A genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose, its construction and application

Abstract

This invention discloses a genetically engineered bacterium that synthesizes 12-aminolauric acid (12-aminolauric acid) de novo from glucose, its construction method, and its applications, belonging to the field of genetic engineering technology. The genetically engineered bacterium uses an engineered strain that transforms lauric acid to synthesize 12-aminolauric acid as the starting strain, whose genome integrates a thioesterase-encoding gene, or whose host bacterium contains a recombinant expression plasmid containing a thioesterase-encoding gene. This invention successfully constructs a genetically engineered bacterium with a de novo biosynthetic pathway for 12-aminolauric acid, realizing the biosynthesis of 12-aminolauric acid using inexpensive and renewable carbon source glucose as raw material. To further improve the yield of 12-aminolauric acid, lauric acid synthesis is promoted through pathway modular engineering. Multi-level optimization of the flux, redox and metabolic energy homeostasis, and oxidative stress defense network of key steps in the main pathway improves the de novo synthesis efficiency of 12-aminolauric acid in the genetically engineered bacterium.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose, its construction method, and its application. Background Technology

[0002] Nylon 12 (polydodecanolactam, PA12; also known as polylaurolactam) is a long-chain nylon, a semi-crystalline to crystalline thermoplastic material. Nylon 12 has advantages such as low density, high decomposition temperature, excellent low-temperature resistance, and good noise reduction. It is one of the nylon family materials with the lowest density and water absorption, and is widely used in many fields such as automotive fuel lines, air brake hoses, submarine cables, and 3D printing.

[0003] Nylon 12 can be obtained by polymerization of 12-aminolauric acid or dodecyl lactam monomers. Currently, its industrial production mainly utilizes chemical synthesis of ω-dodecyl lactam followed by ring-opening polymerization. Industrial methods are divided into two main categories. The first category uses butadiene as a raw material to synthesize dodecyl lactam, which requires multiple steps such as trimerization, catalytic hydrogenation, oxidation, ketation, oxime formation, and Beckmann rearrangement. This method suffers from problems such as long process flow, high process requirements, difficult product extraction, and low yield. In addition, since butadiene comes from the C4 fraction of petroleum, its supply is greatly affected by fluctuations in the petroleum market. Moreover, the synthesis process requires the use of highly toxic and corrosive raw materials such as benzene and fuming sulfuric acid, which also generates a large amount of waste, putting enormous pressure on the environment. The second category uses cyclohexanone as a raw material to prepare polydodecyl lactam, namely the peroxide method. This method suffers from problems such as high consumption, low yield, and difficult operation (Progress in the Production Technology of Polydodecyl Lactam, Chemical Industry Progress, 2004, 23(9):1015-1018).

[0004] To partially fill the domestic production gap in long-chain nylon, Liu Minying et al. developed a synthesis process for petroleum-fermented nylon 1212. Using dodecanoic acid obtained from the microbial fermentation of petroleum light wax as a raw material, long-chain nylon is synthesized through reactions such as nitrification, amination, neutralization, and polymerization (Synthesis, Properties, and Applications of Petroleum-Fermented Nylon 1212, Proceedings of the 2001 China Engineering Plastics Processing and Mold Technology Symposium). This reaction, in addition to the fermentation process, also requires a chemical synthesis step, and its fermentation feedstock is n-dodecane from petroleum, meaning its supply is also affected by the petroleum market.

[0005] Regarding the biosynthesis of nylon 12 monomers, the Bühler research group at the Technical University of Dortmund, Germany, first expressed the alkane monooxygenase AlkBGT and ω-transaminase CV2025 in Escherichia coli, initially achieving the biosynthesis of methyl 12-aminolaurate (Schrewe et al., 2013). They then further optimized the biosynthetic pathway of methyl 12-aminolaurate by expressing the alcohol dehydrogenase AlkJ, the outer membrane protein AlkL, and the alanine dehydrogenase AlaDH2 from Bacillus subtilis, ultimately achieving whole-cell catalytic synthesis of methyl 12-aminolaurate (Ladkau et al., 2016). The Yun research group at Konkuk University in South Korea split the 12-aminolauric acid biosynthesis pathway into two parts. They expressed the P450 enzyme (CYP153A from Mycobacterium parasiticus), the electron transport inhibitors CamA and CamB, and the alcohol dehydrogenase AlkJ and ω-transaminase ml1207ω-TA in *E. coli*, respectively. Finally, they used these two recombinant cells in a one-pot cellular method to catalyze the synthesis of 12-aminolauric acid from lauric acid (Ahsan et al., 2018). To address the problem of excessive oxidation of the intermediate 12-carbonyllauric acid (methyl ester) to the byproduct dodecanoic acid in the above methods, and the problem of intracellular cofactor imbalance caused by the introduction of artificial pathways, this research group selectively introduced the P450 monooxygenase fusion protein CYP153A-NCP and the alcohol dehydrogenase mutant BsADH. C257L This effectively solved the problem of excessive oxidation of intermediate products; to address the issue of competitive substrate loss, metabolic modifications were made to the chassis cells, and FadD was knocked out to block the β-oxidation pathway; to improve the efficiency of substrate transmembrane transport, the heterologous outer membrane transport protein AlkL was expressed, increasing the cell's uptake of hydrophobic substrates; to address the problem of cofactor imbalance between reaction steps, glucose dehydrogenase GDH1 and NAD were co-expressed. + The L-alanine dehydrogenase AlaDH2, which is dependent on NADPH, enables intracellular self-compensation of the cofactor NADPH, NADH, and cosubstrate L-alanine; by inserting the gene yaaDE, which expresses the pyridoxal phosphate (PLP) synthesis gene required for transaminase, into the genome of genetically engineered bacteria, the intracellular coenzyme PLP self-sufficiency is achieved (Patent document CN 110643555 A).

[0006] Current research on the biosynthesis of nylon 12 monomers focuses on biotransformation using lauric acid (DDA) and its derivatives as raw materials, with no reports on de novo biosynthesis using glucose as a raw material. Summary of the Invention

[0007] The purpose of this invention is to construct a genetically engineered bacterium that can synthesize lauric acid from glucose and subsequently derivatize it into nylon 12 monomer 12-aminolauric acid (ω-AmDDA) through genetic engineering methods, thereby achieving efficient de novo fermentation biosynthesis of nylon 12 monomer from glucose.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] This invention provides a genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose. The genetically engineered bacterium uses an engineered strain that converts lauric acid to synthesize 12-aminolauric acid as the starting strain, and its genome integrates a thioesterase-encoding gene; or the genetically engineered bacterium uses an engineered strain that converts lauric acid to synthesize 12-aminolauric acid as the starting strain, and the host bacterium contains a recombinant expression plasmid containing a thioesterase-encoding gene. The nucleotide sequence of the thioesterase-encoding gene is as shown in SEQ ID NO.1 or has more than 70% homology with the sequence shown in SEQ ID NO.1 and encodes a functionally equivalent protein.

