EjFADC1 Gene of Loquat, Protein Encoded thereby, and Applications

By cloning and overexpressing the loquat EjFADC1 gene, transgenic plants are constructed, which enhances the cold tolerance of the plants, solves the problem of loquat trees being susceptible to frost loss, and achieves a significant improvement in the antifreeze ability.

CN116064436BActive Publication Date: 2025-08-01SOUTHWEST UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202310130379.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-17
Publication Date
2025-08-01
Estimated Expiration
2043-02-17

AI Technical Summary

Technical Problem

Loquat trees are susceptible to frost loss, and the prior art lacks effective methods for enhancing cold resistance.

Method used

By cloning the loquat EjFADC1 gene and constructing an overexpression vector, it was transferred to the plant genome by Agrobacterium mediating method to overexpress the EjFADC1 protein to enhance the cold tolerance of the plant.

Benefits of technology

It significantly improves the cold tolerance of plants, reduces damage under low temperature stress, and enhances the frost resistance of plants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004084540050000011
    Figure HDA0004084540050000011
  • Figure HDA0004084540050000012
    Figure HDA0004084540050000012
  • Figure HDA0004084540050000021
    Figure HDA0004084540050000021
Patent Text Reader

Abstract

The present invention belongs to the field of plant molecular biology, and particularly relates to a loquat membrane lipid desaturase gene EjFADC1 and its application. The full-length coding region sequence of the cDNA of the EjFADC1 gene is shown in SEQ ID No.1, and the amino acid sequence of the protein encoded by it is shown in SEQ ID No.2. This gene is induced to express by low temperature and is closely related to the cold tolerance of loquat. The overexpression vector of the EjFADC1 gene was transferred into wild-type Arabidopsis thaliana by the agrobacterium-mediated floral dip method. The results show that overexpression of the EjFADC1 gene in wild-type Arabidopsis thaliana can enhance the cold tolerance of Arabidopsis thaliana. This gene can be used for the breeding of cold-tolerant loquat varieties and has good application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of plant molecular biology, and particularly relates to a loquat EjFADC1 protein, its coding gene and application. Background Art

[0002] Loquat (Eriobotrya japonica) is a subtropical evergreen fruit tree of the genus Eriobotrya in the Rosaceae family; its fruits are not only rich in nutrition but also have health care functions, so it has good economic value. Loquat blossoms and bears fruit in autumn and winter and is vulnerable to frost, which often causes serious economic losses in the main producing areas of loquat, and even crop failures in some areas. Therefore, breeding cold-tolerant varieties has important value for promoting the industrial development.

[0003] Low temperature often causes huge economic losses in agriculture. The fatty acid desaturase gene (FAD) increases the fluidity of the membrane by increasing the content of unsaturated fatty acids, thereby enhancing the cold tolerance of plants. The EjFADC1 gene is induced to express by low temperature. Phylogenetic tree analysis shows that EjFADC1 and the FAD8 gene of Arabidopsis thaliana belong to the same large phylogenetic branch, indicating that they have similar functions. FAD8 is located on the chloroplast and belongs to the ω-3 type, catalyzing the introduction of the third double bond at the ω-3 position of the diene fatty acid on glycerol ester to form a triene fatty acid. FAD8 is mainly induced by low temperature and is regulated by low temperature at both transcriptional and post-translational levels. Overexpression of AtFAD8 in tobacco and rapeseed can improve their cold tolerance; overexpression of OsFAD8 in rice can improve the cold tolerance of rice. There is no report on the functional research and application of the loquat EjFADC1 gene. Summary of the Invention

[0004] The object of the present invention is to provide a loquat EjFADC1 protein, its coding gene and application.

[0005] First, the present invention provides a loquat EjFADC1 protein, which is:

[0006] 1) A protein composed of the amino acids shown in SEQ ID No.2; or

[0007] 2) A protein derived from 1) with one or several amino acids substituted, deleted or added in the amino acid sequence shown in SEQ ID No.2 and having the same activity.

[0008] The present invention also provides a gene encoding the above-mentioned loquat EjFADC1 protein.

[0009] Among them, the gene sequence is as shown in SEQ ID No.1.

[0010] The present invention also provides a vector, a host cell and an engineered bacterium containing the above gene. Preferably, the vector is an overexpression vector.

[0011] The present invention also provides the use of the said gene in plant cold-resistant breeding.

[0012] In one embodiment of the present invention, the EjFADC1 gene is transferred into the plant genome and overexpressed in the transgenic plant to enhance the cold resistance of the plant.

