Apple fruit sugar content regulatory protein MdSWEET9b, its encoding gene and application

By overexpressing or inhibiting the MdSWEET9b protein gene in apple fruits, the fruit sugar content is regulated, and the problem of low sugar content in apple fruits is solved, and the fruit sugar content is significantly improved and the quality is improved, and the breeding time is shortened.

CN116063426BActive Publication Date: 2025-07-25SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210985784.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-15
Publication Date
2025-07-25
Estimated Expiration
2042-08-15

AI Technical Summary

Technical Problem

The technology for controlling sugar content of apple fruits has the problem of a single variety and a sugar content reduction, which affects the flavor quality of the fruit. The existing breeding methods are inefficient and it is difficult to quickly improve the sugar content of fruits.

Method used

By discovering and utilizing the MdSWEET9b protein and its encoding gene in apple fruits, overexpressing or inhibiting the MdSWEET9b gene in plants through genetic engineering means, regulating the sugar content of plants, and increasing or decreasing the sugar content of fruits.

Benefits of technology

Significantly increase or decrease the total sugar content of plant fruits, especially sucrose content, promote fruit sugar accumulation, shorten breeding years, and improve fruit quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003798480110000011
    Figure BDA0003798480110000011
  • Figure BDA0003798480110000021
    Figure BDA0003798480110000021
  • Figure HDA0003798480120000011
    Figure HDA0003798480120000011
Patent Text Reader

Abstract

The present invention discloses an apple fruit sugar content regulatory protein MdSWEET9b, its encoding gene and applications. The present invention provides a protein obtained from Malus pumila, named MdSWEET9b protein, which is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing. The gene encoding the MdSWEET9b protein, named MdSWEET9b gene, also belongs to the scope of protection of the present invention. The present invention also protects the application of the MdSWEET9b protein in regulating the sugar content of plants. The regulation is positive regulation. When the content of the MdSWEET9b protein increases, the sugar content of the plant increases. The present invention can be used for apple breeding related to the sugar content of apple fruits, and shorten the breeding period through directional selection breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to an apple fruit sugar content regulating protein MdSWEET9b and a coding gene and application thereof. Background Art

[0002] "Medicine and food have the same origin, eat nutritiously and eat healthily" has become a consensus among people. Apples have good storage resistance and a long supply cycle. The fruit contains a high proportion of free polyphenols that are easily absorbed by the human body. It has good antioxidant, anti-tumor, prevention of cardiovascular and cerebrovascular diseases and liver protection. It has high nutritional and health value and has the reputation of "An apple a day keeps the doctor away!". Many countries in the world have listed it as a major consumer fruit and strongly recommend it. However, the survey results in recent years show that the fruit variety is single, the homogeneity problem is prominent, the sugar content of the fruit is reduced, and the quality has dropped sharply. Therefore, breeders have effectively utilized germplasm resources such as Xinjiang wild apples, carried out distant hybridization breeding, and further cultivated characteristic diversified varieties, which has promoted the transformation and upgrading of the apple industry and the supply-side structural reform, and continuously increased farmers' income and improved human health.

[0003] The sugar content in the fruit directly determines the flavor quality of the fruit. Focusing on the scientific protection and sustainable and efficient utilization of Xinjiang wild apple germplasm resources, we constructed the first-generation hybrid and second-generation backcross populations of Xinjiang red-fleshed apples and apple varieties [high-sugar variety Gala × high-flavonoid apple excellent germplasm (CSR6R6)]. The study clarified the genetic structure and genetic diversity characteristics of Xinjiang wild apple populations, the technical parameters for core germplasm construction, the genetic variation characteristics and developmental mechanisms of traits such as flavonoid content, and established an efficient apple breeding technology system that organically combines conventional hybridization and biotechnology, creating a batch of new varieties and excellent germplasm. Summary of the invention

[0004] The purpose of the present invention is to provide an apple fruit sugar content regulating protein MdSWEET9b and its encoding gene and application.

[0005] The present invention provides a protein obtained from apple (Malus pumila), named as MdSWEET9b protein, which is as follows (a1) or (a2):

[0006] (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing;

[0007] (a2) A protein derived from sequence 1 in which the amino acid sequence of sequence 1 is substituted and / or deleted and / or added with one or more amino acid residues and which is associated with the sugar content of plants.

[0008] To facilitate the purification and detection of the MdSWEET9b protein in (a1), a tag shown in Table 1 can be linked to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

[0009] Table 1 Sequences of Tags

[0010]

[0011]

[0012] The protein in the above (a2) can be artificially synthesized, or its coding gene can be synthesized first and then obtained through biological expression. The coding gene of the protein in the above (a2) can be obtained by deleting the codons of one or several amino acid residues in the DNA sequences shown in Sequence 2 or Sequence 3 in the Sequence Listing, and / or performing missense mutations of one or several base pairs, and / or linking the coding sequences of the tags shown in Table 1 at its 5′ end and / or 3′ end.

[0013] The gene encoding the MdSWEET9b protein, named the MdSWEET9b gene, also belongs to the protection scope of the present invention.