[0010] The engineered strain used to synthesize 12-aminolauric acid from lauric acid is a strain known in the art, possessing the ability to synthesize 12-aminolauric acid from lauric acid. This strain contains a P450 monooxygenase expression module, an alcohol dehydrogenase expression module, and an ω-transaminase expression module. Each expression module includes a promoter and a target gene. The strain uses lauric acid as a substrate to catalyze the synthesis of 12-aminolauric acid. Based on this, the present invention utilizes gene integration technology or the introduction of recombinant expression plasmids to express thioesterase in the aforementioned starting strain. The host cell's central metabolic pathway converts glucose into acetyl-CoA, which is then converted to saturated C12 acyl-ACP via the fatty acid synthesis FAS II pathway. The saturated C12 acyl-ACP then synthesizes lauric acid under the catalysis of thioesterase. Combined with the lauric acid-to-12-aminolauric acid synthesis pathway present in the starting strain, this invention achieves a technical route for the de novo synthesis of 12-aminolauric acid from glucose.

[0011] Preferably, the starting strain is Escherichia coli BL21(DE3): P1-1-CGCAB (accession number CCTCC NO: M2019571), and its construction method is based on patent document CN 110643555 A. This strain contains a vector plasmid containing the chimeric P450 enzyme CYP153A-NCP gene and the glucose dehydrogenase GDH1 gene, and contains the alcohol dehydrogenase mutant BsADH. C257LThe vector plasmid containing the genes, ω-transaminase Cv-2025 and L-alanine dehydrogenase AlaDH2, was used to knock out FadD, a key enzyme in the β-oxidation pathway of Escherichia coli BL21(DE3). The original FadD position was then replaced with an AlkL gene with the LacUV5 promoter and a yaaDE gene with the T7 promoter.

[0012] This invention allows for the acquisition of gene fragments encoding enzymes that are successfully expressed in host cells through gene cloning and codon optimization. The nucleotide sequence of the thioesterase BTE encoding gene, as shown in SEQ ID NO.1, originates from *Umbellularia californica*. Gene fragments encoding thioesterase BTE from other sources can also be used in this invention.

[0013] This invention demonstrates that integrating the thioesterase expression module and the P450 monooxygenase expression module into one module can enhance the expression level of the lauric acid hydroxylation module and increase the content of the target product.

[0014] Furthermore, the alcohol dehydrogenase encoding gene in the genetically engineered bacteria is replaced with an AlkJ encoding gene, the nucleotide sequence of which is as shown in SEQ ID NO.5 or has more than 70% homology with the sequence shown in SEQ ID NO.5 and encodes a functionally equivalent protein. The activity of thioesterase is affected by Zn... 2+ Inhibition of the synthesis and catalysis of the FAD-binding protein AlkJ does not require Zn. 2+ This invention replaces the alcohol dehydrogenase encoding gene with the AlkJ encoding gene as the alcohol dehydrogenase in the de novo synthesis pathway to circumvent Zn. 2+ Inhibition of BTE.

[0015] Furthermore, the antibiotic pressure selection element ampR in the genetically engineered bacteria is replaced with the apramycin resistance gene aprR, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0016] Furthermore, the coding sequence of P450 monooxygenase in the genetically engineered bacteria is replaced with the coding gene of a P450 enzyme mutant, the nucleotide sequence of which is shown in SEQ ID NO.3. P450 enzyme is a key rate-limiting enzyme in the pathway, and improving its activity will contribute to the synthesis of the final product. This invention modifies P450 monooxygenase by site-directed mutagenesis, mutating alanine (A) at position 230 to arginine (R), glutamine (Q) at position 129 to alanine (A), and serine (S) at position 140 to glutamine (Q), and fusing a dimerization enhancement module, the zip leucine zipper sequence, at the N-terminus. Compared to P450 monooxygenase, the mutant exhibits significantly enhanced enzyme catalytic activity.

[0017] Furthermore, the genome of the genetically engineered bacteria also integrates a fatty acid synthesis module FAS M1, an acetyl-CoA activation module ACA M1, or an acetyl-CoA supply module GLY M; or the host bacteria contain a recombinant expression plasmid containing a fatty acid synthesis module FAS M1 and an acetyl-CoA activation module ACA M1 or an acetyl-CoA supply module GLY M.

[0018] The fatty acid synthesis module FAS M1 contains the encoding genes for β-hydroxyacyl-ACP dehydratase FabA, β-ketoacyl-ACP synthase III FabH, β-ketoacyl-ACP reductase FabG, and enoyl-ACP reductase FabI, with nucleotide sequences shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, or sequences that have more than 70% homology with the sequences shown and encode proteins that are functionally equivalent.

[0019] The acetyl-CoA activation module ACA M1 includes the encoding genes for acetyl-CoA activation-related enzymes AccA, AccB, AccC, AccD, and FabD, with nucleotide sequences shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, and SEQ ID NO.16, or sequences that have more than 70% homology with the sequences shown and encode proteins that are functionally equivalent.

[0020] The acetyl-CoA supply module GLY M contains the encoding genes for glyceraldehyde-3-phosphate dehydrogenase A (GapA), phosphoglycerate kinase (Pgk), pyruvate dehydrogenase E1 component (AceE), pyruvate dehydrogenase complex dihydrolipoyl lysine residue acetyltransferase component (AceF), and dihydrolipoic acid dehydrogenase (LpdA), with nucleotide sequences shown in SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21, or sequences that have more than 70% homology with the sequences shown and encode functionally equivalent proteins.

[0021] In the de novo synthesis of 12-aminolauric acid from glucose, lauric acid acts as a metabolic hub, and enhancing its synthesis contributes to the synthesis of the final product. This invention integrates FAS M1, composed of enzyme-encoding genes related to the fatty acid synthesis system, into the host. Furthermore, it integrates either the acetyl-CoA activation module ACA M1 containing malonyl-CoA synthesis-related enzyme-encoding genes or the acetyl-CoA supply module GLY M containing acetyl-CoA synthesis-related enzyme-encoding genes, to provide precursor substances for fatty acid synthesis.

[0022] Furthermore, the genome of the genetically engineered bacteria also integrates the reducing power cofactor regeneration and balance module Cofactor M, or the host bacteria contain a recombinant expression plasmid containing the reducing power cofactor regeneration and balance module Cofactor M. The reducing power cofactor regeneration and balance module Cofactor M includes the encoding genes for glucose nonphosphorylated transporter Glf, gluconate kinase GntK, 6-phosphogluconate dehydratase Edd, 2-keto-3-oxo-6-phosphogluconate aldolase Eda, and transhydrogenases PntA and PntB, with nucleotide sequences shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.27, or sequences that have more than 70% homology with the sequences shown and encode functionally equivalent proteins. Simultaneously, the encoding genes for glucose phosphorylase Glk and ATP-consuming enzyme FecE in the genome are knocked out. The nucleotide sequence of the Glk encoding gene in Escherichia coli DE3 is shown in SEQ ID NO.29, and the nucleotide sequence of the FecE encoding gene is shown in SEQ ID NO.30.

[0023] This invention improves cell productivity and optimizes the supply of reducing power cofactors by knocking out ATP-consuming enzyme FecE and glucose phosphorylase Glk, thereby increasing the yield of the target product.

[0024] Furthermore, the genome of the genetically engineered bacteria also integrates the oxidative stress defense module ROS M, or the host bacteria contain a recombinant expression plasmid of the oxidative stress defense module ROS M, wherein the oxidative stress defense module ROS M includes the gene encoding the oxidative stress regulatory transcription factor OxyR, and the nucleotide sequence is shown in SEQ ID NO.28 or has more than 70% homology with the sequence shown and the encoded protein is functionally equivalent.

