A feed additive containing eucommia ulmoides leaf extract and lysozyme mutant and its application

Abstract

The present invention discloses a feed additive containing Eucommia ulmoides leaf extract and a lysozyme mutant and its application. The present invention screened a lysozyme mutant LM-2 with an amino acid sequence shown in SEQ ID NO: 1, whose enzyme activity is increased by 3.5 times compared with the original lysozyme, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2, and this mutant has obvious inhibitory effects on Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis. The present invention also prepared a feed additive by mixing the lysozyme mutant LM-2 with Eucommia ulmoides leaf extract, which can significantly reduce the inflammation level of white - feather broilers under heat stress conditions, and has good application prospects in the breeding of livestock and poultry animals.

Description

Technical Field

[0001] The present invention belongs to the field of enzyme engineering, and particularly relates to a feed additive containing Eucommia ulmoides leaf extract and a lysozyme mutant and its application. Background Art

[0002] Lysozyme is widely present in various tissues of the human body, as well as in the egg white of birds and poultry, and the tears, saliva, plasma, and milk of mammals. Lysozyme, also known as muramidase or N-acetylmuramoyl glycanohydrolase, is an alkaline enzyme that can hydrolyze mucopolysaccharides in bacteria. It mainly destroys the β-1,4 glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in the cell wall, decomposes the insoluble mucopolysaccharide in the cell wall into soluble glycopeptides, causes the cell wall to rupture and the contents to escape, resulting in the dissolution of bacteria, and thus has an antibacterial effect. However, lysozyme from natural sources generally has low activity, and a relatively high addition amount is required to achieve an ideal antibacterial effect. Therefore, in the context of "antibiotic substitution", finding or designing a safe lysozyme with good antibacterial effect is an urgent problem to be solved. Summary of the Invention

[0003] The present invention provides a feed additive containing Eucommia ulmoides leaf extract and a lysozyme mutant and its application. The present invention has obtained a lysozyme mutant LM-2 with a 3.5-fold increase in enzyme activity, which has an inhibitory effect on a variety of pathogenic bacteria, and the feed additive prepared in combination with Eucommia ulmoides leaf extract has good application prospects in the breeding of livestock and poultry.

[0004] In order to achieve the above invention purpose, the present invention is implemented by the following technical solutions:

[0005] The present invention provides a lysozyme mutant LM-2, whose amino acid sequence is shown in SEQ ID NO: 1.

[0006] The present invention also provides a coding gene, which is the coding gene of the lysozyme mutant LM-2, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0007] The present invention also provides a recombinant expression vector, which contains the above coding gene.

[0008] The present invention also provides a recombinant engineering bacterium, which contains the above coding gene.

[0009] The present invention also provides a feed additive, which simultaneously contains the fermented liquid spray powder of the lysozyme mutant LM-2 and Eucommia ulmoides leaf extract.

[0010] Furthermore, the mass ratio of the fermented liquid spray powder of the lysozyme mutant LM-2 to Eucommia ulmoides leaf extract is 1:1 to 4.

[0011] The present invention also provides the use of the lysozyme mutant LM-2 in the preparation of an antibacterial agent.

[0012] Furthermore, the pathogenic bacteria inhibited by the antibacterial agent are Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis.

[0013] The present invention also provides the use of the lysozyme mutant or the feed additive in the breeding of livestock and poultry.

[0014] Furthermore, the dosage of the lysozyme mutant or feed additive is 70 mg / kg diet to 280 mg / kg diet.

[0015] Compared with the prior art, the advantages and beneficial technical effects of the present invention are:

[0016] 1. First, the present invention optimizes and mutates the gene codons of lysozyme. After obtaining a mutant with improved enzyme activity through screening, the cecropin partial gene is fused using a linker peptide to further improve its enzyme activity. Finally, the enzyme activity of the obtained lysozyme mutant LM-2 is 3.5 times that of the original lysozyme.

[0017] 2. The obtained lysozyme mutant LM-2 of the present invention has obvious inhibitory effects on Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis.

