A ω-transaminase mutant and its application
By directed evolution of ω-transaminase, a high-activity and good tolerance ω-transaminase mutant was constructed, which solved the problem of low synthesis efficiency of sitagliptin intermediates in the prior art, and achieved efficient and low-cost biocatalytic preparation.
Patent Information
- Application Number
- CN202211623314.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-16
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2042-12-16
AI Technical Summary
The ω-transaminase catalyst used in the prior art for synthesizing the sitagliptin intermediate has problems such as low catalytic activity, poor tolerance to organic solvents, and insufficient thermal stability, resulting in low synthesis efficiency and high cost.
Using the omega-transaminase mutant, a genetically engineered bacteria was constructed by single mutation or multi-point joint mutation at positions 275, 115 and 97 of the Aspergillus fungus Aspergillus lentulus transaminase, and a recombination was performed using the E. coli expression vector to prepare a sitagliptin intermediate.
A highly efficient biocatalytic reaction with sitagliptin prosterone as the substrate was achieved, with a total yield of 66.7%, and a stereoselective e.e. value reached 99%, which significantly improved the catalytic efficiency and product purity.
Smart Images

Figure CN116064457B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an ω-aminotransferase mutant, an encoding gene, a vector containing the encoding gene, a genetically engineered bacterium, and use of the mutant in preparing a sitagliptin intermediate by microbial catalysis. Background Art
[0002] Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor. DPP-4 is a multifunctional enzyme present as a homodimer on the cell membrane. It cleaves multiple peptide hormones, including glucagon-like peptide-1 and gastric inhibitory peptide, both of which are closely linked to type 2 diabetes. DPP-4 controls blood glucose levels by protecting and enhancing the effects of endogenous incretins. Glucose-dependent insulinotropic peptide (GIP) and glucagon-like peptide-1 (GLP-1) are incretins released in response to dietary intake.
[0003] GLP-1 and GIP can increase insulin synthesis and release from pancreatic β cells through intracellular signaling pathways. GLP-1 can also reduce glucagon secretion from pancreatic α cells, thereby reducing hepatic glucose production. However, both GLP-1 and GIP are rapidly metabolized by DPP-4, resulting in a loss of their insulinotropic effects.
[0004] This drug inhibits the degradation of the incretin hormone DPP-4, thereby enhancing the functions of GLP-1 and GIP, increasing insulin release and lowering circulating glucagon levels (this effect is glucose-dependent). This drug selectively inhibits DPP-4 and has no inhibitory activity against DPP-8 or DPP-9. Furthermore, DPP-4 inhibitors can inhibit the degradation of other peptides involved in blood glucose regulation, such as GIP, pituitary adenylate cyclase-activating polypeptide, and gastrin-releasing peptide. Sitagliptin increases insulin secretion in a glucose-dependent manner, has a moderate glucose-lowering effect, does not cause hypoglycemia, and has no side effects such as weight gain, nausea, or vomiting. Sitagliptin, marketed as Januvia, was developed by Merck and Codexis in the United States and is the first dipeptidyl peptidase-IV (DPP-IV) inhibitor to receive FDA approval for the treatment of type 2 diabetes (October 2016). It has been approved for use in more than 70 countries around the world. According to reports, its total global sales reached US$3 billion in 2021, making it one of the top 20 drugs in international sales.
[0005] Sitagliptin and its intermediates can be synthesized using either a purely chemical method or a combination of chemical and enzymatic methods. The key to the chemoenzymatic method is obtaining an ω-aminotransferase capable of catalyzing the asymmetric transamination reaction to produce optically pure sitagliptin intermediates.
[0006] International patent WO201009950 discloses an engineered aminotransferase developed by Codexis (wild type derived from Arthrobacter sp. ), has good tolerance to the solvent DMSO, but poor tolerance to alcohol solvents; when DMSO is used in enzyme-catalyzed reactions, it is difficult to remove it from the reaction system due to its high boiling point, resulting in a large loss of reaction products during the purification process, leading to higher costs.