[0025] This invention introduces the oxidative stress defense module ROS M into genetically engineered bacteria to improve the host's tolerance to ROS. After optimizing the host's ROS defense network, the yield of the target product is further increased.

[0026] Another objective of this invention is to provide a method for constructing the above-mentioned genetically engineered bacteria, comprising: using an engineered strain that transforms lauric acid to synthesize 12-aminolauric acid as the starting strain, inserting a thioesterase encoding gene into the genome using biological techniques or introducing it using a recombinant expression plasmid.

[0027] Furthermore, the construction method includes: using an engineered strain that transforms lauric acid to synthesize 12-aminolauric acid as the starting strain, knocking out the glucose phosphorylase Glk and ATP-consuming enzyme FecE encoding genes, inserting or using recombinant expression plasmids to freely express the acetyl-CoA supply module GLY M, fatty acid synthesis module FAS M1, reducing power cofactor regeneration and balance module Cofactor M, and oxidative stress defense module ROS M to enhance precursor supply, and introducing a three-point mutation A231R / Q129A / S140Q into the P450 chimeric enzyme responsible for lauric acid hydroxylation in the starting strain, fusing the N-terminal dimerization enhancement module Zip leucine zipper sequence, replacing the alcohol dehydrogenase encoding gene with AlkJ, and replacing the antibiotic pressure selection element ampR with the apramycin resistance gene aprR.

[0028] Specifically, the construction method includes the following steps:

[0029] (1) Construction of recombinant plasmid: The synthesized thioesterase BTE gene fragment was cloned into plasmid pRSFDuet to obtain plasmid R-BTE;

[0030] The antibiotic pressure selection element ampR in plasmid pET-T7-CYP153A-NCP-RBS-GDH1 was replaced with the apramycin resistance gene aprR of aminoglycoside antibiotics to construct plasmid EApr-M1-3.

[0031] The BTE expression cassette in plasmid R-BTE was cloned into EApr-M1-3 to obtain plasmid pAprR-T7-BTE-T7-CYP153A-NCP-RBS-GDH1. Then, CYP153A-NCP in this plasmid was replaced with the mutant CYP153Am4NZ-NCP with the nucleotide sequence shown in SEQ ID NO.3 to obtain recombinant plasmid C.

[0032] The plasmid pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADH was used. C257L BsADH in C257L Replace it with the AlkJ encoding gene to obtain recombinant plasmid D;

[0033] (2) Modification of the genetic background of the starting strain host: Using strain P1-1 as the starting strain, the fatty acid synthesis module FAS M1 was integrated into P1-1 using CRISPR / transposition technology to obtain the modified host P1D1; the fatty acid synthesis enhancement modules FAS M1 and ACA M1 were integrated into P1-1 using CRISPR / transposition technology to obtain the modified host P1D3; the fatty acid synthesis enhancement modules FAS M1 and GLY M were integrated into P1-1 using CRISPR / transposition technology to obtain the modified host P1D5; the ATP-consuming enzyme FecE in the modified host P1D5 was knocked out using CRISPR / transposition technology to obtain the modified host PDA; the glucose phosphorylase Glk in the modified host P1D5 was knocked out using CRISPR / transposition technology and Cofactor M was integrated in, obtaining the modified host PDN; the reducing power homeostasis regulation module Cofactor M was integrated into the host PDA using CRISPR / transposition technology and glucose phosphorylase Glk was knocked out to obtain the modified host PDAN; the ROS was integrated into the host PDA using CRISPR / transposition technology. M is integrated into the modified host PDAN, resulting in the modified host PDANR;

[0034] (3) Construction of recombinant strains: Plasmid R-BTE, plasmid EApr-M1-3, plasmid pAprR-T7-BTE-T7-CYP153A-NCP-RBS-GDH1, any one of the recombinant plasmids C and D are introduced into any one of the following hosts: P1D1, P1D3, P1D5, PDA, PDN, PDAN, and PDANR, to obtain the genetically engineered bacteria.

[0035] The strain P1-1, plasmid pET-T7-CYP153A-NCP-RBS-GDH1, and plasmid pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADH were mentioned. C257L The material is publicly available, and its construction method is referenced in patent document CN 110643555A.

[0036] The present invention also provides the application of the genetically engineered bacteria in the preparation of 12-aminolauric acid, wherein the application uses glucose or glucose-containing raw materials as substrates.

[0037] Furthermore, the application includes: after activation, the genetically engineered bacteria are inoculated into M9 salt medium containing the corresponding antibiotic resistance and supplemented with 10-30 g / L glucose, and cultured at 37°C until OD... 600=0.6–1.5; then add 0.05–0.2 mM isopropyl-β-D-thiogalactoside (IPTG), 1–6 g / L NH4HCO3, 0.2 mM vitamin B1 (VB1), 0.5 mM 5-aminolevulinic acid (δ-ALA), 25 mg / L D-biotin and 1 mL / L metal element stock solution and cool to 25–35 °C for continued culture; after induction, the pH value is monitored every 1–3 h, and when the pH value is lower than 7.0, the pH value is adjusted back to 7.0–8.0 with NH3·H2O. After fermentation for 24–36 h, the supernatant of the fermentation broth is collected by centrifugation to obtain 12-aminolauric acid. The mother liquor containing the metal elements comprises 0.5 mg / L MgCl2, 35 mg / L FeCl2·4H2O, 1 mg / L ZnCl2·4H2O, 0.2 mg / L CoCl2·6H2O, 1 mg / L Na2MoO4·2H2O, 0.5 mg / L CaCl2·2H2O, 1 mg / L CuCl2, and 0.2 mg / L H2BO3.

[0038] This invention uses Escherichia coli as an operating platform and focuses on the discovery, balanced expression, molecular modification, cofactor engineering, and tolerance engineering of key enzymes in the synthetic pathway. It has carried out a series of applied basic studies in metabolic engineering, enzyme engineering, and synthetic biology, and achieved the de novo biosynthesis of 12-aminolauric acid, laying a preliminary foundation for the production of nylon 12 by microbial fermentation.

[0039] The beneficial effects of this invention are as follows:

[0040] (1) This invention provides a genetically engineered bacterium that can realize the de novo synthesis of nylon 12 monomer 12-aminolauric acid from glucose. Starting with a genetically engineered strain that can catalyze the synthesis of 12-aminolauric acid from lauric acid, a saturated C12 acyl-ACP specific thioesterase BTE is introduced to successfully construct a de novo biosynthesis pathway for 12-aminolauric acid, thereby realizing the biosynthesis of 12-aminolauric acid using glucose, a cheap and renewable carbon source, as raw material.

