0090] Macrophage-specific knockout of Slc1a2 gene mice were bred from C57bl6J mice carrying the Slc1a2 flox gene and Lyz2-cre tool mice Figure 5 ). The steps are as follows: crossbreed Slc1a2 flox homozygous mice with Lyz2-cre negative mice, and the offspring are Slc1a2 flox / - Lyz2 Cre mice or Slc1a2flox / - Mice, and then Slc1a2 flox / - Lyz2 Cre Mice, and then Slc1a2 flox / flox Homozygous mice are mated, and offspring have a 25% chance of being Slc1a2 fl / fl Lyz2 cre i.e. CKO mice, with a 25% chance of being Slc1a2 flox / flox i.e. WT mice Figure 5 Fig. 2A). Genotypes were detected by PCR gel electrophoresis Figure 5 Fig. 2B), and further verified by Western-blot detection of EAAT2 protein expression Figure 6 Fig. 2B).

[0091] The results of the fluorescent quantitative PCR detection experiment showed that the peritoneal cavity-specific Slc1a2 gene knockout CKO mice (Slc1a2 fl / fl Lyz2 cre Mice) released less IL-1β and TNF-α than WT mice (Slc1a2 fl / fl Mice) after LPS / IFN-γ stimulation of peritoneal macrophages Figure 6 Fig. 3A).

[0092] WB results showed that macrophage-specific Slc1a2 gene knockout inhibited the protein expression of M1 macrophage Caspase-1, IL-1β and EAAT2 Figure 6 Fig. 3B).

[0093] Immunofluorescence results showed that specific knockout of the Slc1a2 gene reduced the assembly of the inflammasome in M1 macrophages Figure 6 Fig. 3C).

[0094] Example 7

[0095] Effect of macrophage-specific Slc1a2 gene knockout on survival rate of LPS-induced sepsis model mice

[0096] Mice with macrophage-specific Slc1a2 gene knockout (genotype Slc1a2 fl / fl Lyz2 Cre , CKO mice) and littermate wild-type mice (genotype Slc1a2 fl / fl , WT mice) prepared in Example 6 were used as experimental subjects, and 25 mg / kg body weight of LPS was injected intraperitoneally to induce a sepsis model. The survival rate of the mice was then observed every 6 hours. In addition, another batch of mice was injected with the same dose of LPS, and the blood of the mice was collected and the serum was separated 3 hours after injection. The levels of IL-1β and TNF-α in the serum were detected using an ELISA kit.

[0097] The results show that the macrophage-specific knockout of Slcl a2 gene significantly improves the survival rate of mice compared with WT mice Figure 7 A). In addition, the serum IL-1 β and TNF-α levels of CKO mice are lower than those of WT mice 3 hours after LPS injection Figure 7 B).

[0098] Example 8

[0099] Effect of macrophage-specific knockout of Slcl a2 gene on high-fat diet-induced obesity in mice

[0100] The mice with macrophage-specific knockout of Slcl a2 gene (genotype Slcl a2 fl / fl Lyz2 Cre , CKO mice) and littermate wild-type mice (genotype Slcl a2 fl / fl , WT mice) were used as experimental subjects, and the mice were fed with a high-fat diet (fats provide 60% of total calories). During the feeding period, the body weight of the mice was recorded every two weeks. At 12 weeks, the glucose tolerance of the mice was tested. The procedure was as follows: the mice were subjected to a 12-hour fasting treatment, and then 1.5 grams per kilogram of body weight of a glucose solution was injected intraperitoneally. The blood glucose of the mice was detected and recorded by a blood glucose meter (Roche) before injection, 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes after injection. The insulin tolerance was tested one week after the glucose tolerance test. The procedure was as follows: the mice were subjected to a 4-hour fasting treatment, and then 0.75 U / kg of body weight of insulin was injected intraperitoneally. The blood glucose of the mice was detected and recorded before injection, 15 minutes, 30 minutes, 60 minutes, and 90 minutes after injection.

[0101] It can be seen that the macrophage-specific knockout of Slcl a2 gene significantly reduces the body weight and weight gain of obese mice Figure 7 C and D). In addition, the macrophage-specific knockout of Slcl a2 gene significantly improves the glucose tolerance level of obese mice Figure 7 E) and reduces the insulin tolerance level Figure 7 F). This indicates that the macrophage-specific knockout of Slcl a2 gene has a certain improvement effect on obesity in mice.

[0102] The mice were sacrificed at 14 weeks of feeding, and the subcutaneous fat, epididymal fat, and perirenal fat of the mice were collected. The levels of IL-1 β and TNF-α in the three fat tissues were detected by an ELISA kit Figure 7 G-I). The results show that the levels of inflammatory factors in the fat tissues of CKO mice are lower than those of WT mice.

[0103] The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. A knockout Slc1a2 The application of gene-specific reagents in the preparation of drugs for the prevention of M1 macrophage polarization-related diseases, wherein the M1 macrophage polarization-related diseases are sepsis and / or obesity; the knockout... Slc1a2 The gene-based reagent is a CRISPR / Cas9 system containing sgRNA1 and sgRNA2; The nucleotide sequence of the sgRNA1 is shown as SEQ ID NO: 18; The nucleotide sequence of the sgRNA2 is shown as SEQ ID NO: 19; The Slc1a2 The nucleotide sequence of the gene is shown as SEQ ID NO: 2.

Images