[0007] U.S. Patent No. 6,699,871 discloses a chemical synthesis method for sitagliptin intermediates. This method uses a chiral source to induce the production of chiral alpha-amino acids, which are then diazotized to produce beta-amino acids to construct the desired chiral center. This route requires relatively high raw material costs, is complex to react, and is difficult to control both process and product quality during industrialization.
[0008] International Patent WO2005003135 (Merck) discloses a method for synthesizing chiral amines using S-phenylglycinamide to induce catalytic hydrogenation. This route requires two catalytic hydrogenations. The first hydrogenation uses an expensive platinum catalyst, and the second deprotection requires a large amount of PD(OH)2-C catalyst, which is also costly. The resulting ee value is 96%, requiring further recrystallization.
[0009] International Patent W02004087650 discloses a synthetic route for sitagliptin intermediates developed by Merck. This route utilizes a chiral ruthenium catalyst for asymmetric hydrogenation of ketones to form chiral alcohols, which are then converted into chiral amines. This synthesis method requires ruthenium-catalyzed asymmetric hydrogenation, a costly catalyst, resulting in an overall yield of only 52%. High-pressure hydrogen is also required, resulting in low stereoselectivity.
[0010] International Patent W02007050485 discloses Merck's method for synthesizing a sitagliptin intermediate, which uses a chiral germanium catalyst to asymmetric hydrogenate an enamine to synthesize a chiral amine with a yield of 84% and an ee value of 94%. However, this method requires expensive germanium chiral catalysts, which are difficult to remove and recycle.
[0011] U.S. Patent No. 8293507 discloses that Coexis modified the transaminase (ATA117) from Arthrobacter to obtain a biocatalyst that replaced the germanium catalyst in the above process, and the ee value of the product obtained by transamination reached 99%.
[0012] The following patents disclose process routes for the production of synthetic sitagliptin intermediates.
[0013] Chinese patent CN107384887 discloses that He Renbao et al. screened a Burkholderia gladiolus strain ( Burkholderiagladioli) and engineered it. Although the engineered transaminase disclosed in CN107384887 can directly use sitagliptin precursor ketone as a substrate, its activity is not high enough, requiring 50g / L of wet cells to achieve a high conversion rate. Furthermore, DMSO is still used as the solvent in the reaction system. The high concentration of wet cells makes the reaction system extremely complex, which is very unfavorable for post-reaction processing and product extraction. Furthermore, the removal of DMSO also limits the isolation yield of the product.
[0014] Chinese patent CN102838511 discloses a production method for a sitagliptin intermediate developed by Zhejiang Haixiang Pharmaceuticals. The method uses a Grignard reagent to perform nucleophilic substitution on chiral epichlorohydrin, which is then hydrolyzed with cyanide to synthesize beta-hydroxy acid. This method has an overall yield of only 40% and uses highly toxic cyanide, which limits its application.
[0015] Chinese patent CN103014081 discloses that Suzhou Hanzyme Company used transaminase to transaminate 3-carbonyl-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester to (R)-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester. However, the specific transaminase sequence and cloning method were not disclosed.
[0016] In Chinese patent CN105018440, Nanjing Boyu Kangyuan Biopharmaceutical Technology Co., Ltd. Mycobacterium vanbaalenii ) PYR-1-derived transaminase was modified to obtain an engineered transaminase, which was used to synthesize a relatively simple sitagliptin intermediate: R-3-amino-4-(2,4,5-trifluorophenyl)-butyric acid methyl ester. Although the engineered transaminase disclosed in CN105018440 has good tolerance to alcohol solvents such as ethanol (the solvent used is 50% ethanol, which is conducive to product purification), its catalytic activity is not high, and 10g / L of enzyme protein needs to be added. In addition, the product of the transamination reaction needs to be Boc-protected before it can be further converted into Boc-protected sitagliptin. After deprotection, sitagliptin is obtained. The overall yield is not high, resulting in high cost.