[0041] (2) In order to further improve the yield of 12-aminolauric acid, this invention optimizes the shake-flask fermentation reaction conditions, chassis host, alcohol dehydrogenase, ω-transaminase system and plasmid module resistance screening elements in the de novo synthesis process to better exert the productivity of the de novo synthesis pathway. Through pathway modular engineering, DDA synthesis is promoted and its subsequent derivatization is balanced. The strain P1D5 (EApr-M1-B3 / C-M2-A) obtained by shake-flask fermentation synthesizes 243 mg / L of 12-aminolauric acid. Subsequently, through multi-level optimization of the flux of key steps in the main pathway (core pathway layer), redox and metabolic energy homeostasis (cofactor layer), and oxidative stress defense network (intracellular environment layer), the de novo synthesis efficiency of 12-aminolauric acid in genetically engineered bacteria was improved. Specifically, by knocking out pathways that do not consume metabolic energy, enhancing heterologous pathways for reducing power supply, and regulating reducing power distribution, the intracellular metabolic energy and reducing power supply during the de novo synthesis of 12-aminolauric acid were optimized. The negative impact of ROS on de novo synthesis was mitigated by adjusting the intracellular oxidative stress defense network. The key enzyme CYP153A-NCP was modified using rational and semi-rational design methods to enhance the flux of the key lauric acid hydroxylation step in the de novo synthesis pathway. Finally, the recombinant bacteria PDANRCD (EApr-M1-B3mut / C-M2-A) was able to synthesize 471 mg / L of 12-aminolauric acid de novo from glucose in shake flask culture. Attached Figure Description

[0042] Figure 1 This is a flowchart of one embodiment of the construction method of the present invention.

[0043] Figure 2 A schematic diagram (A) and a liquid phase diagram (B) illustrate the pathway of de novo biosynthesis of 12-aminolauric acid from glucose by recombinant strain P1-1-R1, where DDA represents lauric acid, ω-OHDDA represents 12-hydroxylauric acid, and ω-AmDDA represents 12-aminolauric acid. In diagram (B), black arrows indicate the elution peak of the 12-aminolauric acid standard, red arrows indicate the elution peak of the 24-hour fermentation sample of P1-1-R1, and blue arrows indicate the elution peak of the control without BTE enzyme.

[0044] Figure 3 A comparison diagram showing the synthesis of 12-aminolauric acid from glucose by recombinant strain P1-1-R1, P1-1-R2 with AlkJ alcohol dehydrogenase replaced, and P1-1-R3 with AprR replaced as the resistance selection element, over 24 hours.

[0045] Figure 4A comparative diagram showing the synthesis of 12-aminolauric acid from glucose over 24 hours by recombinant strain P1-1-R3, P1-1-R4 (integrated fatty acid synthesis module FAS M1), P1-1-R5 (integrated FAS M1 and acetyl-CoA activation module ACA M1), and P1-1-R6 (integrated FAS M1 and acetyl-CoA enhancement module GLY M).

[0046] Figure 5 A comparison diagram showing the synthesis of 12-aminolauric acid from recombinant strain P1-1-R6 and optimized lauric acid synthesis from P1-1-R7 after subsequent hydroxylation using glucose over 24 hours.

[0047] Figure 6 A comparison of recombinant strain P1-1-R7, P1-1-R8 with FecE knockout optimized for ATP supply, P1-1-R9 with Cofactor M integrated optimized for reducing power cofactor supply, P1-1-R10 with simultaneous optimized ATP and reducing power cofactor supply, and P1-1-R11 with ROS M integrated to optimize tolerance based on P1-1-R10, showing the synthesis of 12-aminolauric acid from glucose over 18 hours.

[0048] Figure 7 A comparison of the intensity of the hydroxylation step in the optimized pathway of recombinant strain P1-1-R11 and the P450-replaced enzyme mutant CYP153Am4NZ-NCP using glucose to synthesize 12-aminolauric acid over 18 hours, using PDANRCD. Detailed Implementation

[0049] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental methods used in the embodiments are conventional techniques in the art, and the raw materials and reagents are all commercially available products.

[0050] Strain Escherichia coli BL21(DE3): P1-1-CGCAB (CCTCC NO: M2019571), chassis host strain P1-1 of P1-1-CGCAB, recombinant plasmid A: pET-T7-CYP153A-NCP-RBS-GDH1, recombinant plasmid B: pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADH C257L This invention was constructed in the early stages by our research group. The construction method can be found in Chinese Patent Application No. 201910749344.5.

[0051] The construction method of strain P1-1 includes: knocking out the key enzyme FadD in the β-oxidation pathway of host Escherichia coli BL21(DE3) using CRISPR / Cas9 technology to obtain the modified host B-ΔD; knocking in the AlkL gene with the LacUV5 promoter at the original FadD position in the Escherichia coli B-ΔD genome using CRISPR / Cas9 technology to obtain the modified host B1-1; and knocking in the yaaDE gene with the T7 promoter at the original FadD position in the Escherichia coli B1-1 genome using CRISPR / Cas9 technology to obtain the modified host P1-1.

[0052] Example 1: Construction of recombinant plasmids

[0053] 1. The protein sequence of BTE (UniProtKB / Swiss-Prot:Q41635.1) was obtained from NCBI, and its nucleotide sequence is shown in SEQ ID NO.1. The plasmid pRSFDuet-1-T7-BTE-ter(R-BTE) was synthesized by Hangzhou Jierui Company.

[0054] 2. Using the laboratory-preserved aminoglycoside antibiotic Apr antiplasmid pCutamp as a template, the sequence of the antibiotic pressure selection element aprR was obtained by PCR using designed primers (upstream primer: APR-CZ-ET-F: GCTTCAATCATGATTGAAAAAGGAAGAGTATGTCATCAGCGGTGGAGTG; downstream primer: APR-CZ-ET-R: TAAAGTATATATGAGTAAACTTGGTCTGACAGTCAGCCAATCGACTGGCG AG), and its nucleotide sequence is shown in SEQ ID NO.2. The antibiotic pressure selection element ampR in the plasmid module E-M1-3 (pET-T7-CYP153A-NCP-RBS-GDH1) of strain Escherichia coli BL21(DE3):P1-1-CGCAB was replaced with aprR to construct the plasmid EApr-M1-3 (pAprR-T7-CYP153A-NCP-RBS-GDH1).

[0055] 3. Using designed primers (upstream primer: BTE-gg-F: GGCTACGGTCTCCGCCTGCTCTCCCTTATGCGACTCCT; downstream primer: BTE-gg-R: GGCTACGGTCTCCAGGCTtaAACGCGCGGTTCTGCCG), the BTE expression cassette in the R-BTE plasmid was cloned into EApr-M1-3 to obtain plasmid EApr-M1-B3 (pAprR-T7-BTE-T7-CYP153A-NCP-RBS-GDH1).

[0056] 4. Using designed primers (CYP-A231R-F: ATCGCATGGCTGGTCGCGCAAGCGCAAC; CYP-A231R-R: CGGTTGCGCTTGCGCGACCAGCCATGCG; CYP-Q129A-F: TAGCGCAGAGCCGGCGATTATTCTGGGC; CYP-Q129A-R: GTCGCCCAGAATAATCGCCGGCTCTGCG; CYP-S140Q-F: CGCCGGAAGGTCTGCAGGTGGAGATGTT; CYP-S140Q-R: ATGAACATCTCCACCTGCAGACCTTCCG), a three-point mutation (A231R / Q129A / S140Q) was introduced into plasmid EApr-M1-B3. From the Saccharomyces cerevisiae S288C genome, using designed primers (upstream primer: N zip-gg-F: GGCTACGGTCTCGGCATGGATCCGGCAGCACTGAAACG; downstream primer: N zip-gg-R: GGCTACGGTCTCGACTACCACCACCACCGCGTTCACCAACCAGCTTTTTCAG), the N-terminal fusion dimerization enhancement module zip leucine zipper sequence was obtained by PCR. This sequence was then incorporated into the N-terminus of the CYP153A-NCP mutant to obtain CYP153Am4NZ-NCP, whose nucleotide sequence is shown in SEQ ID NO.3. Replacing CYP153A-NCP in EApr-M1-B3 yielded plasmid C: EApr-M1-B3mut(pAprR-T7-CYP153Am4NZ-NCP-RBS-GDH1). Furthermore, the nucleotide sequence of GDH1 contained in EApr-M1-B3mut is shown in SEQ ID NO.4.