[0014] The MdSWEET9b gene is specifically as follows (1) or (2) or (3) or (4) or (5):

[0015] (1) A DNA molecule whose coding region is shown in Sequence 2 in the Sequence Listing;

[0016] (2) A DNA molecule whose coding region is shown in the nucleotides at positions 1-801 of Sequence 2 in the Sequence Listing;

[0017] (3) A DNA molecule shown in Sequence 3 in the Sequence Listing;

[0018] (4) A DNA molecule that hybridizes with the DNA sequence defined in (1) or (2) or (3) under stringent conditions and encodes a protein related to the sugar content of plants;

[0019] (5) A DNA molecule that has more than 98% homology with the DNA sequence defined in (1) or (2) or (3) and encodes a protein related to the sugar content of plants.

[0020] The above stringent conditions can be a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS, and hybridize and wash the membrane at 65°C in a DNA or RNA hybridization experiment.

[0021] The recombinant expression vector, expression cassette, transgenic cell line, transgenic plant tissue or recombinant bacterium containing the MdSWEET9b gene all belong to the protection scope of the present invention.

[0022] The present invention also protects the application of the MdSWEET9b protein in regulating the sugar content of plants.

[0023] The regulation is positive regulation.

[0024] When the content of the MdSWEET9b protein increases, the sugar content of the plant increases.

[0025] When the content of the MdSWEET9b protein decreases, the sugar content of the plant decreases.

[0026] The sugar content of the plant refers to the sugar content of the plant fruit.

[0027] The sugar content refers to the total sugar content.

[0028] The sugar content refers to the sucrose content.

[0029] The present invention also protects the application of the MdSWEET9b gene in cultivating transgenic plants with increased sugar content.

[0030] The sugar content refers to the sugar content of the fruit.

[0031] The sugar content refers to the total sugar content.

[0032] The sugar content refers to the sucrose content.

[0033] The present invention also protects a method for cultivating transgenic plants, which includes the following steps: introducing the MdSWEET9b gene into a starting plant to obtain a transgenic plant with a sugar content higher than that of the starting plant.

[0034] The present invention also protects a method for cultivating transgenic plant tissues, which includes the following steps: introducing the MdSWEET9b gene into starting plant tissues to obtain transgenic plant tissues with a sugar content higher than that of the starting plant tissues.

[0035] The sugar content refers to the total sugar content.

[0036] The sugar content refers to the sucrose content.

[0037] The MdSWEET9b gene can be specifically introduced into the starting plant through a recombinant expression vector containing the MdSWEET9b gene. Existing plant expression vectors can be used to construct a recombinant expression vector containing the MdSWEET9b gene. When using the MdSWEET9b gene to construct a recombinant expression vector, any one of enhancer-type, constitutive, tissue-specific or inducible promoters can be added before the transcription start nucleotide, and they can be used alone or in combination with other plant promoters; in addition, when using the MdSWEET9b gene to construct a recombinant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the start codon in the adjacent region, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. For the convenience of identifying and screening transgenic plant cells or plants, the used plant expression vector can be processed, such as adding a gene that can produce a color change enzyme or a luminescent compound in plants, an antibiotic marker with resistance, or an anti-chemical reagent marker gene, etc. Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened by phenotype.

[0038] The recombinant expression vector containing the MdSWEET9b gene can specifically be the following recombinant plasmid: the small fragment between the SalI and SmaI restriction enzyme recognition sequences in the pRI101 vector is replaced with the DNA molecule shown by the 1st to 801st nucleotides in Sequence 2 of the Sequence Listing.

[0039] The recombinant expression vector containing the MdSWEET9b gene can specifically be the following recombinant plasmid: the small fragment between the XbaI and SmaI restriction enzyme recognition sequences in the pBI121 vector is replaced with the DNA molecule shown by the 1st to 801st nucleotides in Sequence 2 of the Sequence Listing.

[0040] The present invention also protects a method for cultivating transgenic plants, including the following steps: inhibiting the expression of the MdSWEET9b gene in the starting plant to obtain a transgenic plant with a sugar content lower than that of the starting plant.

[0041] The present invention also protects a method for cultivating transgenic plant tissues, including the following steps: inhibiting the expression of the MdSWEET9b gene in the starting plant tissues to obtain transgenic plant tissues with a sugar content lower than that of the starting plant tissues.

[0042] Inhibiting the expression of the MdSWEET9b gene in the starting plant is specifically achieved by introducing a substance for inhibiting the expression of the MdSWEET9b gene.

[0043] The substance for inhibiting the expression of the MdSWEET9b gene may specifically be an interfering vector targeting the MdSWEET9b gene.

[0044] The interfering vector may specifically be the following recombinant plasmid: inserting the double-stranded DNA molecule shown in Sequence 4 of the Sequence Listing into the BsaI digestion site of the pHSE401 vector to obtain the recombinant plasmid.

[0045] The total sugar content in any of the above = sucrose content + glucose content + fructose content + sorbitol content.

[0046] The plant in any of the above may be a monocotyledon or a dicotyledon.

[0047] The dicotyledon may specifically be a Rosaceae plant. The Rosaceae plant may specifically be a Malus plant. The Malus plant may specifically be Malus domestica, and more specifically, 'Orin' apple.

[0048] The present invention has great application and promotion value for plant breeding, especially apple breeding.