[0017] In recent years, chemoenzymatic methods have gradually become the preferred method for synthesizing chiral pharmaceutical chemicals and their intermediates due to their high selectivity and environmental optimization. ω-aminotransferase is a key enzyme in the production of sitagliptin. Many ω-aminotransferase genes have been cloned, and some have been expressed in various hosts (such as Escherichia coli and Pichia pastoris), resulting in engineered strains with high enzyme activity and selectivity. Despite this, reports of natural ω-aminotransferases with R-selective transamination are rare. These ω-aminotransferases catalyze a narrow substrate spectrum, often serving as optimal biocatalysts selected for specific reactions, significantly limiting their application. With the development of directed evolution technology, protein engineering is increasingly being used to modify enzyme substrate specificity. This allows for the screening of novel transaminases with broad substrate spectra and the study of their ability to efficiently and selectively catalyze chiral drugs and their intermediates. This not only broadens their application range and enhances their potential, but also lays the foundation for industrial production. Summary of the Invention
[0018] The purpose of the present invention is to overcome the shortcomings of the engineered transaminases used in the prior art for synthesizing sitagliptin or its chiral amino intermediates, and to provide an engineered transaminase that directly uses sitagliptin precursor ketone as a substrate, has better activity, better tolerance to organic solvents, and better thermal stability - an ω-transaminase mutant, an encoding gene, a vector containing the encoding gene, a genetically engineered bacterium, and its use in the microbial catalytic preparation of sitagliptin intermediates.
[0019] The technical solution adopted in the present invention is:
[0020] A ω-transaminase mutant is obtained by single mutation or multi-point combined mutation at positions 275, 115 and 97 of the amino acid sequence shown in SEQ ID NO.2.
[0021] The protein composed of the amino acid sequence shown in SEQ ID No. 2 can be obtained from Aspergillus fungus Rand ( Aspergillus lentulus ), can be isolated from a recombinant protein expressing the protein, or can be synthesized artificially. The identity between two amino acid sequences or two nucleotide sequences can be determined using algorithms commonly used in the art, preferably using NCBI Blastp and Blastn software according to default parameters.
[0022] The mutant is one of the following or a combination of two or more thereof: (1) glycine at position 275 is mutated into alanine; (2) lysine at position 115 is mutated into methionine; (3) lysine at position 97 is mutated into arginine.
[0023] Preferably, the amino acid sequence of the mutant is shown as SEQ ID No. 4 (mutant G275A), 6 (mutant K115M) or 8 (mutant K97R / K115M).
[0024] Proteins whose amino acid sequences are substituted, deleted or added with one or more amino acid residues and whose derived amino acid sequences have at least 95% identity and have transaminase activity fall within the scope of protection of the present invention.
[0025] The present invention also relates to a gene encoding the ω-aminotransferase mutant.
[0026] Specifically, the nucleotide sequence of the encoding gene is shown in SEQ ID NO.3 (encoding the mutant shown in SEQ ID No.4) or SEQ ID NO.5 (encoding the mutant shown in SEQ ID No.6) or SEQ ID NO.7 (encoding the mutant shown in SEQ ID No.8).
[0027] Due to the degeneracy of nucleotide codons, the polynucleotide sequences encoding the amino acid sequences of SEQ ID Nos. 4, 6, and 8 are not limited to SEQ ID Nos. 3, 5, and 7. The nucleic acid sequence encoding the engineered transaminase of the present invention may also be any other nucleic acid sequence encoding the amino acid sequences shown in SEQ ID Nos. 4, 6, and 8 in the sequence listing.
[0028] The present invention also relates to a recombinant vector and a genetically engineered bacterium containing a gene encoding the ω-transaminase mutant.
[0029] The present invention also relates to the use of the ω-transaminase mutant in the microbial catalytic preparation of sitagliptin intermediates. Specifically, a recombinant vector containing the transaminase gene is constructed, the recombinant vector is transformed into Escherichia coli, the resulting recombinant genetically engineered bacteria are subjected to induction culture, the culture fluid is separated to obtain bacterial cells containing the recombinant transaminase, and the crushed crude transaminase enzyme liquid and the purified pure transaminase enzyme are used to prepare the sitagliptin intermediate. The catalyst includes other forms such as pure enzymes of transaminase and its mutants, wet cells of the corresponding recombinant genetically engineered bacteria, crude enzyme liquid, crude enzyme powder, pure enzyme liquid, and pure enzyme powder.
