A method for regulating rice starch through OsNAP gene

Abstract

The present invention discloses a method for regulating rice starch through OsNAP gene, including gene editing of rice OsNAP gene. The present invention verifies through various technical means that OsNAP is a brand-new starch synthase regulatory factor, especially a regulatory factor of amylose synthase, so that the purpose of fine-tuning the reduction of rice amylose can be achieved by gene editing OsNAP, while other appearance qualities of rice will not be negatively affected, and it has great application potential in improving the taste quality; the functional loss of OsNAP can not only reduce the amylose content, but also reduce the total starch content, thereby increasing the soluble sugar content and improving the flavor and taste of rice.

Description

Technical Field

[0001] The invention belongs to the technical field of plant transgenic technology, and specifically relates to a method for regulating rice starch through OsNAP gene. Background Art

[0002] The quality of rice determines the choice of consumers and its market economic value. The quality indicators of rice include milling quality, appearance quality (mainly chalkiness and aspect ratio), taste quality, nutritional quality, etc. About 90% of the dry weight of rice is starch, which is composed of amylose and amylopectin. Amylose accounts for about 0%-30% of the total starch in rice, but has a huge impact on the quality of rice. A high content of amylose often leads to a deterioration in the taste quality of rice. Conversely, a low content of amylose greatly improves the taste quality of rice. Therefore, in recent years, many researchers have achieved the purpose of improving rice quality by editing the amylose synthase encoding gene OsGBSSI (Wx).

[0003] However, modification of the coding region of OsGBSSI often directly results in a complete loss of amylose content, producing an opaque waxy glutinous rice phenotype, which lacks application value in production. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] One of the objectives of the present invention is to provide a method for regulating rice starch through the OsNAP gene.

[0007] In order to solve the above technical problems, the present invention provides the following technical solution: a method for regulating rice starch through OsNAP gene, comprising gene editing the rice OsNAP gene.

[0008] As a preferred embodiment of the method for regulating rice starch by OsNAP gene of the present invention, the nucleotide sequence of the rice OsNAP gene is shown as SEQ ID NO.1.

[0009] As a preferred embodiment of the method for regulating rice starch by OsNAP gene of the present invention, the gene editing is performed by using CRISPR / Cas9 system, and the CRISPR / Cas9 system includes a sgRNA vector expressing the targeting rice OsNAP gene.

[0010] As a preferred embodiment of the method for regulating rice starch by OsNAP gene of the present invention, the vector expressing sgRNA targeting the rice OsNAP gene may be vector SK-gRNA and / or vector pCAMBIA 1300-GN.

[0011] As a preferred embodiment of the method for regulating rice starch by OsNAP gene of the present invention, the target sequence of the sgRNA is positions 312 to 331 downstream of the first exon ATG of the gene sequence of SEQ ID NO.1.

[0012] As a preferred embodiment of the method for regulating rice starch by OsNAP gene of the present invention, the CRISPR / Cas9 system includes an sgRNA vector expressing the sgRNA targeting the 312-331st positions downstream of the first exon ATG of the gene sequence of SEQ ID NO.1.

[0013] As a preferred embodiment of the method for regulating rice starch by OsNAP gene of the present invention, the rice is japonica rice.

[0014] Another object of the present invention is to provide a DNA molecule, wherein the DNA molecule is any of the following:

[0015] (a1) The nucleotide sequence is a DNA molecule shown in SEQ ID NO.3;

[0016] (a2) The nucleotide sequence is a DNA molecule shown in SEQ ID NO.5.

[0017] As a preferred embodiment of the DNA molecule of the present invention, the DNA molecule shown in SEQ ID NO.3 is a frameshift mutation of the rice OsNAP gene (SEQ ID No.1), which has an insertion of a base;

[0018] The DNA molecule shown in SEQ ID NO.5 is a frameshift mutation of the rice OsNAP gene (SEQ ID No.1), which has a deletion of 4 bases.