[0057] 5. The AlkJ (GenBank: CAB54054.1) sequence was obtained from NCBI, and its nucleotide sequence is shown in SEQ ID NO.5. The plasmid pET30a-AlkJ was synthesized by Hangzhou Jierui Company. Using pET30a-AlkJ as a template, the AlkJ sequence was obtained by PCR using designed primers (upstream primer: AlkJ-EcoRI-F: CTTAAGAATTCTAATACGACTCACTATAGGGGAAT; downstream primer: AlkJ-XhoI-R: ATCGCTCGAGTTACATGCAGACAGCTATCATGGCC). This sequence was then ligated into the plasmid module C-M2-2 (pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADH) contained in the strain Escherichiacoli BL21(DE3): P1-1-CGCAB. C257L Replace BsADH C257L The recombinant plasmid D was subsequently constructed: C-M2-A(pCD-T7-Cv2025-RBS-AlaDH2-T7-AlkJ). Furthermore, the nucleotide sequences of Cv2025 and AlaDH2 contained in C-M2-A are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0058] Example 2: Metabolic modification of host Escherichia coli BL21(DE3)

[0059] 1. To promote the conversion of glucose into fatty acids, fatty acid synthesis system-related enzymes FabA, FabH, FabG, and FabI from E. coli were used to construct a fatty acid synthesis enhancement module FAS M1 (T7-FabA-T7-FabH-T7-FabG-T7-FabI). FAS M1 was integrated into P1-1 using CRISPR / transposon technology to obtain the modified host P1D1. The nucleotide sequences of the fatty acid synthesis system-related enzymes FabA, FabH, FabG, and FabI are shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively.

[0060] 2. Acetyl-CoA activation-related enzymes AccA, AccB, AccC, AccD, and FabD from *E. coli* were used to construct the acetyl-CoA activation module ACA M1 (T7-AccA-ter-T7-AccB-ter-T7-AccC-ter-T7-AccD-ter-T7-FabD-ter); fatty acid synthesis enhancement modules FAS M1 and ACA M1 were integrated into P1-1 using CRISPR / transposon technology to obtain the modified host P1D3; the nucleotide sequences of the acetyl-CoA activation-related enzymes AccA, AccB, AccC, AccD, and FabD are shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, and SEQ ID NO.16, respectively.

[0061] 3. GapA, Pgk, AceE, and AceF from *E. coli*, which are related to acetyl-CoA supply, and LpdA from *E. faecalis* were used to construct the acetyl-CoA enhancement module GLY M (T7-GapA-ter-T7-Pgk-ter-T7-AceE-ter-T7-AceF-ter-T7-LpdA-ter). The fatty acid synthesis enhancement modules FAS M1 and GLY M were integrated into P1-1 using CRISPR / transposon technology to obtain the modified host P1D5. The nucleotide sequences expressing GapA, Pgk, AceE, AceF, and LpdA are shown in SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21, respectively.

[0062] 4. To optimize the metabolic energy homeostasis of the cell factory, the ATP-consuming enzyme FecE in the modified host P1D5 was knocked out using CRISPR / transposon technology to obtain the modified host PDA. The nucleotide sequence of FecE is shown in SEQ ID NO.30.

[0063] 5. Further, to optimize the reducing power homeostasis of the cell factory, a reducing power homeostasis regulatory module Cofactor M (Tac-Glf-rrnB T1-T7-GntK-ter-T7-Edd-ter-T7-Eda-ter-T7-PntAB-ter) was constructed using the sugar transporter Glf from Z. mobilis, endogenous gluconic acid from E. coli, related enzymes GntK, Edd, and Edd, and the transhydrogenase PntAB from E. coli. Using CRISPR / transposon technology, the glucose phosphorylase Glk in the modified host P1D5 was knocked out and integrated into Cofactor M, obtaining the modified host PDN. The nucleotide sequences of Glf, GntK, Edd, PntA, and PntB are shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.27, respectively. The nucleotide sequence of Glk is shown in SEQ ID NO.29.

[0064] 6. Using CRISPR / transposon technology, the reducing power homeostasis regulation module Cofactor M was integrated into the host PDA, while glucose phosphorylase Glk was knocked out to obtain the modified host PDAN.

[0065] 7. To optimize the tolerance of the cell factory, the oxidative stress regulatory transcription factor OxyR from E. coli was constructed into an oxidative stress defense module ROS M (T7-OxyR); ROS M was integrated into the modified host PDAN using CRISPR / transposon technology to obtain the modified host PDANR; the nucleotide sequence of the transcription factor OxyR is shown in SEQ ID NO.28.

[0066] Example 3: Construction of recombinant strains

[0067] 1. Import plasmid R-BTE (pRSFDuet-1-T7-BTE-ter) into plasmid modules E-M1-3 (pET-T7-CYP153A-NCP-RBS-GDH1) and C-M2-2 (pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADH) using standard methods. C257L The recombinant strain P1-1-R1:P1-1(R-BTE / E-M1-3 / C-M2-2) was obtained from the Escherichia coli BL21(DE3):P1-1-CGCAB, and was preserved as a glycerol strain or a freeze-dried strain.

[0068] 2. Plasmids R-BTE, E-M1-3, and C-M2-A were introduced into the chassis host strain P1-1 of P1-1-CGCAB using conventional methods to obtain the recombinant strain P1-1-R2:P1-1(R-BTE / E-M1-3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0069] 3. Plasmids R-BTE, EApr-M1-3, and C-M2-A were introduced into strain P1-1 using conventional methods to obtain the recombinant strain P1-1-R3:P1-1(R-BTE / EApr-M1-3 / C-M2-A), which was then preserved as glycerol culture or freeze-dried culture.

[0070] 4. Plasmids R-BTE, EApr-M1-3, and C-M2-A were introduced into the modified host strain P1D1 containing the fatty acid synthesis enhancement module FASM1 using conventional methods to obtain the recombinant strain P1-1-R4:P1D1(R-BTE / EApr-M1-3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0071] 5. Plasmids R-BTE, EApr-M1-3, and C-M2-A were introduced into the modified host strain P1D3 containing the fatty acid synthesis enhancement module FASM1 and the acetyl-CoA activation module ACA M1 using conventional methods to obtain the recombinant strain P1-1-R5:P1D3(R-BTE / EApr-M1-3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0072] 6. Plasmids R-BTE, EApr-M1-3, and C-M2-A were introduced into the modified host strain P1D5 containing the fatty acid synthesis enhancement module FASM1 and the acetyl-CoA enhancement module GLY M using conventional methods to obtain the recombinant strain P1-1-R6:P1D5(R-BTE / EApr-M1-3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0073] 7. Plasmids EApr-M1-B3 and C-M2-A were introduced into strain P1D5 using conventional methods to obtain recombinant strain P1-1-R7:P1D5(EApr-M1-B3 / C-M2-A), which was then preserved as glycerol culture or freeze-dried culture.