[0030] Specifically, the application is as follows: 1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone (I) is used as a reaction substrate, wet bacteria containing the ω-transaminase mutant is used as a biocatalyst, dimethyl sulfoxide (DMSO) is used as a cosolvent, pyridoxal phosphate (PLP) is used as a coenzyme, isopropylamine is used as a cosubstrate, and a pH 8-9 triethanolamine buffer is used as a reaction medium to form a reaction system, and a biocatalytic reaction is carried out at a temperature of 30-45°C and a stirring speed of 100-800 r / min. After the reaction is completed, the reaction liquid is separated and purified to obtain (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone (II).
[0031] (I) (II)
[0032] In the reaction system, the wet cell dosage is 10-50 g / L (preferably 50 g / L), the final substrate concentration is 50-200 g / L, the final dimethyl sulfoxide volume concentration is 10-20% (v / v), pyridoxal phosphate is 0.5-2 g / L, and isopropylamine is 5-20 g / L.
[0033] The wet bacteria can be prepared as follows: recombinant Escherichia coli containing the gene encoding the ω-aminotransferase mutant is inoculated into LB liquid medium containing 50 μg / ml kanamycin, and cultured at 37°C and 200 rpm for 12 h. Then, the wet bacteria are inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance at a volume concentration of 1%, and cultured at 37°C and 150 rpm until the bacteria OD reaches 0. 600 When the p-value reaches 0.6-0.8, IPTG with a final concentration of 0.1 mM is added, and the mixture is induced and cultured at 28°C for 12 h. The mixture is centrifuged at 4°C and 5000 rpm for 20 min, the supernatant is discarded, and the precipitate is collected to obtain the wet bacteria.
[0034] The beneficial effects of the present invention are mainly reflected in: in order to solve the problems of the reported asymmetric synthesis of sitagliptin and its intermediates with low total yield (generally less than 50%), low stereoselectivity (product ee value is generally less than 90%), expensive metal catalysts, and the inability of biocatalysts to directly use sitagliptin precursor ketone as a substrate, the present invention provides a novel asymmetric synthesis of sitagliptin and its intermediates derived from an Aspergillus fungus, Aspergillus lentulus) was used as a transaminase mutant (biocatalyst) to prepare a high-optical-purity sitagliptin intermediate by biocatalytic reaction, separation and purification using a sitagliptin intermediate precursor ketone (e.g., 1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone) as a substrate, isopropylamine as an amino donor, pyridoxal phosphate as a coenzyme, and dimethyl sulfoxide as a cosolvent. The total yield of this method reached 66.7% (including conversion yield and separation and purification yield), and the product ee value reached 99% (high stereoselectivity), which has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 This is the result of HPLC test of the reaction liquid;
[0036] Figure 2 This is the reaction formula for the biocatalytic synthesis of sitagliptin intermediates;
[0037] Figure 3 This is the result of protein electrophoresis detection in Example 4. DETAILED DESCRIPTION
[0038] The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments:
[0039] Example 1: Amplification of aminotransferase gene MS3
[0040] According to the Genbank collection of Aspergillus fungus Rand ( Aspergillus lentulus ) was used as the basis for the transaminase gene sequence information. ® SPIN Kit is used to extract Aspergillus fungi ( Aspergillus lentulus PCR amplification was performed using total genomic DNA from a single strain of WT strain (100 μL) as a template using Primer 1 (ATGGGTATCGACACCGGTACCTC) and Primer 2 (GTACTGGATAGCTTCGATCAGCG). The PCR reaction system (50 μL total volume) included 25 μL of 10× Pfu DNA Polymerase Buffer, 1 μL of a 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL each of cloning Primer 1 and Primer 2 at 50 μM concentrations, 1 μL of genomic DNA, 1 μL of Pfu DNA Polymerase, and 20 μL of ddH2O.