[0049] The inventor of the present invention discovered a new protein and its coding gene from the F2 generation of Xinjiang red-fleshed apple hybrids, named MdSWEET9b protein and MdSWEET9b gene respectively. The expression level of the MdSWEET9b gene was extremely significantly positively correlated with the total sugar content of fruits, and positively regulated fruit sugar accumulation. The results of the heterologous transformation of the sucrose yeast mutant SUSY7 / ura3 showed that the MdSWEET9b protein could specifically transport sucrose into the yeast mutant, thereby promoting the normal growth of the yeast mutant strain. The MdSWEET9b gene was introduced into 'Orin' apple callus by Agrobacterium-mediated overexpression. Compared with the wild-type callus, the total sugar content (mainly sucrose content) of the transgenic callus increased. By inhibiting the expression of the MdSWEET9b gene in 'Orin' apple callus through the CRISPR / Cas9 system, compared with the wild-type callus, the total sugar content (mainly sucrose content) of the callus with the target gene inhibited decreased. The above results indicate that the expression of the MdSWEET9b gene promotes the entry of sugar into fruit cells, thereby increasing the total sugar content of fruits. In addition, by comparing the growth status of MdSWEET9b-121-GUS overexpressing callus and 35S::GUS overexpressing callus in culture systems with different sugar components, it was found that overexpressing the MdSWEET9b gene promoted callus growth. The results of GUS staining activity determination showed that the MdSWEET9b-GUS activity was higher on the sucrose medium, indicating that the MdSWEET9b gene preferentially promoted the entry of sucrose into cells, ultimately promoting callus growth.

[0050] The present invention can be used for apple breeding related to the sugar content of apple fruits, and shorten the breeding years through directional selection breeding. Brief Description of the Drawings

[0051] Figure 1 It is a result diagram of the subcellular localization of MdSWEET9b protein in Example 2.

[0052] Figure 2 It is a result diagram of the correlation analysis between the expression level of MdSWEET9b gene and sugar content in Example 3.

[0053] Figure 3 It is a result diagram of the function verification of MdSWEET9b protein in the sucrose-transporting yeast mutant SUSY7 / ura3 in Example 4.

[0054] Figure 4 It is a result diagram of the overexpression of MdSWEET9b gene increasing the sugar content in Example 5.

[0055] Figure 5 It is the relevant sequencing result of three RNAi transgenic lines in Example 6.

[0056] Figure 6 It is a result diagram of the down-regulation of MdSWEET9b gene reducing the sugar content in Example 6.

[0057] Figure 7 It is the growth status of MdSWEET9b-121-GUS overexpressing callus and 35S::GUS overexpressing callus in a culture system with different sugar components in Example 7. Detailed Description of the Invention

[0058] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0059] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. Unless otherwise specified, the quantitative tests in the following examples are all set with three repeated experiments, and at least three repeated treatments are set in each repeated experiment, and the results are averaged. pRI101 vector (also known as "pRI101-ANDNA"): Takala Company, Code No. 3262. Agrobacterium tumefaciens LBA4404: Tiangen Company, product catalog number: CC2901. Competent Agrobacterium tumefaciens GV3101 (pSoup-p19): Shanghai Weidi Biotechnology Co., Ltd.; CAT# is AC1003.

[0060] For the method of preparing young leaf callus, please refer to the literature: Ji X H, Zhang R, Wang N, Yang L & Chen X S. Transcriptome profiling reveals auxin suppressed anthocyanin biosynthesis in red-fleshed apple callus (Malus sieversii f. niedzwetzkyana). Plant Cell Tiss Organ Cult, 2015, 123: 389–404.

[0061] For the method of measuring GUS enzyme activity, please refer to the literature: XING-BIN, XIE, SHEN, LI, RUI-FEN, & ZHANG, et al. The bHLH transcription factor mdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples. Plant, Cell & Environment, 2012, 35(11), 1884-1897.

[0062] The pYES-DEST2 vector (i.e., vector pYES-DEST2 in the literature) is described in the following literature: "MdERDL6-mediated glucose efflux to the cytosol promotes sugar accumulation in the vacuole through up-regulating tsts in apple and tomato". Proceedings of the National Academy of Sciences, 118(1), e2022788118.

[0063] The SUSY7 / ura3 strain (i.e., mutant SUSY7 / ura3 yeast in the literature) is described in the following literature: "Plasma membrane-localized SlSWEET7a and SlSWEET14 regulate sugar transport and storage in tomato fruits". Horticulture Research, 2021, 8:186.

[0064] The pBI121 vector (i.e., pBI121 plasmid in the literature) is described in the following literature: "The proanthocyanidin-specific transcription factor MdMYBPA1 initiates anthocyanin synthesis under low-temperature conditions in red-fleshed apples". The Plant journal: for cell and molecular biology, 2018, 96(1):39 - 55.

[0065] The pHB vector (i.e., pHB vector in the literature) is described in the following literature: "JrWRKY21 interacts with JrPTI5L to activate the expression of JrPR5L for resistance to Colletotrichum gloeosporioides in walnut", The Plant Journal, (2022), doi:10.1111 / tpj.15883.