[0013] The present invention also provides a method for constructing a transgenic plant. By using the Agrobacterium-mediated method, an overexpression vector containing the EjFADC1 gene is transferred into the plant genome, and transgenic plants are obtained by screening.

[0014] Among them, compared with the wild type, the said transgenic plant significantly enhances its cold resistance.

[0015] The present invention cloned a EjFADC1 gene closely related to cold resistance from loquat leaves. It was confirmed by real-time fluorescence quantitative PCR that low temperature induced the high expression of the EjFADC1 gene, and its expression level was higher in loquat materials with strong cold resistance than in those with weak cold resistance. An overexpression vector of the EjFADC1 gene was constructed by means of genetic engineering and transferred into wild-type Arabidopsis thaliana for overexpression, which can significantly enhance the cold resistance of Arabidopsis thaliana. The present invention provides a good application prospect for cold-resistant breeding of angiosperms. Description of the Drawings

[0016] Figure 1 It is an electrophoresis photograph for verifying the coding region sequence of the loquat EjFADC1 gene. M is the DL2000 DNA marker, and 1 is the PCR product of the ORF of the EjFADC1 gene.

[0017] Figure 2 It is the cDNA nucleotide sequence diagram of the coding region of the loquat EjFADC1 gene.

[0018] Figure 3 It is the amino acid sequence and domain division diagram of the loquat EjFADC1 protein.

[0019] Figure 4 It shows the expression of the loquat EjFADC1 gene induced by low temperature in loquat leaves.

[0020] Figure 5 It is the PCR identification of the EjFADC1 transgenic Arabidopsis thaliana plants.

[0021] Figure 6 It is the morphological phenotype of the plants overexpressing EjFADC1 in Arabidopsis thaliana. The wilting and water loss state of the wild-type Arabidopsis thaliana treated at low temperature is more serious than that of the transgenic plants, and most of the leaf edges begin to show impregnated curling state, and the edges of the old leaves turn yellow, while only a small number of young leaves of the transgenic plants are frostbitten at the edges, and the edges of some old leaves turn yellow.

[0022] Figure 7 are the electrolyte leakage and MDA content of the leaves of Arabidopsis thaliana overexpressing EjFADC1. Specific implementation manners

[0023] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the examples are all carried out under conventional experimental conditions, such as in the Molecular Cloning Experiment Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001), or according to the conditions recommended by the manufacturer's instructions.

[0024] Example 1 Cloning of the cDNA sequence of the loquat EjFADC1 gene

[0025] Extraction of total RNA from loquat leaves

[0026] Collect the loquat leaves treated at low temperature, quickly put them into cryotubes, freeze them in liquid nitrogen for 2 h, and then put them into a -80 °C ultra-low temperature refrigerator for use. Use an RNA extraction kit to extract the total RNA from the loquat leaves according to the instructions, and use a micro nucleic acid concentration detector to detect the RNA concentration and quality.

[0027] Reverse transcription of total RNA from loquat leaves into cDNA

[0028] Take the total RNA of loquat leaves for denaturation treatment. The reaction system is as follows: ensure that the amount of total RNA is 2000 ng, among which Oligo DT15 is 1 μL (50 nmol / L), N6 is 0.5 μL (50 nmol / L), add RNase free water, and the total volume is 14.5 μL. The reaction program is 70 °C for 10 min, 4 °C for 2 min, and quickly take it out from the PCR instrument after the reaction ends.

[0029] Reverse transcription of total RNA from loquat leaves: Add 4 μL of 5×M-MLV buffer, 1 μL of 10 mM dNTP, 0.25 μL of RNase Inhibitor, and 0.25 μL of M-MLV to the denatured reaction solution. The reaction program is 42 °C for 60 min, 70 °C for 10 min. After the reaction ends, dilute it with 30 μL of ddH2O and store it at -20 °C for standby.