[0041] A BioRad PCR instrument was used for PCR reaction conditions: initial denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 65°C for 30 seconds, and extension at 72°C for 1 minute for 30 cycles, with a final extension at 72°C for 5 minutes. The results showed that the nucleotide sequence amplified by primers 1 and 2 was 936 bp (MS3 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO. 2), encoding a complete open reading frame.
[0042] Example 2: Construction of recombinant Escherichia coli BL21 / pET28b-MS3
[0043] Primer 3 (ATACCGCCGGCGGTGGTGCACATAAAGA) and primer 4 (GCACCACCGCCGGCGGTATTATGCCTATA) were designed based on the MS3 gene sequence in Example 1. Primers 3 and 4 were used for PCR amplification under the action of high-fidelity polymerase Phanta Max Super-FIDelity DNA Polymerase.
[0044] PCR reaction system (total reaction system is 50 μL): 25 μL of 1× Phanta max Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of Phanta Max Super-FIDelity DNA Polymerase, 1 μL each of cloning primer 3 and primer 4 (both at a concentration of 50 μM), 1 μL of genomic DNA, and 20 μL of nuclease-free water.
[0045] A BioRad PCR instrument was used, and the PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 4 min, for a total of 30 cycles, and a final extension at 72°C for 5 min.
[0046] PCR reactions were checked by 0.9% agarose gel electrophoresis. 1 μL of DpnI and 5 μL of CutSmart® Buffer were added to PCR reaction mixtures 1 and 2, respectively, and digested for 2 hours. The target gene was ligated into the plasmid vector via a one-step cloning reaction to generate the recombinant expression vector pET28b-MS3. The one-step cloning reaction system consisted of 2 μL of Exnase™ II, 4 μL of 5× CE II Buffer, 1 μL of PCR reaction solution, 2 μL of PCR reaction solution, and 12 μL of nuclease-free water.
[0047] Take 10 μL of the above-mentioned recombinant expression vector pET28b-MS3 and transform it into Escherichia coli BL21 (DE3) (Invitrogen) (42°C, 90 s), spread it on an LB plate containing 50 μg / ml kanamycin resistance, and culture it at 37°C overnight. Randomly pick clones to extract plasmids for sequencing and identification, and screen to obtain recombinant Escherichia coli BL21 (DE3) / pET28b-MS3 containing the recombinant plasmid pET28b-MS3.
[0048] Example 3: Inducible expression of transaminase ω-MS3
[0049] The recombinant Escherichia coli BL21 (DE3) / pET28b-MS3 obtained in Example 2 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, and cultured at 37 ° C, 200 rpm for 12 h. Then, 1% (v / v) inoculum was inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance, and cultured at 37 ° C, 150 rpm until the bacterial OD 600 When the pH reaches 0.6-0.8, add IPTG to a final concentration of 0.1 mM and induce the culture at 28°C for 12 hours. Centrifuge at 5000 rpm for 25 minutes at 4°C, discard the supernatant, and collect the precipitate to obtain recombinant E. coli BL21 / pET28b-MS3 wet cells containing the recombinant plasmid. This cell can be used directly as a biocatalyst or for protein purification.
[0050] Example 4: Isolation and purification of transaminase ω-MS3
[0051] The wet cells obtained in Example 3 were resuspended in binding buffer (50 mM, pH 8.0 sodium phosphate buffer), ultrasonically disrupted (under ice bath conditions, 240W for 10 min, working for 1 s and pausing for 2 s), and centrifuged at 12,000 rpm for 10 min. The supernatant was incubated with Ni affinity chromatography resin equilibrated with the above binding buffer, and then washed with washing buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 20 mM imidazole) until there was almost no impurity protein. The target protein was then eluted with elution buffer (50 mM, pH 8.0 sodium phosphate buffer, containing 300 mM NaCl, 500 mM imidazole) and collected. After electrophoresis to identify the purity, the target proteins were combined and dialyzed with dialysis buffer (50 mM, pH 8.0 sodium phosphate buffer) for 48 h (dialysis bag molecular cutoff 33 kDa). The protein content was determined by Coomassie Brilliant Blue method and was 1.8 mg / mL. The enzyme solution was washed with 50 mM, pH Dilute with 8.0% sodium phosphate buffer to a final concentration of 0.5 mg / mL, aliquot, and store at -80°C.