[0066] Example 1. Discovery of MdSWEET9b Protein and Its Encoding Gene

[0067] The inventors measured the fruit sugar content of the F2 hybrid population of Xinjiang red-fleshed apple and Gala variety by liquid chromatography and found that there were significant differences in fruit sugar content among different plants. Further, through qPCR analysis and transgenic methods, the inventors discovered a key protein that regulates fruit sugar content, namely MdSWEET9b protein. The gene encoding MdSWEET9b protein was named MdSWEET9b gene.

[0068] The MdSWEET9b protein is as shown in Sequence 1 of the sequence listing. The coding frame in the cDNA is as shown in Sequence 2 of the sequence listing. The MdSWEET9b gene in the genomic DNA is as shown in Sequence 3 of the sequence listing.

[0069] Sequencing showed that the genomic DNA of Wanglin apple also has the MdSWEET9b gene shown in Sequence 3 of the sequence listing.

[0070] Example 2. Subcellular Localization of MdSWEET9b Protein

[0071] I. Construction of Recombinant Plasmid and Recombinant Agrobacterium

[0072] Replace the small fragment between the HindIII and BamH I restriction enzyme recognition sequences of the pHB vector with the double-stranded DNA molecule shown by the nucleotides at positions 1-801 in Sequence 2 of the sequence listing to obtain the recombinant plasmid SWEET9b-PHB-GFP.

[0073] Introduce the recombinant plasmid SWEET9b-PHB-GFP into the competent cells of Agrobacterium tumefaciens GV3101 (pSoup-p19) to obtain recombinant Agrobacterium, named SWEET9b-GV3101.

[0074] Introduce the pHB vector into the competent cells of Agrobacterium tumefaciens GV3101 (pSoup-p19) to obtain recombinant Agrobacterium, named pHB-GFP-GV3101.

[0075] II. Agrobacterium-mediated Transient Infection of Tobacco Leaves and Localization Observation

[0076] Collect the recombinant Agrobacterium cells, wash them with ddH2O, and then resuspend the cells with MES infection solution to obtain a bacterial suspension with an OD 600nm value of 0.8. MES infection solution (pH 5.5): 500 μl MES solution (0.2 M), 100 μl MgCl2·6H2O solution (1 M), 15 μl AS solution (100 mM), and make up the volume to 10 ml with ddH20.

[0077] Nicotiana benthamiana plants for subcellular localization grew to a size of 4 - 5 leaves. The newly prepared bacterial suspension was allowed to stand for 3 h in the dark and then injected into the tobacco plants. The injected tobacco plants were cultured in the dark for 24 h and then transferred to light for continued culture for 48 h, and the fluorescence results were observed using a super - resolution laser confocal microscope (Zeiss LSM880).

[0078] Exemplary photos are shown in Figure 1 . The MdSWEET9b protein is localized on the plasma membrane.

[0079] Example 3. Correlation analysis of MdSWEET9b gene expression level and sugar content

[0080] Tested apples: F2 generation population of the hybrid between Xinjiang red - flesh apple and Gala variety.

[0081] 1. Fresh pulp of mature apple fruits was taken to extract total RNA, and cDNA was obtained by reverse transcription.

[0082] 2. Using cDNA as a template, the relative expression level of the MdSWEET9b gene was detected by qRT - PCR. Using the MdActin gene as an internal reference gene, the 2 -ΔΔCT method was used for analysis. The primers for detecting the MdSWEET9b gene consisted of MdSWEET9b - F and MdSWEET9b - R. The primers for detecting the MdActin gene consisted of Actin - F and Actin - R.

[0083] MdSWEET9b - F: TGTGGTTCTTCTACGGATT;

[0084] MdSWEET9b - R: AACTTCTTCATCTCCTGAGT.

[0085] Actin - F: TGACCGAATGAGCAAGGAAATTACT;

[0086] Actin - R: TACTCAGCTTTGGCAATCCACATC.

[0087] The results are shown in Figure 2 A. Different numbers represent different plants.

[0088] 3. Fresh pulp of mature apple fruits was taken as the test sample to detect the sugar content.

[0089] The method for detecting the sugar content is as follows:

[0090] ① Weigh 5.0 g of the test sample with fresh weight, add 10 ml of ddH2O, and grind it into a homogenate to obtain fruit pulp.

[0091] ② Take the pulp obtained in step ①, water bath at 80 °C for 30 min, then centrifuge at 12000 rpm for 10 min, and collect the supernatant.

[0092] ③ Add 10 ml of ddH2O to the residue of step ②, water bath at 80 °C for 30 min, then centrifuge at 12000 rpm for 10 min, and collect the supernatant.

[0093] ④ Combine the supernatant obtained in step ② and the supernatant obtained in step ③, then add ddH2O to a total volume of 50 ml, and then filter with a 0.45 μm filter membrane to collect the filtrate.

[0094] ⑤ Prepare standard solutions with sucrose standard, glucose standard, fructose standard and sorbitol standard respectively, and detect by HPLC (parameters are the same as in step ⑥). Make a standard curve of the peak area of the target peak and the standard content.

[0095] ⑥ Take the filtrate obtained in step ④, load the sample and then perform HPLC. Substitute the peak area of the target peak into the standard curve to calculate the sucrose content, glucose content, fructose content and sorbitol content in the pulp, and the unit is mg / g fresh weight. Calculate the total sugar content. Total sugar content = sucrose content + glucose content + fructose content + sorbitol content.