[0018] 3. The present invention prepares a feed additive by mixing the Eucommia ulmoides leaf extract and the lysozyme mutant LM-2, which can significantly reduce the inflammation level of white - feather broilers under heat stress conditions, showing good application prospects in the breeding of livestock and poultry. Brief Description of the Drawings

[0019] Figure 1 It is the PCR result of the lysozyme mutant LM-2.

[0020] Figure 2 It is the comparison of the enzyme activity of the lysozyme mutant in shake - flask fermentation.

[0021] Figure 3 It is the SDS - PAGE electrophoresis result of the lysozyme mutant.

[0022] Figure 4 It is the fermentation curve of the lysozyme mutant in a 15L fermentor.

[0023] Figure 5 It is the antibacterial result of the lysozyme mutant, where the target bacteria numbered A - D are Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis respectively. Detailed Embodiments

[0024] To facilitate the understanding of the present invention, the present invention will be described more comprehensively and in detail below in conjunction with the accompanying drawings and embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.

[0025] For the molecular biology experimental methods not specifically described in the following embodiments, reference can be made to the specific methods listed in "Molecular Cloning: A Laboratory Manual" (Third Edition) by J. Sambrook, or carried out according to the kits and product specifications. The reagents and biological materials used in the specific embodiments can be obtained from commercial sources without special instructions.

[0026] The medium formula used in the present invention is as follows:

[0027] LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl;

[0028] MD medium: 1.34% YNB, 0.4 mg / L biotin, 2% glucose;

[0029] YPD medium: 1% yeast extract, 2% peptone, 2% glucose;

[0030] BMGY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4 mg / L biotin, 1% glycerol;

[0031] BMMY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4 mg / L biotin, 1% methanol;

[0032] BSM medium: 26.7 mL of 85% phosphoric acid, 0.93 g of calcium sulfate dihydrate, 14.9 g of magnesium sulfate heptahydrate, 4.13 g of potassium hydroxide, 18.2 g of potassium sulfate, 40 g of glycerol, 4.0 mL of PMT1.

[0033] When the above media are solid media, 2% agar powder can be added to the original formula.

[0034] Enzyme activity assay: Refer to the assay method of lysozyme in the "Nanjing Jiancheng - Lysozyme Assay Kit".

[0035] Example 1: Construction and screening of lysozyme mutant genes

[0036] Referring to the amino acid sequence of lysozyme from Bacillus licheniformis (GenBank: TDO63020.1), the corresponding nucleotide sequence was translated and artificially synthesized after gene sequence optimization. The following primers were designed, with an EcoR I restriction enzyme site designed at the 5' end and a Not I restriction enzyme site designed at the 3' end.

[0037] Lys-F: CCGGAATTCATGGGAATTAAGGGTATT (SEQ ID NO: 3);

[0038] Lys-R: ATAAGCGGCCGCTTACTTAACTCTAATCT (SEQ ID NO: 4).

[0039] Using the GeneMorph II Random Mutagenesis PCR Kit, with the synthetic gene as the template, random mutagenesis was carried out, and the primer sequences used were Lys-F and Lys-R.

[0040] The amplified random mutagenesis PCR product was double digested with EcoR I and Not I, purified and recovered, and then ligated to the pET-21a(+) vector. Escherichia coli BL21-DE3 was transformed, and positive clones were screened on an LB plate with ampicillin resistance to obtain pET-LysMx. In the same way, the synthetic original gene was ligated to the pET-21a(+) vector and transformed into Escherichia coli BL21-DE3 to obtain pET-Lys0.

[0041] The selected single colonies were inoculated into 96-well deep-well plates. Two single colonies expressing Lys0 were inoculated into each plate as controls. 300 μL of LB liquid medium (containing 100 μg / mL ampicillin) was added to each well. After shaking culture at 37°C and 200 rpm for 4 hours, 50 μL of the bacterial solution was transferred to a new 96-well plate for preservation. 200 μL of LB-Amp medium containing IPTG was added to the remaining bacterial solution in the plate to make the final concentration of IPTG 1 mM and the final concentration of ampicillin 100 μg / mL. The bacteria were cultured at 37°C and 200 rpm on a shaker for 10 h to induce the expression of lysozyme.