[0052] Example 5: Construction of mutant strain library
[0053] According to the Genbank collection of Aspergillus fungus Rand ( slow-moving ) was used to design site-directed mutagenesis primers based on the parent transaminase base sequence (sequence shown in SEQ ID NO. 2, nucleotide sequence shown in SEQ ID NO. 1). Rapid PCR was used with the recombinant vector pET28b-MS3 as a template to introduce single mutations at positions 275, 115, and 97. The primers were:
[0054] Primer 5: G275A Pf ATACCGCCGGCGGTGGTGCACATAAAGA
[0055] G275A Pr GCACCACCGCCGGCGGTATTATGCCTATA
[0056] Primer 6: K115M Pf ACGATGATCATACCCATTGCATCACGGATA
[0057] K115M Pr TTGTTGCCATGGTATATCTCCTTCTTAAAGTT
[0058] Primer 7: K97R Pf AGCTCTGTGCGCAAGATCCTGGTGGAAATGG
[0059] K97R Pr CCAGGATCTTGCGCACAGAGCTCAGTGCC
[0060] PCR reaction system (total reaction system is 50 μL): 25 μL of 1× Phanta max Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP and dTTP), 1 μL of Phanta Max Super-FIDelity DNA Polymerase, 1 μL of upstream and downstream primers (both at a concentration of 50 μM), 1 μL of recombinant vector pET28b-MS3, and 20 μL of nuclease-free water.
[0061] PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 6 min, for a total of 30 cycles, and final extension at 72°C for 5 min.
[0062] Take 10 μL of the PCR product and transfer it into competent cells containing 100 μL of Escherichia coli BL21 (DE3). The transformation conditions are 42°C, heat shock for 90 seconds, and quickly cool on ice for 3 minutes. Add 600 μL of LB liquid culture medium to the tube, culture at 37°C, 180 r / min for 60 minutes, centrifuge at 12000 rpm for 1 minute, discard 600 μL of supernatant, mix the remaining 100 μL of bacterial solution thoroughly, and then apply it to an LB resistance plate containing 50 μg / ml ampicillin. After the bacterial solution is completely absorbed by the culture medium, invert and culture at 37°C for 14~16 hours.
[0063] Monoclonal strains were picked on LB resistance plates containing 50 μg / ml ampicillin and sent to Hangzhou Qingke Sequencing Company for sequence detection. The sequencing results were analyzed using software.
[0064] Example 6: Enzyme activity assay of ω-MS3 mutants
[0065] After obtaining Escherichia coli containing the mutant protein, biotransformation of the intermediate precursor ketone of sitagliptin was screened at a final concentration of 25 g / L. The final concentration composition and catalytic conditions of the catalytic system (1 ml) were as follows: 15 g / L triethanolamine, pH 8.5-9.0 triethanolamine buffer, 25 g / L substrate sitagliptin intermediate precursor ketone 1-piperidinyl-4-(2,4,5-trifluorophenyl)-1,3-dibutanone, 50% (v / v) DMSO final concentration, 0.5 g / L pyridoxal phosphate, and 40 g / L isopropylamine.
[0066] Reaction conditions: 45°C, 600 rpm, 12 h. Under the same conditions, a blank control was added to the reaction solution containing unmutated wet cells. After the reaction, samples were collected for HPLC analysis.