[0096] The chromatographic column used in HPLC: 7.8×300 mm Carbomix Ca NP column (Sepax). Column temperature: 80 °C.

[0097] Mobile phase: ultrapure water. Mobile phase flow rate: 1 ml min -1 .

[0098] Sample loading volume: 10 μl.

[0099] Refractive index detector temperature: 35 °C.

[0100] 4. Take the data obtained in step 2 and the data obtained in step 3, and use Microsoft Excel 2007 software to calculate the correlation coefficient between the relative expression level of the MdSWEET9b gene and the total sugar content. The results are shown in Figure 2 of B.

[0101] Example 4. Functional verification of MdSWEET9b protein in the sucrose transporter yeast mutant SUSY7 / ura3

[0102] 1. Obtaining the SWEET9b-pYES-DEST2 plasmid

[0103] Replace the small fragment between the recognition sequences of AgeⅠ and PemⅠ of the pYES-DEST2 vector with the double-stranded DNA molecule shown by the 1st to 801st nucleotides in Sequence 2 of the sequence list to obtain the recombinant plasmid SWEET9b-pYES-DEST2.

[0104] 2. Transiently transform the yeast strain SUSY7 / ura3 with SWEET9b-pYES-DEST2

[0105] The SUSY7 / ura3 strain is a yeast strain lacking sucrose transport.

[0106] (1) Preparation of SUSY7 / ura3 yeast competent cells

[0107] Inoculate the SUSY7 / ura3 strain on a YPD solid medium by streaking and incubate it upside down in a 30 °C incubator for 2.5 days. Then pick a single colony and inoculate it into 3 ml of YPD liquid medium and culture it overnight at 30 °C and 220 rpm. Pipette 5 μl of the bacterial liquid into 50 ml of YPD liquid medium and culture it at 30 °C and 220 rpm until the OD 600nm value reaches 0.3 - 0.4. Then transfer the whole culture system to a 100 ml centrifuge tube, centrifuge at 700 g for 5 min, collect the cells, add 100 ml of YPD liquid medium to resuspend the cells, and culture at 30 °C and 220 rpm until the OD 600nm value reaches 0.5. Then, divide the culture system into two 100 ml centrifuge tubes, centrifuge at 700 g for 5 min, discard the supernatant, add 30 ml of sterile ddH2O to the cell pellet to resuspend the cells, centrifuge at 700 g for 5 min, discard the supernatant, add 1.5 ml of 1.1×TE / LiAC to the cell pellet to resuspend the cells, transfer the resuspended cells to 2 ml centrifuge tubes respectively, centrifuge at high speed for 15 s, discard the supernatant, add 600 μl of 1.1×TE / LiAC to the cell pellet to resuspend the cells, and place it on ice for transformation.

[0108] (2) Transformation of SUSY7 / ura3 yeast competent cells and functional verification of MdSWEET9b

[0109] Use the Yeastnaker TM Yeastformation System 2KIT yeast transformation kit (Clontech, USA) to transform yeast.

[0110] The test plasmid is: pYES-DEST2 vector or recombinant plasmid SWEET9b-pYES-DEST2.

[0111] Specific method: Add 7 μl of the test plasmid into a pre-cooled 1.5 ml centrifuge tube, add 10 μl of pre-denatured Carrier DNA, mix gently, then add 50 μl of SUSY7 / ura3 yeast competent cells and 500 μl of PEG / LiAC in sequence. Incubate in a water bath at 30 °C for 30 min (mix up and down every 10 min), then add 20 μl of DMSO, mix gently, incubate in a water bath at 42 °C for 15 min (mix up and down every 5 min), ice bath for 2 min, centrifuge at high speed for 15 s, discard the supernatant and collect the thalli. Add 1 ml of 0.9% NaCl aqueous solution to resuspend the thalli, and then streak on a uracil (ura)-deficient selection medium with 2% glucose as the sole carbon source, and culture at 30 °C for 2.5 days.

[0112] Pick single colonies for colony PCR identification.

[0113] Pick positive clones and culture them in 3 ml of SD-ura liquid medium containing 2% glucose until the OD 600nm value reaches 1.0. Pipette 1 ml of the bacterial solution into a 1.5 ml centrifuge tube, centrifuge at high speed to collect the thalli, wash the thalli 3 times with sterile ddH2O, serially dilute the bacterial solution by 10-fold gradients, spot inoculate onto uracil (ura)-deficient selection media (SD-ura+glucose, SD-ura+sucrose) containing different carbon sources, and culture in an inverted position in an incubator at 30 °C to observe the bacterial growth rate.

[0114] The photos are shown in Figure 3 A of

[0115] Draw a growth curve: Pick positive clones and grow them in a liquid medium (SD-ura) supplemented with 2% sucrose, and measure the OD 600 value of the cell culture every 4 h. See Figure 3 B of

[0116] Example 5. Overexpression of the MdSWEET9b gene increases the sugar content

[0117] I. Construction of the MdSWEET9b overexpression vector

[0118] 1. Synthesize the double-stranded DNA molecule shown in Sequence 2 of the sequence listing.