[0030] Cloning of the EjFADC1 gene

[0031] The complete cDNA sequence of EjFADC1 was found by sequence alignment of transcriptome data and loquat genome, and the cloning primers of the gene were designed using Oligo 7: FLEjFADC1-F: 5'-ATGGCGAGTTGGGTCCTCTCTGAAT-3', FLEjFADC1-R: 5'-TTAATTTGATGGAGGAAAGCCACC-3'. Gene amplification was performed using the Phanta Max Super-Fidelity DNA Polymerase (P505-d1 / d2 / d3) kit. The EjFADC1 gene amplification system consisted of 25 μL of 2× Phanta Max Buffer, 1.0 μL of 10 mM dNTP Mix, 2.0 μL of 10 μM F, 2.0 μL of 10 μM R, 1.0 μL of Phanta Max Super-Fidelity DNA Polymerase, and 1.0 μL of cDNA. The total volume was adjusted to 50 μL with ddH2O. The amplification program was 95°C for 4 min, followed by 35 cycles of 95°C for 30 sec, 56°C for 30 sec, and 72°C for 40 sec. The final cycle was followed by 72°C for 10 min. After PCR amplification, the DNA was analyzed by electrophoresis and recovered using an agarose gel recovery kit. The DNA was then concentrated and stored at −20°C. The recovered target fragment was ligated with the pTOPO-Blunt Vector and transformed into competent E. coli cells. Single clones were picked and sequenced. The sequencing results were analyzed and spliced to obtain the full-length cDNA sequence of the loquat EjFADC1 gene (SEQ ID No. 1). The sequence is shown in the figure. Figure 2 .

[0032] Using BioEdit software, we translated the protein sequence (SEQ ID No. 2) from the full-length cDNA sequence of the loquat EjFADC1 gene and divided the transmembrane domains according to the protein characteristics. We found that the EjFADC1 protein has four transmembrane domains ( Figure 3 ).

[0033] Example 2 Analysis of loquat EjFADC1 gene expression

[0034] The tetraploid loquat B431 (2n=4x=68) and the triploid loquat B431×GZ23 (2n=3x=51) with different cold resistance were selected; the cold resistance of B431×GZ23 (LT 50 =-9.419)>B431(LT 50= -7.195). Select branches of B431 and B431×GZ23 with the same thickness and use common loquat as the rootstock. Subject the uniformly grafted seedlings to -3°C stress for 72 h, with 4 biological replicates for each treatment. Take the leaves at the same leaf position, extract RNA, and reverse transcribe it into cDNA as a template.

[0035] According to the full-length cDNA sequence of the loquat EjFADC1 gene, use oligo 7.0 software to design real-time fluorescence quantitative primers qEjFADC1F: 5'-TTTGGAACCGACCCAGAACC-3' and qEjFADC1R: 5'-CTACACAACCCACCTGCGAT-3'. Detect its specificity by PCR. Only when the specific amplification of PCR is ensured can real-time fluorescence quantitative PCR be carried out. Use the loquat actin gene as the internal reference gene, and the primers are qEjactin-F: 5'-AATGGAACTGGAATGGTCAAGGC-3' and qEjactin-R: 5'-TGCCAGATCTTCTCCATGTCATCCCA-3'. Amplify using the three-step method, with 3 biological replicates for each reaction. The PCR reaction program is: pre-denaturation at 95°C for 1 min; 20 s at 95°C, 20 s at 58°C, 30 s at 72°C, for 45 cycles; collect the melting curve. According to the obtained Ct values, use the 2-ΔΔCT method to calculate the expression levels of the EjFADC1 gene in triploid and tetraploid loquats under low-temperature stress ( Figure 4 ). The results show that the expression level of the EjFADC1 gene is higher in the cold-tolerant triploid loquat than in the cold-sensitive tetraploid loquat.

[0036] Example 3 Construction of the plant transgenic vector pFGC5941-EjFADC1 of the loquat EjFADC1 gene

[0037] Using PCR amplification, restriction enzyme sites were introduced at both ends of the CDS region of the loquat EjFADC1 gene. Using the cDNA reverse transcribed from the total RNA of loquat leaves as a template, with EjFADC1-F: 5′-GGCGCGCCATGGCGAGTTGGGTCCTCTCTGAAT-3′ (AscI restriction enzyme site introduced) and EjFADC1-R: 5′-CGGGATCCTTAATTTGATGGAGGAAAGCCACC-3′ (BamHI restriction enzyme site introduced) as primers, Phanta Max Super-Fidelity DNA Polymerase was used for PCR amplification. The PCR products were subjected to 1% agarose gel electrophoresis and recovered using an agarose gel DNA recovery kit. The recovered PCR products were ligated to the pTOPO-Blunt vector, transferred into Escherichia coli competent cells. After picking monoclonal colonies, samples were sent for sequencing. According to the vector sequence, primers were designed at the junction of the vector and the target fragment for sequencing, and plasmids were extracted. At the same time, the plasmid of the transgenic vector pFGC5941 was extracted. The pTOPO-Blunt-EjFADC1 recombinant plasmid and the pFGC5941 vector were double digested with AscI and BamHI restriction enzymes respectively. After ligating the double-digested EjFADC1 gene to pFGC5941 using T4-DNA ligase, it was transferred into Escherichia coli competent cells to obtain the plant transgenic expression vector pFGC5941-EjFADC1. The obtained expression vector was sent for sequencing. According to the vector sequence, primers were designed at the junction of the vector and the target fragment for sequencing. The two-way sequencing was completed, and the sequencing results contained both the vector sequence and the sequence of the EjFADC1 gene, proving that the EjFADC1 gene was successfully ligated to the pFGC5941 vector.