[0019] Another object of the present invention is to provide a biomaterial, wherein the biomaterial is any of the following:

[0020] (b1) sgRNA specifically targeting the rice OsNAP gene;

[0021] (b2) sgRNA that specifically targets the target sequence;

[0022] (b3) a DNA molecule encoding the sgRNA described in (b1) or (b2);

[0023] (b4) an expression cassette containing the DNA molecule described in (b3);

[0024] (b5) a recombinant vector containing the DNA molecule described in (b3), or a recombinant vector containing the expression cassette described in (b4);

[0025] (b6) a recombinant microorganism containing the sgRNA described in (b1) or (b2) or the DNA molecule described in (b3), or a recombinant microorganism containing the expression cassette described in (b4), or a recombinant microorganism containing the recombinant vector described in (b5);

[0026] (b7) A transgenic plant cell line containing the sgRNA described in (b1) or (b2) or the DNA molecule described in (b3), or a transgenic plant cell line containing the expression cassette described in (b4), or a transgenic plant cell line containing the recombinant vector described in (b5).

[0027] As a preferred embodiment of the biomaterial of the present invention, the vector may be a plasmid, a cosmid, a phage or a virus vector.

[0028] As a preferred embodiment of the biomaterial of the present invention, the microorganism may be yeast, bacteria, algae or fungi. The bacteria may be from Escherichia, Erwinia, Agrobacterium, Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc.

[0029] As a preferred embodiment of the biomaterial of the present invention, the recombinant vector may specifically be a CRISPR / Cas9 targeting vector, including an intermediate vector SK-gRNA and / or a final vector pC1300-Cas9, but not limited thereto.

[0030] Another object of the present invention is to provide a method for preparing rice with improved rice quality, comprising:

[0031] The DNA molecule shown in SEQ ID No. 3 or SEQ ID No. 5 is used to replace the DNA molecule shown in SEQ ID No. 1 in the rice genome DNA to obtain rice with improved rice quality.

[0032] As a preferred embodiment of the method for preparing rice with improved rice quality of the present invention, wherein: the improvement of rice quality is at least one of the following:

[0033] (c1) total starch content is reduced;

[0034] (c2) Soluble sugar content increases.

[0035] (c3) The chalkiness rate and chalkiness are reduced.

[0036] Another object of the present invention is to provide the method for regulating rice amylose, and / or the use of the DNA molecule, and / or the biological material in creating OsNAP gene alleles and / or rice breeding.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention experimentally confirms that OsNAP is a new starch synthase encoding regulatory factor, which can regulate the expression of OsGBSSI, and OsNAP can promote the transcriptional activation of OsGBSSI by regulating the nuclear transport of another OsGBSSI regulatory factor OsNAP and forming a heterodimer, thereby achieving the purpose of controlling the content of amylose. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0040] Figure 1 Schematic diagram of the gene skeleton of OsNAP in the present invention; wherein, the black frame represents exons, and the black line represents introns; Target site is the target site of CRISPR / Cas9 gene editing, del is the deletion site, in is the insertion site, PF and PR are the forward primer and reverse primer, which are used to identify mutants.

[0041] Figure 2 The sequence is the sequencing result of the OsNAP gene sequence and mutant sequence in the present invention.

[0042] Figure 3 is the relative expression level of OsNAP in WT and osnap mutant in the present invention.

[0043] Figure 4 The endosperm phenotypes of the wild type and osnap mutant in the present invention are shown in the upper row and the lower row are the cross sections of brown rice.

[0044] Figure 5 The results are the appearance quality index detection results of the osnap mutant of the present invention. Figure 5 A and 5B are the test results of grain length and thousand-grain weight of mutants; Figure 5C and 5D are the test results of the chalkiness rate and chalkiness of the mutant.

[0045] Figure 6 This is the starch content test result of the OsNAP mutant of the present invention. Figure 6 A. Figure 6 B and Figure 6 C are the detection results of total starch content (TSC), apparent amylose content (AAC) and soluble sugar content (SSC) of the mutants, respectively.

[0046] Figure 7 The results of qRT-PCR detection of the expression levels of 12 starch synthase encoding genes in the endosperm of the osnap mutant of the present invention, with UBQ10 as the internal reference gene, 4 biological replicates for each sample, and 3 endosperms for each replicate. *P<0.05, **P<0.01, ***P<0.001. DETAILED DESCRIPTION

[0047] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0048] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0049] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0050] Example 1

[0051] 1. Plant Materials and Growth Conditions

[0052] The japonica rice variety (Oryza sativa ssp) Zhonghua11 (ZH11) was used. Using japonica rice ZH11 as the genetic transformation background, transgenic plants of OsNAP mutants were constructed. Paddy field conditions: Planted in the Songjiang Experimental Base in Shanghai in summer and grown in Lingshui, Hainan in winter under natural conditions, mainly used for phenotypic analysis, gene expression detection and seed production. Greenhouse conditions: 28℃, 11-h day / 13-h night, mainly for seedling culture and gene expression detection.