[0042] The induced bacterial solution was repeatedly frozen and thawed for disruption. The disrupted cell lysate was centrifuged to collect the supernatant, and then the activity of lysozyme was detected. Mutant genes with enzyme activity higher than that of the control were screened for sequencing. After sequencing, the lysozyme mutant LysM1 was obtained, and its amino acid sequence is shown in SEQ ID NO: 5, and its nucleotide sequence is shown in SEQ ID NO: 6.

[0043] Example 2: Construction of Lysozyme Mutant LM-2 Gene and Verification of Its Bacteriostatic Activity

[0044] Using the lysozyme mutant LysM1 obtained in Example 1 as a template, the partial mutant gene of cecropin (NCBI PRF: 2018170A) was amplified using primers C-F and CL1-R, the mutant LysM1 was amplified using primers CL2-F and Lys-R, and then the fusion gene was obtained by overlapping PCR using primers C-F and Lys-R. The amplified product was verified by electrophoresis. The results are as Figure 1 shown, and the fusion fragment was successfully constructed. Finally, the lysozyme mutant LM-2 was obtained, whose amino acid sequence is shown in SEQ ID NO: 1 and nucleotide sequence is shown in SEQ ID NO: 2.

[0045] The primers used are as follows:

[0046] C-F: CCGGAATTCGCTCCAGAACCTAGATG (SEQ ID NO: 7);

[0047] CL1-R: AGCCTTAGCGGCAGCTTCCTTAGCGGCAGCTTCGGCCTTACCAATAGCCTTAGCGCT(SEQID NO: 8);

[0048] CL2-F: GCCGAAGCTGCCGCTAAGGAAGCTGCCGCTAAGGCTATGGGAATTAAGGGTATTG(SEQ IDNO: 9);

[0049] Lys-R: ATAAGCGGCCGCTTACTTAACTCTAATCT (SEQ ID NO: 4).

[0050] The overlapping PCR reaction system was 50 μL. First, the primers were not added, and other conditions were carried out according to the instructions of the corresponding DNA polymerase. The reaction conditions were 2-step cycling: pre-denaturation at 96 °C for 5 min, denaturation at 94 °C for 30 sec, annealing (extension) at 68 °C for 45 sec. After 5 cycles, the PCR program was paused, the PCR tube was taken out, placed on ice, 2 μL of upstream primer and 2 μL of downstream primer were added, and mixed well; then denaturation at 94 °C for 30 sec, annealing (extension) at 68 °C for 45 sec, cycled 30 times, followed by extension at 72 °C for 10 min, and stored at 15 °C.

[0051] The lysozyme mutant LM-2 gene was cloned into the pET-21a(+) vector according to the method in Example 1, and transformed into Escherichia coli BL21-DE3 for shake-flask fermentation to obtain the fermentation broth.

[0052] According to the method of the lysozyme assay kit, the supernatant after centrifugation of the fermentation broth was taken to measure the enzyme activity. The results are as Figure 2As shown, the enzyme activity of lysozyme mutant LM-2 is further improved, which is 3.5 times that of the original lysozyme Lys0.

[0053] Example 3: Transformation of Pichia pastoris SMD168 with Lysozyme Mutant LM-2

[0054] The gene of lysozyme mutant LM-2 was ligated to the pPIC9K plasmid with EcoR I and Not I double digestion sites and transformed into Escherichia coli DH5α to obtain the expression vector pPIC-LM-2, which was verified by sequencing. After linearizing the positive expression vector with Sal I, it was electrotransformed into Pichia pastoris SMD168. Transformants were screened on MD plates and then transferred to YPD plates for activation (usually pick 24 - 48 transformants). The activated transformants were inoculated into shake flasks for fermentation (each flask containing 20 mL of BMGY medium). After culturing at 30 °C with shaking for 18 h, 1% methanol was added for induction, and the shaking culture was continued. Thereafter, 1% of the culture volume of methanol was added every 24 h. After 96 h of induced expression, the culture broth was centrifuged to obtain the supernatant, and the average antibacterial activity of the fermentation broth supernatant was measured. Under the shake flask fermentation conditions, the antibacterial activity of lysozyme mutant LM-2 in yeast SMD168 was about 3 times that in Escherichia coli BL21, and the antibacterial activity was further improved. The fermentation supernatant was subjected to SDS-PAGE, and clear target bands could be seen on the protein gel ( Figure 3 ).