[0119] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, perform PCR amplification with the primer pair consisting of MdSWEET9b-F and MdSWEET9b-R, and recover the PCR amplification product.

[0120] MdSWEET9b-F: ttgatacatatgccc gtcgac ATGCGGTTCTTGAATACTGAACAA;

[0121] MdSWEET9b-R: tcagaattcggtacc cccggg TACGTGTTCATCGTTTGCTTCG。

[0122] 3. Take the pRI101 vector, perform double digestion with restriction endonucleases SalI and SmaI, and recover the vector backbone of approximately 10 kb.

[0123] 4. The vector backbone recovered in step 3 and the PCR amplification product recovered in step 2 are ligated by homologous recombination to obtain a circular recombinant plasmid of approximately 10 kb, which is the MdSWEET9b overexpression vector. The MdSWEET9b overexpression vector has been verified by sequencing. Compared with the pRI101 vector, the difference in the MdSWEET9b overexpression vector is only that: the small fragment between the SalI and SmaI restriction enzyme recognition sequences in the pRI101 vector is replaced by the DNA molecule shown by nucleotides 1-801 in sequence 2 of the sequence listing.

[0124] II. Preparation of transgenic callus

[0125] 1. Introduce the MdSWEET9b overexpression vector into Agrobacterium tumefaciens LBA4404 to obtain recombinant Agrobacterium. Take the recombinant Agrobacterium cells, wash them with ddH2O, and then suspend them in 30 ml of liquid MS medium to obtain a bacterial suspension with an OD 600nm value of 0.8. Then add 30 μL of 100 mM acetosyringone solution (the solvent is DMSO), which is the infection solution.

[0126] 2. Take the young leaf callus of 'Wanglin' apple and inoculate it on the solid MS medium plate, and culture it in the dark at 25 °C for 15 days.

[0127] 3. After completing step 2, take the callus, immerse it in the infection solution obtained in step 1, shake it at 160 rpm at room temperature for 30 min, and then blot the surface dry with a sterilized filter paper.

[0128] 4. After completing step 3, take the callus and place it on the co-culture medium (solid MS medium containing 1 mg / L 2,4-D and 0.5 mg / L 6-BA), and culture it in the dark at 25 °C for 36 hours.

[0129] 5. After completing step 4, take the callus and place it on the screening medium (solid MS medium containing 50 mg / L kanamycin, 250 mg / L carbenicillin, 1 mg / L 2,4-D and 0.5 mg / L 6-BA), and culture it in the dark at 25 °C for 20 - 30 days.

[0130] 6. After completing Step 5, take the resistant calli that can grow on the screening medium, extract genomic DNA, and perform PCR identification. If a band of the expected size is amplified, the corresponding calli are MdSWEET9b gene - transformed calli.

[0131] The primer pairs used for PCR identification are as follows (the target sequence is about 850 bp):

[0132] 35S - F: GACGCACAATCCCACTATCC;

[0133] S9b - R: TACGTGTTCATCGTTTGCTTCG.

[0134] 7. Inoculate the MdSWEET9b gene - transformed calli obtained in Step 6 onto a screening medium (solid MS medium containing 50 mg / L kanamycin, 250 mg / L carbenicillin, 1 mg / L 2,4 - D, and 0.5 mg / L 6 - BA) plate for sub - culture. Calli sub - cultured from the same callus are called 1 line.

[0135] III. Preparation of wild - type calli

[0136] Take the young leaf calli of 'Wanglin' apple and inoculate them onto a solid MS medium plate containing 1 mg / L 2,4 - D and 0.5 mg / L 6 - BA for sub - culture.

[0137] IV. Sugar content determination

[0138] The tested calli are respectively: the calli sub - cultured for 20 days in Step 2 (three MdSWEET9b gene - transformed callus lines, OE - S9b - 2 line, OE - S9b - 4 line, and OE - S9b - 6 line), and the wild - type calli sub - cultured for 20 days in Step 3 (represented by WL).

[0139] Photos of the tested calli are shown in Figure 4 A of

[0140] Detect the sugar content of the tested calli (the tested calli are used as test substances). The detection method is the same as Step 3 of Example 3.

[0141] The sugar content results are shown in Figure 4B, C, D, E, and F (total sugar, i.e., total sugar; sucrose is sucrose, glucose is glucose, fructose is fructose, and sorbitol is sorbitol). Compared with wild-type callus, the total sugar content of MdSWEET9b transgenic callus was significantly increased, and the sucrose content was significantly increased (2.3 times that of wild-type callus), while the glucose content, fructose content, and sorbitol content increased slightly.

[0142] Example 6: Inhibitory expression of MdSWEET9b gene reduces sugar content

[0143] I. Construction of recombinant plasmid

[0144] Insert the double-stranded DNA molecule shown in Sequence 4 of the sequence listing into the BsaI restriction site of the pHSE401 vector to obtain a recombinant plasmid (the recombinant plasmid has been verified by sequencing), which is the inhibitory expression vector.

[0145] In Sequence 4 of the sequence listing, nucleotides 18-37 encode the target sequence binding region of the first sgRNA, and nucleotides 38-113 encode the backbone region of the first sgRNA. In Sequence 4 of the sequence listing, nucleotides 592-611 encode the target sequence binding region of the second sgRNA, and nucleotides 612-687 encode the backbone region of the second sgRNA.