[0038] Example 4: The transgenic expression vector pFGC5941-EjFADC1 was transferred into wild-type Arabidopsis thaliana

[0039] Take 2 μg of the plasmid pFGC5941-EjFADC1, add 100 μL of Agrobacterium competent cells, pipette and mix evenly; incubate on ice for 30 min, transfer to liquid nitrogen and freeze rapidly for 1 min, incubate in a 37 °C water bath for 5 min, incubate on ice for 10 min, add 800 μL of LB liquid medium, and shake at 28 °C and 250 rpm for 5 h; transfer the bacterial solution to an LB (50 mL LB + 50 μg / mL Kan + 50 μg / mL Rif) solid selection medium, spread evenly, and incubate inverted at 28 °C for 48 h; select monoclonal colonies and inoculate them into 10 mL of liquid LB medium (containing 10 μg / mL Kan + 10 μg / mL Rif); shake and culture overnight at 28 °C and 200 rpm until OD = 0.8. Take 2 mL of the bacterial solution and transfer it to 100 mL of LB liquid medium (50 μg / mL Kan and 50 μg / mL Rif) and culture until OD600 = 0.7 - 0.8. Transfer the bacterial solution to 2 sterilized 50 mL centrifuge tubes, centrifuge at room temperature at 5000 rpm for 5 min, pour off the supernatant, add 2 mL of infection buffer (0.5% Silwet L-77, 5% sucrose, 1 / 2 MS medium) to each tube and gently suspend the cells, then add 48 mL of infection buffer (100 mL of infection buffer: 5 g of sucrose, 50 μL of Silwet L-77, 1 / 2 MS medium).

[0040] Place Arabidopsis thaliana seeds on moist filter paper and place them at 4 °C. After 48 h of treatment, sow them in nutrient soil and culture them at a temperature of 22 °C, a humidity of 75%, and a condition of 14 h of darkness / 10 h of light; one day before transgenic transformation, thoroughly water the Arabidopsis thaliana plants; before infection, cut off the existing siliques on the Arabidopsis thaliana plants, immerse the inflorescences in the pFGC5941-EjFADC1 Agrobacterium infection solution for about 60 s for infection transformation; cover with a black sealing film and maintain a high-temperature and high-humidity environment inside the film. After 2 d of dark culture, uncover the film and return to the normal environment to continue growing. Infect 3 - 4 times using the above method, with an interval of  7 d.

[0041] Example 5 Screening and Phenotypic Identification of Transgenic Arabidopsis thaliana with Loquat EjFADC1 Gene

[0042] Collect mature seeds of EjFADC1 transgenic Arabidopsis thaliana, dry them in an oven at 37 °C, and vernalize them at 4 °C. Sow the vernalized seeds on peat soil. When the seedlings grow to about ten days old, spray glufosinate-ammonium at 20 mg / L (the vector pFGC5941 is resistant to glufosinate-ammonium), spray once every three days, and spray a total of 3 - 4 times. Collect the seeds of the surviving plants.

[0043] Extract the DNA of EjFADC1 transgenic Arabidopsis thaliana. Take a small piece of Arabidopsis thaliana leaf and place it in a 1.5 mL eppendorf tube, quickly freeze it in liquid nitrogen and grind it; add 600 μL of extraction buffer, vortex it, and then place it on ice; after all samples are processed, place it in a 65 °C water bath for 25 min; take the sample out of the water bath and let it cool to room temperature. After cooling to room temperature, add 340 μL of potassium acetate solution, vortex it, and ice-bath for 20 min; centrifuge at 12,000 rpm for 10 min at high speed, and transfer the supernatant to a new eppendorf tube; add an equal volume of isopropanol, centrifuge at 4 °C and 12,000 rpm for 20 min, discard the supernatant, and rinse with ice-cold absolute ethanol (put absolute ethanol in a -20 °C refrigerator 2 h in advance); rinse the precipitate with 70% and 100% ethanol in turn; after the precipitate is dried, dissolve it in 50 μL of sterile water.