[0055] Example 4: Fermentation and Preparation of Lysozyme Mutant LM-2 in a 15 L Fermenter

[0056] The genetically engineered bacteria of lysozyme mutant LM-2 were streaked on YPD plates respectively and cultured at 30 °C for 3 days to grow single colonies. Well-grown single colonies were picked and streaked on YPD plates for continuous culture. The Pichia pastoris single colonies obtained after such activation for three generations were inoculated into 20 mL of BMGY medium and cultured at 30 °C and 200 rpm for 24 h. Inoculated into 300 mL of BMGY medium at an inoculation amount of 2%, cultured at 30 °C and 200 rpm until OD600 reached 5, and used as the seed liquid to inoculate the fermenter. Fermentation production process: BSM medium, pH 4.8, temperature 30 °C, stirring rate 500 rpm, ventilation volume 1.5 (v / v), dissolved oxygen controlled above 20%. The fermentation process was divided into three stages: (1) Bacterial cell culture stage: The seed liquid was inoculated at an 8% ratio and cultured at 30 °C for 20 - 24 h to exhaust the glycerol in the fermentation broth; (2) Starvation stage: When the carbon source glycerol was exhausted, no carbon source was added temporarily, and the starvation stage ended when the dissolved oxygen rose to 80%; (3) Induced expression stage: The pH was adjusted to the required value with ammonia water or phosphoric acid, methanol was added dropwise for induction, and the dissolved oxygen was maintained above 20%. The induction time was 160 - 200 h; After the fermentation ended, the fermentation broth was treated by a plate and frame filter press and then spray-dried into a powder preparation by a spray tower for application testing.

[0057] The fermentation process curve of lysozyme mutant LM-2 is as Figure 4 shown: Samples were taken every 8 h to measure the enzyme production level. After 160 h of fermentation, the enzyme activity level reached the highest point.

[0058] Example 5: Antibacterial test of lysozyme mutant against common pathogenic bacteria

[0059] According to the agar diffusion method, Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis were used as target bacteria respectively. An appropriate amount of target bacteria was added to the melted warm LB agar medium, and the plates were poured. After the plates solidified, holes were punched. An equal amount of fermentation broth was added to each hole, and it was placed in an incubator and incubated statically until an antibacterial zone was formed. The diameter of the antibacterial zone was measured and compared with that of the antibiotic to obtain the corresponding antibacterial titer.

[0060] Preparation of lysozyme mutant fermentation broth: The LM-2 fermentation broth was spray-dried and formulated into a concentration of 0.1 g / mL, and then filtered and sterilized for standby. In a laminar flow hood, under aseptic operation, an appropriate amount of fermentation broth was added to the holes of the plate.

[0061] The results are as Figure 5 shown. The lysozyme mutant LM-2 has good antibacterial effects against Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis.

[0062] Example 6: Preparation of feed additive and its effects on the growth and heat stress of broilers

[0063] The lysozyme mutant LM-2 fermentation broth was spray-dried and mixed evenly with Eucommia ulmoides leaf extract at a mass ratio of 1:1 to prepare a feed additive containing Eucommia ulmoides leaf extract. Among them, the preparation method of Eucommia ulmoides leaf extract was as follows: Eucommia ulmoides leaves were taken and extracted with water at an extraction temperature of 55 - 65 °C and an extraction time of 2 - 4 h, and then filtered. The filtrate was vacuum-concentrated at 60 °C to a specific gravity of 1.2 (for the solution concentrated to this specific gravity, the spray-drying time is the shortest because chlorogenic acid decomposes at high temperatures. With a short spray-drying time, chlorogenic acid is instantaneously spray-dried without loss and energy is saved), and then spray-dried in a spray drying tower to obtain the Eucommia ulmoides leaf extract.