[0146] II. Preparation of inhibitory expression callus

[0147] 1. Replace the MdSWEET9b overexpression vector with the inhibitory expression vector, and the other steps are the same as Step 1 in Example 5.

[0148] 2. The same as Step 2 in Example 5.

[0149] 3. The same as Step 3 in Example 5.

[0150] 4. The same as Step 4 in Example 5.

[0151] 5. The same as Step 5 in Example 5.

[0152] 6. After completing Step 5, take the resistant callus that can grow on the screening medium, extract genomic DNA, perform PCR amplification using the primer pair composed of S9b-F and S9b-R, then recover the PCR amplification product and sequence it, and observe whether mutations occur in the target site and the sequences on both sides of the target site. The callus with mutations in the MdSWEET9b gene knockout is called the inhibitory expression callus.

[0153] S9b-F: TTGATCATCAGCATCAACAGC;

[0154] S9b-R: TACGTGTTCATCGTTTGCTTC。

[0155] Three independent calli with MdSWEET9b gene knockout were obtained and named S9b-Cas9-3, S9b-Cas9-5, and S9b-Cas9-7, respectively.

[0156] In S9b-Cas9-3, S9b-Cas9-5, and S9b-Cas9-7, multiple substitutions, deletions, and insertions occurred in the nucleotide sequences at target sites 1 and 2 (see the relevant sequencing results in Figure 5 ).

[0157] 7. Inoculate the MdSWEET9b gene knockout calli obtained in step 6 onto a screening medium (solid MS medium containing 50 mg / L kanamycin, 250 mg / L carbenicillin, 1 mg / L 2,4-D, and 0.5 mg / L 6-BA) plate for subculture. Calli subcultured from the same callus are called one strain.

[0158] III. Preparation of wild-type calli

[0159] Take the young leaf calli of 'Wanglin' apple and inoculate them onto a solid MS medium containing 1 mg / L 2,4-D and 0.5 mg / L 6-BA for subculture.

[0160] IV. Sugar content determination

[0161] The test calli are as follows: the calli subcultured for 20 days in step II (S9b-Cas9-3 strain, S9b-Cas9-5 strain, and S9b-Cas9-7 strain), and the wild-type calli subcultured for 20 days in step III (denoted as WL).

[0162] Detect the relative expression level of the MdSWEET9b gene in the test calli (the method is the same as step 2 of Example 3).

[0163] Detect the sugar content of the test calli (the test calli are used as test substances). The detection method is the same as step 3 of Example 3.

[0164] The results are shown in Figure 6 . The results show that: compared with the wild-type calli, the expression level of the MdSWEET9b gene in the MdSWEET9b gene knockout calli is significantly reduced, and the total sugar content, sucrose content, fructose content, and glucose content are all significantly reduced (among the effects on sugar components, the inhibitory effect on sucrose content accumulation is the most significant).

[0165] Example 7,

[0166] To further verify the function of MdSWEET9b protein in sugar accumulation, the growth of transgenic calli under different sugar components was observed, and the effect of MdSWEET9b protein on fruit sugar content was further verified by MdSWEET9b-GUS activity under sugar components.

[0167] I. Construction of MdSWEET9b-121-GUS overexpression vector

[0168] 1. Synthesize the double-stranded DNA molecule shown in Sequence 2 of the sequence listing.

[0169] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, perform PCR amplification with the primer pair consisting of MdSWEET9b-F and MdSWEET9b-R, and recover the PCR amplification product.

[0170] MdSWEET9b-F: gagaacacgggggac tctaga ATGCGGTTCTTGAATACTGAACAA;

[0171] MdSWEET9b-R: ataagggactgacca cccggg TACGTGTTCATCGTTTGCTTCG.

[0172] 3. Take the pBI121 vector, perform double digestion with restriction endonucleases XbaI and SmaI, and recover the vector backbone of about 8 kb.

[0173] 4. The vector backbone recovered in step 3 and the PCR amplification product recovered in step 2 are ligated by homologous recombination to obtain a circular recombinant plasmid of about 8 kb, which is the recombinant plasmid MdSWEET9b-121-GUS. The recombinant plasmid MdSWEET9b-121-GUS has been verified by sequencing. Compared with the pBI121 vector, the difference in the recombinant plasmid MdSWEET9b-121-GUS is only that: the small fragment between the XbaI and SmaI restriction enzyme recognition sequences in the pBI121 vector is replaced with the DNA molecule shown by the 1st to 801st nucleotides in Sequence 2 of the sequence listing.

[0174] II. Preparation of transgenic callus

[0175] 1. Replace the MdSWEET9b overexpression vector with the recombinant plasmid MdSWEET9b-121-GUS, and the others are the same as step 1 of step two in Example 5.

[0176] 2. The same as step 2 of step two in Example 5.

[0177] 3. The same as step 3 of step two in Example 5.

[0178] 4. The same as item 4 in Step 2 of Example 5.

[0179] 5. The same as item 5 in Step 2 of Example 5.

[0180] 6. The same as item 6 in Step 2 of Example 5.