[0074] 8. Plasmids EApr-M1-B3 and C-M2-A were introduced into a PDA strain containing FAS M1 and GLY M with FecE knocked out using conventional methods to obtain the recombinant strain P1-1-R8:PDA (EApr-M1-B3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0075] 9. Plasmids EApr-M1-B3 and C-M2-A were introduced into a modified host PDN strain containing FAS M1 and GLY M and integrated with Cofactor M using conventional methods to obtain the recombinant strain P1-1-R9:PDN(EApr-M1-B3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0076] 10. Plasmids EApr-M1-B3 and C-M2-A were introduced into the modified host PDAN strain containing FAS M1, GLY M and Cofactor M and with FecE knocked out using conventional methods to obtain the recombinant strain P1-1-R10:PDAN(EApr-M1-B3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0077] 11. Plasmids EApr-M1-B3 and C-M2-A were introduced into the modified host PDANR strain containing FAS M1, GLY M, Cofactor M and ROS M and with FecE knocked out using conventional methods to obtain the recombinant strain P1-1-R11:PDANR(EApr-M1-B3 / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0078] 12. Plasmids EApr-M1-B3mut and C-M2-A were introduced into the modified host PDANR strain containing FAS M1, GLY M, Cofactor M and ROS M and with FecE knocked out using conventional methods to obtain the recombinant strain PDANRCD:PDANR(EApr-M1-B3mut / C-M2-A), which was then preserved as a glycerol strain or a lyophilized strain.

[0079] Example 4

[0080] The genetically engineered bacteria of 12 examples were used to produce 12-aminolauric acid from glucose, and yield verification experiments were conducted:

[0081] 1. Pick a single colony and inoculate it into a 5 mL LB tube containing the corresponding antibiotic resistance, then incubate at 37°C for 12 h; inoculate the seed culture at a volume ratio of 1-3% into a shake flask containing the corresponding antibiotic resistance and 20 g / L glucose infused in M9 salt medium, and incubate at 37°C until OD reaches 100%. 600=0.6; then add 0.1mM IPTG, 2g / L NH4HCO3, 0.2mM VB1, 0.5mM δ-ALA, 25mg / L D-biotin and trace metal element additives (0.5mg / L MgCl2, 35mg / L FeCl2·4H2O, 80mg / L ZnCl2·4H2O, 0.2mg / L CoCl2·6H2O, 1mg / L Na2MoO4·2H2O, 0.5mg / L CaCl2·2H2O, 1mg / L CuCl2 and 0.2mg / L H2BO3), cool to 25-30℃ and continue culturing; after induction, check the pH value every 1-2 hours, and when the pH value is lower than 7.0, use NH3·H2O to adjust the pH value to 7.0-8.0. After 24 hours of fermentation, centrifuge and collect the supernatant of the fermentation broth to obtain 12-aminolauric acid.

[0082] 2. The content of 12-aminolauric acid was detected by reversed-phase high-performance liquid chromatography (RP-HPLC). HPLC analysis was performed using an Agilent 1100 Infinity system with a Luna C8(2) reversed-phase column (250 mm × 4.6 mm × 5 μm). The HPLC conditions were: mobile phase A: 0.1% TFA in water, mobile phase B: 0.1% TFA in methanol. Gradient elution was used under the following conditions: initial: 70% A; 3 min: 70% A; 20 min: 15% A; 28 min: 2% A; flow rate: 0.8 mL / min; column temperature: 40 ± 1℃; injection volume: 25 μL. Detection was performed using an ELSD detector (detection temperature: 65℃, N2 flow rate: 1.5 mL / min).

[0083] 3. Results Analysis

[0084] (a) The recombinant strain P1-1-R1 produces 12-aminolauric acid from glucose; experiments showed that P1-1-R1 can successfully achieve the fermentation synthesis of 12-aminolauric acid from glucose. Figure 2 ), and the fermentation yield reached 28 mg / L in 24 hours.

[0085] (b) Recombinant strain P1-1-R2 produces 12-aminolauric acid from glucose; BsADH C257L Both the synthesis and catalysis of Zn require high concentrations of Zn. 2+ This is related to BTE being Zn 2+ This contradicts the inhibitory property (1 mM inhibits 100%). Neither the synthesis nor the catalysis of the FAD-binding protein AlkJ requires Zn. 2+ Therefore, we tried replacing BsADH with AlkJ. C257L As an alcohol dehydrogenase in the de novo synthesis pathway to circumvent Zn 2+Inhibition of BTE. Replacing C-M2-2 with the AlkJ-containing module C-M2-A yielded the recombinant strain P1-1-R2. During the culture process, the concentration of ZnCl2·4H2O was reduced from 80 mg / L to 1 mg / L, while other conditions remained the same as above. Results are as follows... Figure 3 After AlkJ replacement, the yield increased from 28 mg / L to 61 mg / L.

[0086] (c) The recombinant strain P1-1-R3 utilizes glucose to produce 12-aminolauric acid. In the three plasmid modules of the de novo synthesis pathway, the antibiotic pressure selection elements of R-BTE and C-M2-A are the aminoglycoside antibiotics kanamycin (Kan) and streptomycin (Sm) resistance genes kanR and smR, respectively, while the E-M1-3 module contains the β-lactam antibiotic ampicillin (Amp) resistance gene ampR. Unlike the intracellular function of aminoglycoside-resistant enzymes such as KanR and SmR, AmpR is secreted extracellularly to hydrolyze Amp, thus achieving tolerance. Therefore, during growth, Amp gradually becomes ineffective, causing E-M1-3 to lose its maintenance pressure and resulting in genetic heterogeneity of the bacterial community. Therefore, ampR was replaced with the aprR, an aminoglycoside antibiotic resistance gene, to construct a new EApr-M1-3 module, which was then used to replace E-M1-3 to obtain the recombinant strain P1-1-R3. The bacterial culture process is shown in (b). like Figure 3 After replacing the resistance element, the yield reached 81 mg / L.

[0087] (d) The recombinant strain P1-1-R4 utilizes glucose to produce 12-aminolauric acid; enhancing precursor supply is a common strategy for improving the productivity of metabolic pathways. In de novo synthesis, lauric acid serves as a metabolic hub, and enhancing its synthesis may contribute to the synthesis of the final product. Therefore, FAS M1, composed of enzymes related to the FAS II system for endogenous fatty acid synthesis in *E. coli*, was integrated into the host via a CRISPR / transposase system to obtain the recombinant strain P1-1-R4. The culture process is described in (b). Figure 4 The enhanced endogenous fatty acid synthesis system increased the yield to 130 mg / L.