[0053] 2. Plasmid Construction and Transformation

[0054] For the construction of CRISPR / Cas9 mutants, wild-type ZH11 genomic DNA was used as a template, and the wild-type OsNAP gene sequence was shown in SEQ ID NO. 1. A target site was selected on the second exon of the OsNAP gene, specifically at positions 312 to 331 downstream of the first exon ATG of the gene sequence of SEQ ID NO. 1. The first exon ATG is at positions 2000 to 2002 of the gene sequence of SEQ ID NO. 1, as shown in FIG. Figure 1 The specific target site sequence is:

[0055] T1:GCAAGTACCCGAACGGGATC

[0056] According to the requirements of the CRISPR / Cas9 system, the target site was designed into primers and synthesized by a biological company. The specific primer sequences are:

[0057] T1-F: 5'-GGCAGCAAGTACCCGAACGGGATC-3'

[0058] T1-R: 5'-CACC GATCCCGTTCGGGTACTTGC-3'

[0059] After the target site primers are mixed and denatured and annealed, a fragment with sticky ends is formed and then connected to the intermediate vector SK-gRNA that has been digested with Aar I (Ferment). The transformed connection plasmid is tested for colony PCR positive. And sequencing is performed to verify whether it is correct. The correctly sequenced intermediate vector is digested with the same tail enzyme system and connected to the final vector pCAMBIA 1300-GN that has been digested with Kpn I and BamHI. Then PCR screening of positive colonies is performed and sequencing is verified.

[0060] 3. Genetic transformation

[0061] The recombinant vector plasmid with correct sequencing was transferred into the EHA105 strain, and the recipient rice ZH11 callus was infected by the Agrobacterium-mediated genetic transformation method (Liu Qiaoquan et al., Acta Physiologica Sinica, 1998). After 3 days of co-cultivation, the callus was cultured on a screening medium containing hygromycin. The selected resistant callus was cultured on a pre-differentiation medium for about 10 days, and the pre-differentiated callus was transferred to a differentiation medium for culture. Transgenic T0 generation plants were obtained in about one month.

[0062] 4. Detection and screening of mutant plants

[0063] The CTAB method was used to quickly extract genomic DNA from T0 rice leaves for mutation type detection. About 1 gram of fresh rice leaves from T0 tissue culture seedlings were cut into pieces and placed in a 2 ml centrifuge tube. Steel balls were added and frozen with liquid nitrogen, then crushed on a grinder, and DNA was extracted. The obtained DNA precipitate was dissolved in 100 microliters of ultrapure water.

[0064] Primers were designed on the OsNAP genome sequence to amplify the DNA fragment containing the target site, and the PCR product was sequenced directly. The sequencing results were analyzed using the online decoding website DSDecodeM to obtain mutation information. Individual plants with mutations were further planted, homozygous strains were screened, and transgenic traces were removed. After multiple generations of screening, we obtained two independent strains with different mutation types (named osnap-1 / 2).

[0065] The sequences of amplification primers for detecting mutation types are:

[0066] PF: 5'-AGTACCCACCCTCACAGCTC-3'

[0067] PR: 5'-AGTTGGTCTTGGTGCCCTTG-3'

[0068] The sequencing analysis results are as follows Figure 2 As shown in Table 1, osnap-1 has a T insertion at the 4th base from the target site; due to the frameshift and premature termination codon, the translation produces a polypeptide of 163 amino acids, as shown in Table 1. osnap-2 has a 4-base deletion at the fourth base from the target site, resulting in frameshift and premature termination, encoding 151 amino acids, as shown in Table 1.

[0069] The wild-type amino acid sequence of OsNAP is shown in SEQ ID NO. 2. The nucleotide sequence of the mutant osnap-1 is shown in SEQ ID NO. 3; the amino acid sequence of the mutant osnap-1 is shown in SEQ ID NO. 4. The nucleotide sequence of the mutant osnap-2 is shown in SEQ ID NO. 5; the amino acid sequence of the mutant osnap-2 is shown in SEQ ID NO. 6.