[0181] 7. Inoculate the transgenic callus obtained in Step 6 onto a screening medium (solid MS medium containing 50 mg / L kanamycin, 250 mg / L carbenicillin, 1 mg / L 2,4-D, and 0.5 mg / L 6-BA) plate for subculture. The callus subcultured from the same callus is called 1 strain.

[0182] III. Preparation of Empty Vector-Transformed Callus

[0183] Use the pBI121 vector to replace the recombinant plasmid MdSWEET9b-121-GUS, and operate according to Step 2 to obtain empty vector-transformed callus, denoted as 35S::GUS.

[0184] IV. Trait Identification

[0185] The tested calli are respectively: the calli subcultured for 20 days in Step 2 (three MdSWEET9b gene-transformed callus strains, S9b-GUS-1 strain, S9b-GUS-2 strain, and S9b-GUS-4 strain), and the empty vector-transformed callus subcultured for 20 days in Step 3.

[0186] 1. Culture the callus on a sugar-containing medium plate.

[0187] The sugar-containing medium is obtained by adding sugar (so that its concentration in the medium is 3%, i.e., 3 g / 100 ml) to the MS solid medium.

[0188] The sugars are respectively: sucrose, glucose, fructose, sorbitol.

[0189] The phenotypic photos of the callus cultured in the sugar-containing medium for 20 days are shown in Figure 7 A of

[0190] 2. GUS Activity Staining Analysis

[0191] Culture the callus on a sugar-containing medium plate.

[0192] After culturing the callus in the sugar-containing medium for 20 days, take the callus and use the GUS staining solution (Solarbio Science & Technology Co., Ltd.) for staining and statistically analyze the quantitative data of GUS activity. Specific steps: Take 0.5 g of the sample in a test tube, add 1 ml of GUS staining solution, culture overnight at 37°C, and take a photo to record the staining status of the callus.

[0193] The photo is shown in Figure 7 B of

[0194] The quantitative data of GUS activity is shown in Figure 7 C (Suc represents sucrose, Glu represents glucose, Fru represents fructose, and Sor represents sorbitol).

[0195] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In general, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made by using conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. Application of MdSWEET9b protein in increasing sucrose content of apples; the MdSWEET9b protein is a protein composed of the amino acid sequence shown in Sequence 1 in the Sequence Listing.

2. MdSWEET9b Use of a gene in cultivating a transgenic apple with increased sucrose content; the MdSWEET9b gene is a gene encoding an MdSWEET9b protein; the MdSWEET9b protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the sequence listing.

3. The application according to claim 2, characterized in that: The said MdSWEET9b The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is as shown in the nucleotides at positions 1-801 of Sequence 2 in the Sequence Listing; (3) A DNA molecule shown in Sequence 3 in the Sequence Listing.

4. A method for cultivating transgenic apples, comprising the following steps: introducing MdSWEET9b genes into the starting apples to obtain transgenic apples with a sucrose content higher than that of the starting apples; the MdSWEET9b genes are genes encoding the MdSWEET9b protein; the MdSWEET9b protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the sequence listing.

5. The method according to claim 4, wherein: The said MdSWEET9b The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is as shown in the nucleotides at positions 1-801 of Sequence 2 in the Sequence Listing; (3) A DNA molecule shown in Sequence 3 in the Sequence Listing.

6. A method for culturing transgenic apple tissue, comprising the following steps: introducing MdSWEET9b a gene into starting apple tissue to obtain transgenic apple tissue with a sucrose content higher than that of the starting apple tissue; the MdSWEET9b gene is a gene encoding the MdSWEET9b protein; the MdSWEET9b protein is a protein consisting of the amino acid sequence shown in Sequence 1 in the sequence listing.

7. The method according to claim 6, characterized in that: The said MdSWEET9b The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is as shown in the nucleotides at positions 1-801 of Sequence 2 in the Sequence Listing; (3) A DNA molecule shown in Sequence 3 in the Sequence Listing.

8. A method for cultivating transgenic apples, comprising the following steps: inhibiting the MdSWEET9b gene expression in the starting apples to obtain transgenic apples with a sucrose content lower than that of the starting apples; the MdSWEET9b gene is a gene encoding the MdSWEET9b protein; the MdSWEET9b protein is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing.

9. The method according to claim 8, wherein: The said MdSWEET9b The gene is as follows (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is as shown in the nucleotides at positions 1-801 of Sequence 2 in the Sequence Listing; (3) A DNA molecule shown in Sequence 3 in the Sequence Listing.

10. A method for cultivating transgenic apple tissues, comprising the following steps: inhibiting the MdSWEET9b gene expression in starting apple tissues to obtain transgenic apple tissues with a sucrose content lower than that of the starting apple tissues; the MdSWEET9b gene is a gene encoding the MdSWEET9b protein; the MdSWEET9b protein is a protein composed of the amino acid sequence shown in Sequence 1 in the sequence listing.

11. The method according to claim 10, characterized in that: The said MdSWEET9b The gene is as follows: (1) or (2) or (3): (1) A DNA molecule whose coding region is as shown in Sequence 2 in the Sequence Listing; (2) A DNA molecule whose coding region is as shown in the nucleotides at positions 1-801 of Sequence 2 in the Sequence Listing; (3) A DNA molecule shown in Sequence 3 in the Sequence Listing.