[0064] 540 7-day-old white-feathered broilers with similar body weights were selected and pre-fed for 3 days. After the pre-feeding period ended, they were randomly divided into 6 treatment groups, with 3 replicates in each treatment group, and each replicate group was 1 pen (30 chickens in each pen), and the average body weight of the chickens in each pen was similar.

[0065] Table 1 Grouping and feeding conditions of white-feathered broilers

[0066]

[0067] Starting from 21 days of age, high temperature stress at 35°C for 8 hours per day was given until 35 days of age. Feed intake, average weight were recorded during the experiment, and the feed-to-meat ratio was calculated. After the breeding ended, small intestinal mucosa, jejunum tissue and liver tissue were taken, total RNA was extracted, and after reverse transcription, fluorescence PCR was carried out to detect the expression level of immune factors (internal reference β-actin).

[0068] Table 2 Effects of lysozyme on the growth of white - feather broilers under heat stress

[0069]

[0070] As shown in the results of Table 2, compared with the control group, the group adding feed additives significantly increased the average weight of white - feather broilers and decreased the feed - to - meat ratio, achieving an effect similar to that of the antibiotic group, with better application effects, and all were superior to the group only using Eucommia ulmoides leaf extract.

[0071] Table 3 Effects of lysozyme on the transcriptional levels of pro - inflammatory factors in the jejunal mucosa of white - feather broilers under heat stress

[0072]

[0073] Table 4 Effects of lysozyme on the transcriptional levels of anti - inflammatory factors in the jejunal mucosa of white - feather broilers under heat stress

[0074]

[0075] The analysis results of Table 3 show that the transcriptional levels of pro - inflammatory factors IL - 1β, IL - 6, IFN - γ and iNOS in the experimental group were significantly lower than those in the control group, the antibiotic group and the Eucommia ulmoides leaf extract group, and the transcriptional levels of TNF - α in experimental groups 2 and 3 were significantly lower than those in the blank control group, the antibiotic group and experimental group 1; the results of the transcriptional levels of anti - inflammatory factors in Table 4 show that the transcriptional levels of anti - inflammatory factors IL - 4, IL - 10, IL - 13 were also significantly lower than those in the blank control group, the antibiotic group and the Eucommia ulmoides leaf extract group, and the effect was more significant with the increase in the amount of lysozyme used. It shows that adding the additive containing lysozyme mutant and Eucommia ulmoides leaf extract to the basic diet can significantly reduce the inflammation level of white - feather broilers under heat stress.

[0076] The above - mentioned embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, for those of ordinary skill in the art, it is still possible to modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacement on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions required to be protected by the present invention.

Claims

1. A lysozyme mutant LM-2, characterized in that, Its amino acid sequence is shown in SEQ ID NO:

1.

2. A coding gene, characterized in that, It is the coding gene of the lysozyme mutant LM-2 described in claim 1, and its nucleotide sequence is shown in SEQ ID NO:

2.

3. A recombinant expression vector, characterized in that, It contains the coding gene described in claim 2.

4. A recombinant engineering bacterium, characterized in that, It contains the coding gene described in claim 2.

5. A feed additive, characterized in that, It contains the spray-dried powder of the fermentation broth of the lysozyme mutant LM-2 described in claim 1 and Eucommia ulmoides leaf extract at the same time.

6. The feed additive according to claim 5, characterized in that, The mass ratio of the spray-dried powder of the fermentation broth of the lysozyme mutant LM-2 to the Eucommia ulmoides leaf extract is 1:1 to 4.

7. Use of the lysozyme mutant LM-2 according to claim 1 in the preparation of an antibacterial agent, characterized in that, The pathogenic bacteria inhibited by the bacteriostatic agent are Staphylococcus aureus, Clostridium perfringens, Escherichia coli, and Salmonella enteritidis.

8. Use of the lysozyme mutant described in claim 1 or the feed additive described in claim 5 in the breeding of livestock and poultry.

9. The application according to claim 8, wherein The dosage of the lysozyme mutant or the feed additive is 70 mg / kg diet to 280 mg / kg diet.

Images