[0088] (e) The recombinant strain P1-1-R5 utilizes glucose to produce 12-aminolauric acid; malonyl-CoA is an important precursor for fatty acid synthesis, and low intracellular concentrations of malonyl-CoA are considered a significant factor limiting the synthesis of fatty acids and their derivatives. The acetyl-CoA activation module ACA M1, containing enzymes related to malonyl-CoA synthesis, was integrated into the host P1-1-R4 via a CRISPR / transposase system to obtain the recombinant strain P1-1-R5. The culture process is described in (b). Figure 4By further integrating ACA M1 on top of integrating FAS M1, the yield was further increased to 148 mg / L.

[0089] (f) The recombinant strain P1-1-R6 utilizes glucose to produce 12-aminolauric acid (12-aminolauric acid). Acetyl-CoA is a key intracellular metabolic hub and a source of fatty acid synthesis; therefore, enhancing its supply may contribute to lauric acid synthesis and further enhance 12-aminolauric acid synthesis. The acetyl-CoA enhancement module GLY M, containing enzymes related to acetyl-CoA synthesis, was integrated into the host P1-1-R4 via a CRISPR / transposase system to obtain the recombinant strain P1-1-R6. The culture process is described in (b). Figure 4 By further integrating GLY M on top of integrating FAS M1, the yield was further increased to 165 mg / L.

[0090] (g) Recombinant strain P1-1-R7 produces 12-aminolauric acid from glucose; lauric acid accumulation was detected in the fermentation supernatant of recombinant strain P1-1-R6, therefore, it is necessary to rebalance lauric acid synthesis and accumulation. The expression modules on E-M1-3 and R-BTE were integrated into one module, and the P450 enzyme and GDH1 enzyme modules on E-M1-3 were placed in a T7-BTE expression cassette to further enhance the expression level of the lauric acid hydroxylation module, thus obtaining a new module plasmid EApr-M1-B3. Plasmid EApr-M1-B3 and C-M2-A were introduced into P1D5 to obtain recombinant strain P1-1-R7. The culture process is shown in (b). Figure 5 The yield of lauric acid after balancing the synthesis and subsequent hydroxylation reached 243 mg / L in 24 hours.

[0091] (h) The recombinant strain P1-1-R8 utilizes glucose to produce 12-aminolauric acid; ATP is an energy cofactor in cells, and regulating ATP supply can improve cell growth and increase the productivity of energy-consuming metabolic pathways. To improve the ATP supply in the cell factory, the gene encoding the non-essential ATP-consuming enzyme FecE in P1-1-R7 was knocked out using a CRISPR / transposase system. The culture process is described in (b). Figure 6 The elimination of the non-essential ATP-consuming enzyme FecE improved cell productivity, increasing yield by approximately 27%. When the yield of control P1-1-R7 was 196 mg / L at 18 h, the yield of P1-1-R8 could reach 249 mg / L.

[0092] (i) Recombinant strain P1-1-R9 utilizes glucose to produce 12-aminolauric acid. The de novo synthesis pathway requires the consumption of both NADH and NADPH, two reducing power cofactors; therefore, improving reducing power synthesis and its distribution between the two may enhance pathway productivity. The transport protein Glf enhances the transmembrane transport of non-phosphorylated glucose, the substrate of the reducing power regenerating enzyme GDH1, while GntK, Edd, and Eda can revert the GDH1 metabolite gluconic acid back into the metabolic pathway. The transhydrogenase PntAB can transfer reducing power from the abundant intracellular NADH to the relatively scarce NADPH. The reducing power cofactor regulatory module Cofactor M, composed of Glf, GntK, Edd, Eda, and PntAB, was integrated into P1-1-R7 via a CRISPR / transposase system to obtain recombinant strain P1-1-R9. The culture process is described in (b). Figure 6 After optimizing the supply of reducing agent, the yield reached 289 mg / L.

[0093] (j) The recombinant strain P1-1-R10 utilizes glucose to produce 12-aminolauric acid; combining ATP supply optimization strategies with reducing power supply optimization strategies may further improve cell factory productivity. Cofactor M was integrated into the FecE-knockout recombinant strain P1-1-R8 via a CRISPR / transposase system to obtain the recombinant strain P1-1-R10. The culture process is shown in (b). Figure 6 Meanwhile, the cell factory yield reached 324 mg / L by optimizing the supply of ATP and reducing cofactors.

[0094] (k) The recombinant strain P1-1-R11 utilizes glucose to produce 12-aminolauric acid; aerobic fermentation inevitably leads to the production of ROS by Escherichia coli, including H2O2 and ·O2. - And hydroxyl radicals (·OH). Excessive ROS can damage important cellular components such as cell membranes, proteins, and nucleic acids, leading to ROS stress in cells and ultimately reducing the productivity of cell factories. To improve the host's tolerance to ROS, the key transcriptional regulator OxyR in the ROS defense system was constructed into a ROS M module and integrated into P1-1-R10 via a CRISPR / transposase system to obtain the recombinant strain P1-1-R11. The culture process is shown in (b). Figure 6 After optimizing the host ROS defense network, the yield can be further increased by about 15% in 18 hours, reaching 371 mg / L.

[0095] (l) The recombinant strain PDANRCD utilizes glucose to produce 12-aminolauric acid; the P450 enzyme is a key rate-limiting enzyme in the pathway, and improving its activity will contribute to the synthesis of the final product. Studies have shown that introducing A231R into CYP153A-NCP can enhance substrate anchoring and improve activity. Further introduction of Q129A / S140Q can further improve substrate anchoring and thus enzyme activity by reducing the flexibility of the key heme domain structure BC-Loop. Fusing a leucine zipper structure (Zip) at the N-terminus of the enzyme can help CYP153A-NCP form a catalytically active oligomer, thereby improving catalytic activity. Finally, the original CYP153A-NCP was replaced with a mutant CYP153Am4NZ-NCP containing the mutant A231R / Q129A / S140Q and an N-terminal Zip structure to obtain the recombinant strain PDANRD. The culture process is shown in (b). Figure 7 After optimizing the supply of cofactors and ROS tolerance, further increasing the hydroxylation intensity resulted in a yield increase of approximately 54%, with a PDANRCD yield of 471 mg / L after 18 hours.

[0096] The results of the above 12 recombinant strains demonstrate that the genetically engineered bacteria obtained using the construction strategy of this invention can effectively utilize inexpensive carbon source glucose to synthesize 12-aminolauric acid de novo. In particular, the recombinant strain PDANRCD is the optimal genetically engineered strain, yielding 471 mg / L of 12-aminolauric acid after 18 hours of fermentation.

[0097] This invention provides a chassis-based metabolic engineering approach based on modular design of artificial pathways. It achieves efficient synthesis of glucose to 12-aminolauric acid through the design and matching of metabolic pathway modules. By optimizing ATP supply and the supply of reducing cofactors NADH / NADPH through cofactor engineering strategies, it optimizes intracellular metabolic energy and redox homeostasis in the cell factory, thereby increasing the productivity of products requiring metabolic energy and reducing power for synthesis. Furthermore, it enhances cell tolerance by regulating the intracellular ROS defense network to increase the yield of toxic hydrophobic products. Finally, it further improves pathway productivity by enhancing substrate anchoring and active oligomerization, thereby increasing the activity of the rate-limiting key P450 enzyme.