[0070] The wild-type and mutant amino acid sequences of OsNAP are shown in Table 1.

[0071] Table 1

[0072]

[0073]

[0074] Note: The amino acids with underlined letters represent normal amino acid residues, and the amino acids with bold letters represent frameshifted amino acids.

[0075] Subsequently, we isolated homozygous mutants from the T2 generation of self-segregated offspring plants of the T1 generation. qRT-PCR detection of OsNAP in homozygous mutants showed that the expression of OsNAP was almost undetectable in the endosperm of the mutants, such as Figure 3 These results indicate that osnap mutations are loss-of-function mutations.

[0076] The primer sequences for qRT-PCR detection of OsNAP are as follows:

[0077] OsNAP qRT-PCR F: 5'-TGCTGTGCCGGATCTACAAG-3'

[0078] OsNAPqRT-PCR R: 5'-AGCAGGTCGGAAATGGAAGG-3'

[0079] 5. Rice quality analysis

[0080] The rice seed maturity period is 30 to 50 days after flowering. The seeds were harvested about 50 days after flowering. The mature seeds of OsNAP mutant and wild-type rice plants were threshed and then husked using a micro-rice huller. Finally, the husked brown rice was milled using a micro-rice polisher to remove the seed coat and embryo and polish the rice. The polished rice was then dispersed and placed on the Wanshen Grain Appearance Quality Analyzer for scanning and analysis. The software automatically statistically analyzed and calculated the appearance indicators such as grain length, grain width, thousand-grain weight, chalkiness rate and chalkiness. Three biological replicates were analyzed for each sample, and no less than 300 seeds were analyzed for each biological replicate. *P<0.05,***P<0.001.

[0081] Figure 4 The endosperm phenotypes of the wild type and osnap mutants, the upper row is brown rice, and the lower row is the cross section of brown rice. Figure 5 The results of the appearance quality index detection of osnap mutants. Figure 5 A and 5B are the test results of grain length and thousand-grain weight of mutants; Figure 5 C and 5D are the test results of the chalkiness rate and chalkiness of the mutant.

[0082] The test results showed that the grain length and thousand-grain weight of the osnap mutant increased significantly, resulting in slender grains, while the chalkiness rate and chalkiness were significantly reduced, which greatly improved the appearance quality of rice. The mature endosperm of the osnap mutant was translucent and not chalky.

[0083] 6. Starch content and physical and chemical properties testing

[0084] After the mature seeds were dehulled and roughened, the roughened endosperm was ground into fine powder and filtered through a 150-mesh sieve. The starch assay kit (K-TSTA) was used according to the manufacturer's instructions. The apparent amylose content (AAC) was determined according to the literature method (Tan et al. (1999). The soluble sugar was determined by the anthrone-sulfuric acid colorimetric method. Briefly, 0.1 g of starch powder was washed twice with 4 ml of 80% (v / v) ethanol at 80°C, soluble sugar was extracted for 40 min, and the supernatant containing soluble sugar was collected by centrifugation at 3000 rpm for 5 min and diluted to 10 ml with water. 0.1 ml of the extract was mixed with 3 ml of anthrone-sulfuric acid buffer (0.1 g of anthrone was dissolved in 100 ml of 2M sulfuric acid). The absorbance of the reaction solution at 620 nm was measured, and an equal volume of 80% sugar-free ethanol was used as a blank control. A standard curve was obtained using a standard glucose solution, and then the sugar content of the unknown sample was calculated according to the linear equation.

[0085] Figure 6 A. Figure 6 B. Figure 6 C is the detection of total starch content (TSC), apparent amylose content (AAC) and soluble starch content (SSC).

[0086] The test results showed that compared with WT, the total starch content (TSC) and amylose content (AC) of the mutant endosperm were reduced ( Figure 6 A and Figure 6 B), the soluble sugar content (SSC) as the raw material for starch synthesis increased ( Figure 6 C).

[0087] 7. Expression detection of starch synthase encoding genes:

[0088] The endosperm of wild-type ZH11 and osnap homozygous mutant plants at different days after flowering (3DAF, 5DAF, 10DAF, 15DAF, 20DAF, 25DAF) was collected, and total RNA was extracted using an RNA extraction kit (Tiangen Biochemical); the RNA was then reverse transcribed into cDNA using a reverse transcription kit (TAKARA), and then the various starch synthase encoding genes in the cDNA were detected by sunlight quantitative PCR using a fluorescent quantitative kit (TAKARA); the above operations using the kit were carried out in full accordance with the manufacturer's instructions.