[0067] The HPLC detection conditions were as follows: mobile phase A: 10 mM ammonium acetate; mobile phase B: pure acetonitrile; mobile phase A: mobile phase B = 1:1; flow rate: 1 ml / min; detection wavelength: 205 nm. Several excellent mutants were obtained from the test results, and the enzyme activities of some excellent mutants are shown in Table 1.
[0068] Table 1
[0069]
[0070] Example 7: Application of recombinant transaminase MS3 in the preparation of sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone
[0071] The recombinant Escherichia coli BL21 / pET28b-MS3 wet cells containing the recombinant expression plasmid obtained by the method of Example 3 were used as a biocatalyst, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.
[0072] The final composition and catalytic conditions of the low-substrate concentration catalytic system (1 ml) were as follows: 0.25 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 5 g / L of the substrate sitagliptin precursor ketone, 50% (v / v) DMSO, 0.5 g / L of pyridoxal phosphate, and 10 g / L of isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 cells as a negative control. After the reaction, samples were collected and analyzed by HPLC. The substrate conversion rate of the reaction system was 16.9%, with an EE >99%.
[0073] The final composition and catalytic conditions of the high substrate concentration catalytic system (1 ml) were as follows: 0.25 g wet cells, triethanolamine buffer (pH 8-8.5), 50 g / L sitagliptin precursor ketone, 50% DMSO (final concentration v / v), 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC (under the same conditions as in Example 5). The substrate conversion rate in the reaction system was less than 10% (9.5%).
[0074] Example 8: Application of recombinant transaminase MS3 mutant 1 in the preparation of (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone as a sitagliptin intermediate
[0075] The recombinant Escherichia coli BL21 / pET28b-MS3mut1 wet cells containing the recombinant expression plasmid obtained by the method of Example 3 were used as a biocatalyst, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.
[0076] The final composition and catalytic conditions of the low-substrate concentration catalytic system (1 ml) were as follows: 0.25 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 2 g / L of the substrate sitagliptin precursor ketone, 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. Optimally, at a substrate concentration of 5 g / L, MS3 mutant 1 achieved a conversion of 66.7% with an EE >99%.
[0077] The final composition and catalytic conditions of the high-substrate concentration catalytic system (1 ml) were as follows: 0.75 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 50 g / L of the substrate (sitagliptin intermediate precursor ketone), 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. The conversion rate of the substrate for MS3 mutant 1 was 56.0%, with an ee >99%.
[0078] Example 9: Application of recombinant transaminase MS3 mutant 2 in the preparation of (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone as a sitagliptin intermediate
[0079] The recombinant Escherichia coli BL21 / pET28b-MS3mut2 wet cells containing the recombinant expression plasmid obtained by the method of Example 3 were used as a biocatalyst, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.
[0080] The final composition and catalytic conditions of the low-substrate concentration catalytic system (1 ml) were as follows: 0.25 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 2 g / L of the substrate sitagliptin precursor ketone, 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. Optimally, at a substrate concentration of 5 g / L, MS3 mutant 2 achieved a conversion rate of 74.7% with an EE >99%.
[0081] The final composition and catalytic conditions of the high-substrate concentration catalytic system (1 ml) were as follows: 0.75 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 50 g / L of the substrate (sitagliptin intermediate precursor ketone), 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. The conversion rate of MS3 mutant 2 for the substrate was 68.1%, with an ee >99%.
[0082] Example 10: Application of recombinant transaminase MS3 mutant 3 in the preparation of sitagliptin intermediate (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone
[0083] The recombinant Escherichia coli BL21 / pET28b-MS3mut3 wet cells containing the recombinant expression plasmid obtained by the method of Example 3 were used as a biocatalyst, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.
[0084] The final composition and catalytic conditions of the low-substrate concentration catalytic system (1 ml) were as follows: 0.25 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 2 g / L of the substrate sitagliptin precursor ketone, 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. Optimally, at a substrate concentration of 5 g / L, MS3 mutant 3 achieved a conversion of 87.8% with an EE >99%.