[0098] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by equivalent substitution or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose, characterized in that, The genetically engineered bacteria used was strain CCTCC NO: M2019571. Escherichia coli BL21(DE3): P1-1-CGCAB is the starting strain, whose genome integrates a thioesterase encoding gene; or a recombinant expression plasmid containing a thioesterase encoding gene is introduced into the starting strain, the nucleotide sequence of which is shown in SEQ ID NO.1; the starting strain is an *Escherichia coli* with a P450 monooxygenase expression module, an alcohol dehydrogenase expression module, and an ω-transaminase expression module, wherein the P450 monooxygenase encoding gene in the genetically engineered strain is replaced with a P450 enzyme mutant encoding gene, the nucleotide sequence of which is shown in SEQ ID NO.3; the alcohol dehydrogenase encoding gene in the genetically engineered strain is replaced with an AlkJ encoding gene, the nucleotide sequence of which is shown in SEQ ID NO.5; the genetically engineered strain synthesizes 12-aminolauric acid de novo from glucose.

2. The genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose as described in claim 1, characterized in that, Antibiotic pressure screening element in the genetically engineered bacteria ampR Replace with apramycin resistance gene aprR, The aprR The nucleotide sequence is shown in SEQ ID NO.

2.

3. The genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose as described in claim 1 or 2, characterized in that, The genome of the genetically engineered bacteria also integrates a fatty acid synthesis module FAS M1, an acetyl-CoA activation module ACA M1, or an acetyl-CoA supply module GLY M; or a recombinant expression plasmid containing a fatty acid synthesis module FAS M1 and an acetyl-CoA activation module ACA M1 or an acetyl-CoA supply module GLY M is introduced into the starting strain. The fatty acid synthesis module FAS M1 is composed of the gene encoding β-hydroxyacyl-ACP dehydratase FabA, the gene encoding β-ketoacyl-ACP synthase III FabH, the gene encoding β-ketoacyl-ACP reductase FabG, and the gene encoding enoyl-ACP reductase FabI. The nucleotide sequences corresponding to the above genes are shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively. The acetyl-CoA activation module ACA M1 is composed of the coding genes of acetyl-CoA activation-related enzymes AccA, AccB, AccC, AccD and FabD, and the nucleotide sequences corresponding to the above genes are shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16, respectively. The acetyl-CoA supply module GLY M is composed of the gene encoding glyceraldehyde-3-phosphate dehydrogenase A GapA, the gene encoding phosphoglycerate kinase Pgk, the gene encoding pyruvate dehydrogenase E1 component AceE, the gene encoding the acetyltransferase component AceF of the dihydrolipoic acid residue of the pyruvate dehydrogenase complex, and the gene encoding dihydrolipoic acid dehydrogenase LpdA. The nucleotide sequences corresponding to the above genes are shown in SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, and SEQ ID NO.21, respectively.

4. The genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose as described in claim 3, characterized in that, The genome of the genetically engineered bacteria also integrates the reducing power cofactor regeneration and balance module Cofactor M, or a recombinant expression plasmid containing the reducing power cofactor regeneration and balance module Cofactor M is introduced into the starting strain. The reducing power cofactor regeneration and balance module Cofactor M is composed of the genes encoding glucose nonphosphorylated transporter Glf, gluconate kinase GntK, 6-phosphogluconate dehydratase Edd, 2-keto-3-oxo-6-phosphogluconate aldolase Eda, and transhydrogenases PntA and PntB. The nucleotide sequences corresponding to the above genes are shown in SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, and SEQ ID NO.27, respectively. At the same time, the genes encoding glucose phosphorylase Glk and ATP-consuming enzyme FecE in the genome are knocked out.

5. The genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose as described in claim 4, characterized in that, The genome of the genetically engineered bacteria also integrates the oxidative stress defense module ROS M, or a recombinant expression plasmid of the oxidative stress defense module ROS M is introduced into the starting strain. The oxidative stress defense module ROS M is the gene encoding the oxidative stress regulatory transcription factor OxyR, and its nucleotide sequence is shown in SEQ ID NO.

28.

6. The method for constructing a genetically engineered bacterium that de novo synthesizes 12-aminolauric acid from glucose as described in any one of claims 1-5, characterized in that, include: strain with accession number CCTCC NO: M2019571 Escherichia coli BL21(DE3): P1-1-CGCAB is the starting bacterium. The thioesterase encoding gene is inserted into the genome using biological techniques or introduced using a recombinant expression plasmid. The P450 monooxygenase encoding gene is replaced with the P450 enzyme mutant encoding gene, and the alcohol dehydrogenase encoding gene is replaced with the AlkJ encoding gene.

7. The method for constructing a genetically engineered bacterium that synthesizes 12-aminolauric acid de novo from glucose as described in claim 6, characterized in that, Includes the following steps: (1) Construction of recombinant plasmid: The synthesized thioesterase BTE gene fragment was cloned into plasmid pRSFDuet to obtain plasmid R-BTE; Antibiotic pressure selection element in plasmid pET-T7-CYP153A-NCP-RBS-GDH1 ampR Replace with apramycin resistance gene aprR Construct plasmid EApr-M1-3; The BTE expression cassette in plasmid R-BTE was cloned into EApr-M1-3 to obtain plasmid pAprR-T7-BTE-T7-CYP153A-NCP-RBS-GDH1. Then, CYP153A-NCP in this plasmid was replaced with the mutant CYP153Am4NZ-NCP with the nucleotide sequence shown in SEQ ID NO.3 to obtain recombinant plasmid C. The plasmid pCD-T7-Cv2025-RBS-AlaDH2-T7-BsADH was used. C257L BsADH in C257L Replace it with the AlkJ encoding gene to obtain recombinant plasmid D; (2) Modification of the genetic background of the starting strain host: Using strain P1-1 as the starting strain, the fatty acid synthesis module FAS M1 was integrated into P1-1 using CRISPR / transposition technology to obtain the modified host P1D1; the fatty acid synthesis enhancement module FAS M1 and the acetyl-CoA activation module ACA M1 were integrated into P1-1 using CRISPR / transposition technology to obtain the modified host P1D3; the fatty acid synthesis enhancement module FAS M1 and the acetyl-CoA supply module GLY M were integrated into P1-1 using CRISPR / transposition technology to obtain the modified host P1D5; the ATP-consuming enzyme FecE in the modified host P1D5 was knocked out using CRISPR / transposition technology to obtain the modified host PDA; the glucose phosphorylase Glk in the modified host P1D5 was knocked out using CRISPR / transposition technology and Cofactor M was integrated in, obtaining the modified host PDN; the reducing power homeostasis regulation module Cofactor was integrated into the modified host P1D5 using CRISPR / transposition technology. M is integrated into the host PDA, and glucose phosphorylation enzyme Glk is knocked out to obtain the modified host PDAN; ROS M is integrated into the modified host PDAN using CRISPR / transposon technology to obtain the modified host PDANR. (3) Constructing recombinant strains: Recombinant plasmid C and recombinant plasmid D are introduced into any of the following hosts: P1D1, P1D3, P1D5, PDA, PDN, PDAN, and PDANR, to obtain the genetically engineered strain.

8. The application of the genetically engineered bacteria according to any one of claims 1-5 in the preparation of 12-aminolauric acid, characterized in that, Glucose or glucose-containing raw materials are used as substrates.

Images