[0089] The primer sequences for fluorescent quantitative PCR detection of various starch synthases are shown in Table 2.

[0090] Table 2

[0091]

[0092]

[0093] The test results show that Figure 7 As shown, the expression levels of almost all starch synthase encoding genes were significantly reduced, indicating that OsNAP is indeed a positive regulator of rice endosperm starch synthase.

[0094] Our previous studies have shown that the rice NAC transcription factor OsNAC24 can participate in the regulation of starch synthesis in rice endosperm by directly binding and activating five starch synthase encoding genes including OsGBSSI and OsSBEI. To further reveal the molecular mechanism of OsNAC24 regulating starch synthesis, we screened the interacting proteins of OsNAC24 by yeast two-hybrid. One of the interacting proteins, OsNAP, is also a NAC family transcription factor and has a high degree of homology with OsNAC24, belonging to the same subfamily. OsNAP has a nuclear localization signal peptide (NLS) and is completely localized in the nucleus. OsNAC24 does not have an NLS and is localized in the nucleus and cytoplasm when present alone; when OsNAP and OsNAC24 co-exist, OsNAC24 is completely localized in the nucleus, indicating that OsNAP can promote OsNAC24 to enter the nucleus, thereby enhancing the expression of the target gene OsGBSSI. In addition, the protein interaction between OsNAP and OsNAC24 can greatly enhance the ability of OsNAC24 to activate OsGBSSI. The osnap mutant has a phenotype similar to that of osnac24. The appearance of the endosperm of the osnap mutant has not changed, but the total starch content and amylose content are reduced, and the expression level of the gene encoding starch synthase is changed. The above results indicate that OsNAP can cooperate with OsNAC24 to participate in the regulation of starch synthesis in rice endosperm. Our study confirmed that OsNAP is also involved in the transcriptional regulation of starch synthesis in rice endosperm and is a new starch synthesis regulator.

[0095] OsNAP is a typical NAC transcription factor, highly homologous to OsNAC24 and belonging to the same subfamily. OsNAP has transcriptional activation activity and a nuclear localization signal NLS, and is completely localized in the cell nucleus.

[0096] OsNAP and OsNAC24 can interact with each other, which not only promotes the nuclear localization of OsNAC24, but also greatly enhances the transcriptional activation activity of OsNAC24 on the target gene OsGBSSI.

[0097] OsNAP is also involved in the regulation of endosperm starch synthesis. Its mutant osnap has a phenotype similar to osnac24: the appearance quality is not affected, the total starch content is reduced, the soluble sugar content is increased, and the expression levels of most starch synthase encoding genes in the endosperm are changed.

[0098] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for regulating rice starch by OsNAP gene, characterized in that: The method comprises editing the rice OsNAP gene to make it functionally deficient; the nucleotide sequence of the rice OsNAP gene is shown in SEQ ID NO.

1.

2. The method for regulating rice starch by OsNAP gene according to claim 1, characterized in that: The gene editing is performed using a CRISPR / Cas9 system, wherein the CRISPR / Cas9 system includes a sgRNA vector that expresses a target gene of the rice OsNAP gene.

3. The method for regulating rice starch by OsNAP gene according to claim 2, characterized in that: The target sequence of the sgRNA is 312-331 downstream of the first exon ATG of the gene sequence of SEQ ID NO.1; The first exon ATG is located at positions 2000 to 2002 of the OsNAP gene sequence shown in SEQ ID NO.

1.

4. The method for regulating rice starch by OsNAP gene according to any one of claims 1 to 3, characterized in that: The rice is japonica rice.

5. A method for preparing rice with improved rice quality, characterized in that: include, Replacing the DNA molecule shown in SEQ ID No. 1 in the rice genomic DNA with the DNA molecule shown in SEQ ID No. 3 or SEQ ID No. 5 to obtain rice with improved rice quality; The improvement of rice quality is at least one of the following: (c1) Increased soluble sugar content; (c2) The chalkiness rate and chalkiness are reduced.

6. Use of the method for regulating rice starch according to any one of claims 1 to 4 in rice breeding.

Images