[0085] The final composition and catalytic conditions of the high-substrate concentration catalytic system (1 ml) were as follows: 0.75 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 50 g / L of the substrate (sitagliptin intermediate precursor ketone), 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. The conversion rate of MS3 mutant 3 for the substrate was 83.9%, with an ee >99%.
[0086] Example 11: Application of recombinant transaminase MS3 mutant 4 in the preparation of (R)-3-amino-1-piperidin-4-(2,4,5-trifluorophenyl)-1-butanone as a sitagliptin intermediate
[0087] The recombinant Escherichia coli BL21 / pET28b-MS3mut4 wet cells containing the recombinant expression plasmid obtained by the method of Example 3 were used as a biocatalyst, and the sitagliptin intermediate precursor ketone [1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone] was used as a substrate to carry out a biocatalytic reaction to synthesize the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.
[0088] The final composition and catalytic conditions of the low-substrate concentration catalytic system (1 ml) were as follows: 0.25 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 2 g / L of the substrate sitagliptin precursor ketone, 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. Optimally, at a substrate concentration of 5 g / L, MS3 mutant 4 achieved a conversion rate of 95.2% with an EE >99%.
[0089] The final composition and catalytic conditions of the high-substrate concentration catalytic system (1 ml) were as follows: 0.75 g of wet bacterial cells, triethanolamine buffer (pH 8-8.5), 50 g / L of the substrate (sitagliptin intermediate precursor ketone), 50% (v / v) DMSO, 0.5 g / L pyridoxal phosphate, and 10 g / L isopropylamine. Reaction conditions were: temperature 45°C, stirring speed 1200 rpm, and reaction time 36 h. Under the same conditions, the reaction solution containing no bacterial cells served as a blank control, and wet E. coli BL21 / pET28b cells were used instead of the recombinant E. coli BL21 / pET28b-MS3 as a negative control. After the reaction, samples were collected and analyzed by HPLC. The conversion rate of MS3 mutant 4 to the substrate was 91.7%, with an ee >99%.
[0090] In summary, the method of this example was used to perform conversion rate determination experiments on the other three mutants. The results of HPLC detection after 36 hours of reaction are shown in Table 2:
[0091] Table 2: Conversion rates and product ee values of different transaminase mutants for different substrate concentrations
[0092]
[0093] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.
Claims
1. A ω-aminotransferase mutant, obtained by mutating the lysine at position 97 of the amino acid sequence shown in SEQ ID NO. 2 to arginine and the lysine at position 115 to methionine.
2. A gene encoding the ω-transaminase mutant according to claim 1.
3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.
7. A recombinant vector comprising a gene encoding the ω-aminotransferase mutant according to claim 1.
5. A genetically engineered bacterium containing a gene encoding the ω-aminotransferase mutant according to claim 1.
6. Use of the ω-transaminase mutant according to claim 1 in the microbial catalytic preparation of the sitagliptin intermediate (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone, characterized in that the use comprises: using 1-piperidine-4-(2,4,5-trifluorophenyl)-1,3-dibutanone as a reaction substrate, wet bacteria containing the ω-transaminase mutant as a biocatalyst, dimethyl sulfoxide as a cosolvent, pyridoxal phosphate as a coenzyme, isopropylamine as a cosubstrate, and a pH 8-9 triethanolamine buffer as a reaction medium to form a reaction system, performing a biocatalytic reaction, and after the reaction is completed, separating and purifying the reaction solution to obtain (R)-3-amino-1-piperidine-4-(2,4,5-trifluorophenyl)-1-butanone.
Citation Information
Patent Citations
Beta-amino heterocyclic dipeptidyl peptidase inhibitors for the treatment or prevention of diabetes
US6699871B2
Transaminase biocatalysts
US8293507B2
Process and intermediates for the preparation of beta-amino acid amide dipeptidyl peptidase-iv inhibitors
WO2004087650A2
Phosphoric acid salt of a dipeptidyl peptidase-iv inhibitor
WO2005003135A1
Combination of a dipeptidyl peptidase-4 inhibitor and an Anti-hypertensive agent for the treatment of diabetes and hypertension
WO2007050485A2