[0044] Using the DNA of wild-type Arabidopsis thaliana as a control, design identification primers (35s-F: TGAGACTTTTCAACAAAGGATAATT, 35s-R: TGTCCTCTCCAAATGAAATGAAC) according to the 35S promoter on the pFGC5941 vector to perform PCR identification on the surviving seedlings, and at the same time perform PCR identification with the cloning primers of the target gene to screen and identify the DNA of positive transgenic Arabidopsis thaliana plants. PCR amplification program: 95 °C for 4 min; 95 °C for 30 s, 56 °C for 30 s, 72 °C for 40 s, for 25 cycles; 72 °C for 10 min. After the reaction is completed, perform 1% agarose gel electrophoresis and detect it in a gel imaging system ( Figure 5 ), and the results show that a total of 21 Arabidopsis thaliana plants are obtained, among which 15 are positive plants.

[0045] Plant wild-type (Wt) and T3-generation homozygous transgenic plants in peat soil for cultivation. Plant 3 plants in each pot, and each pot is a biological replicate. There are a total of 3 biological replicates. The cultivation temperature is about 23 ± 0.5 °C, the humidity is about 60%, and the photosynthetic photon flux density (PPFD) of the light is 50 ± 5 μmol·m -2 ·s -1, with a photoperiod of 14 / 10 (day / night), cultured for 6 weeks until rosette leaves were formed. The wild-type and transgenic plants that had grown for about 6 weeks were placed in a low-temperature treatment chamber, and the temperature was decreased at a rate of 1 °C / h until the temperature reached 0 °C. The light for cultivation was weak light, and they were maintained at low temperature for 96 h. After the treatment, the relative electrolyte conductivity and MDA content of the leaves at 0 h and 96 h were measured. The results showed that the wilting and water loss state of the wild-type Arabidopsis thaliana under low-temperature treatment was more serious than that of the transgenic plants. Most of the leaf margins showed an impregnated and curled state, and the margins of the old leaves turned yellow. Only a few young leaves of the transgenic plants were frostbitten at the margins, and occasionally the margins of the old leaves turned yellow; after recovering growth at 23 °C for 6 d, the margins of most leaves of the wild-type plants turned yellow, and a small number of plants produced reproductive branches. A small number of old leaves of the transgenic plants had yellow margins, and all the plants produced a large number of reproductive branches, and the growth rate of their reproductive branches was faster than that of the wild-type ( Figure 6 ). Electrolyte leakage and MDA are important evaluation indicators of plant stress physiology, which reflect the degree of cell damage and membrane lipid peroxidation; the test results showed that heterologous overexpression of EjFADC1 significantly reduced the electrolyte leakage and MDA content of Arabidopsis thaliana leaves and improved the cold tolerance of Arabidopsis thaliana ( Figure 7 ).

[0046] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. Loquat EjFADC1 protein, which is a protein composed of the amino acids shown in SEQ ID No.

2.

2. A gene encoding the loquat EjFADC1 protein according to claim 1.

3. The gene according to claim 2, wherein The sequence is as shown in SEQ ID No.

1.

4. A vector containing the gene according to claim 2 or 3.

5. An engineered bacterium containing the gene according to claim 2 or 3.

6. Use of the gene according to claim 2 or 3 in plant cold-resistant breeding, characterized in that, The plant is Arabidopsis thaliana or loquat.

7. The use according to claim 6, characterized in that Transfer the gene according to claim 2 or 3 into the plant genome and overexpress it in the transgenic plant to enhance the cold tolerance of the plant.

8. A method for constructing a transgenic plant, characterized in that, By the Agrobacterium-mediated method, transfer the overexpression vector containing the gene according to claim 2 or 3 into the plant genome, and screen to obtain transgenic plants, and the plant is Arabidopsis thaliana or loquat.

9. The construction method according to claim 8, characterized in that, Compared with the wild type, the cold tolerance of the transgenic plant is significantly enhanced.

Citation Information

Patent Citations

  • Chorispora bungeana endoplasmic reticulum type omega-3 fatty acid desaturation enzyme gene and application thereof

    CN103740739A

  • Gene participating in peach fruit fatty acid forming and application thereof

    CN105400805A

  • Ammopiptanthus mongolicus chloroplast omega-3 fatty acid desaturase (AmFAD7) coding gene and application thereof

    CN108410829A