An engineered bacterium for specifically removing arsenic

Abstract

The present invention relates to the technical field of biological arsenic removal, and in particular to an engineered bacterium that specifically removes arsenic. The engineered bacterium and vector provided by the present invention comprise an arsenic-binding protein expression cassette, and the expression cassette comprises an arsenic-inducible promoter, a bacterial surface display carrier protein gene, a fluorescent protein gene, and an arsenic-binding protein gene. The engineered bacterium can be induced by arsenic to efficiently express an arsenic-binding protein with arsenic-binding activity on the bacterial surface without the need for additional inducers. It can specifically bind to arsenic, and the expression of the arsenic-binding protein can also be monitored based on fluorescent signals. The engineered bacterium and vector that specifically remove arsenic provided by the present invention provide a new method for the treatment of arsenic pollutants in the environment. At the same time, it provides a new idea, means, and resource for constructing engineered bacteria and vectors with the function of removing specific metals using metal-specific inducible promoters and corresponding metal-specific regulatory proteins, which is of great significance in removing non-metallic and metallic pollutants in the environment.

Description

Technical Field

[0001] This application is a divisional application of patent application number 2020108203457, entitled "An engineered bacterium specifically for arsenic removal, its construction method, and application." The present invention relates to the field of biological arsenic removal technology, and specifically to an engineered bacterium specifically for arsenic removal. Background Art

[0002] Currently, the main methods for remediating environmental pollution are physical and chemical methods and biological methods. The former is a method that uses physical and chemical means to remove pollutants in the environment or convert them into stable and harmless substances, while the latter is a method that uses the characteristics of organisms or certain components in organisms to remove pollutants in the environment.

[0003] Metal ion removal can be achieved by leveraging the metal ion adsorption capacity of bacteria expressing metal-binding proteins. Currently, research on genetically engineered bacteria expressing metal-binding proteins is limited to constructing nonspecific metal-binding bacteria (capable of adsorbing a variety of metal ions), often requiring the addition of inducers when expressing metal-binding proteins, or exhibiting limited metal binding and adsorption capacities. The simultaneous adsorption of multiple heavy metal ions is detrimental to the recovery and utilization of adsorbed heavy metals; the addition of inducers not only increases economic costs, but some inducers (such as IPTG) are inherently toxic; and the limited metal-binding capacity leads to low metal removal or recovery efficiencies.

[0004] Arsenic and its compounds are common environmental pollutants. Arsenic and arsenic compounds in the environment can enter the human body through water, air, and food, causing harm. The discovery of promoters that specifically respond to environmental pollutants and proteins that specifically bind to them has opened up the possibility of engineering bacteria with specific adsorption properties for these pollutants. Building upon this foundation, the development of engineered bacteria that can specifically adsorb arsenic without the addition of specific inducers is of great significance. Summary of the Invention

[0005] The purpose of the present invention is to provide an engineered bacterium that specifically removes arsenic. Another purpose of the present invention is to provide a construction method and application of the strain.

[0006] To achieve the above objectives, the present invention utilizes genetic recombination technology to clone the gene for an arsenic-binding protein and a bacterial surface display vector protein gene downstream of an arsenic-inducible promoter, constructing an expression cassette capable of surface expression of the arsenic-binding protein regulated by arsenic. This expression cassette is then transferred into a host bacterium to create an engineered bacterium with specific arsenic adsorption. When arsenic is present in the environment, the engineered bacterium expresses the arsenic-binding protein and specifically adsorbs and removes arsenic without the need for additional inducers. Furthermore, a fluorescent protein gene is introduced into the arsenic-binding protein expression cassette, enabling monitoring of arsenic-binding protein expression through fluorescent signals.

[0007] The arsenic-binding protein expression cassette of the present invention comprises a fusion protein of a bacterial surface display carrier protein, a fluorescent protein, and an arsenic-binding protein. Each protein in the fusion protein needs to have a normal protein structure to function normally. However, the expression and folding of each protein in the fusion protein often have unpredictable interactions, thereby affecting the expression level and correct folding of one or more proteins in the fusion protein. When constructing a fusion protein and expression cassette comprising a bacterial surface display carrier protein, a fluorescent protein, and an arsenic-binding protein, the present invention found that selecting different combinations of promoters, arsenic-binding proteins, and bacterial surface display carrier proteins resulted in significant differences in the surface expression effects of the arsenic-binding protein obtained from the expression cassettes. After extensive screening and comparison, the present invention determined the expression cassette structure and sequence that can simultaneously ensure the large-scale and correct expression of the arsenic-binding protein on the bacterial surface.

[0008] Specifically, the present invention provides the following technical solutions:

[0009] The present invention first provides an engineered bacterium comprising a metal or non-metal binding protein expression cassette, wherein the expression cassette comprises a metal-inducible promoter or a non-metal-inducible promoter, a bacterial surface display carrier protein gene, a metal binding protein gene or a non-metal binding protein gene.

[0010] The metals are cadmium, zinc, lead, copper and nickel, and the non-metal is arsenic.

[0011] Furthermore, the present invention provides an engineered bacterium that specifically removes arsenic, which comprises an arsenic-binding protein expression cassette, wherein the expression cassette comprises an arsenic-inducible promoter, a bacterial surface display carrier protein gene, and an arsenic-binding protein gene.

[0012] The arsenic-binding protein mentioned above is preferably derived from the genome of Escherichia coli or the R factor R773 plasmid of Escherichia coli, the genome of Pseudomonas fluorescens MSP3, or the genome of Pseudomonas aeruginosa.

[0013] Preferably, the embodiments of the present application provide the arsenic-inducible promoters described above, namely, Pars1 in the embodiment (including the operator gene, i.e., the regulatory region sequence, the promoter sequence, and the regulatory gene, i.e., the gene sequence encoding the transcriptional repressor protein that can specifically bind to arsenic, a total of 492 bp), whose nucleotide sequence is shown in SEQ ID NO.1, and Pars2 (including the operator gene, i.e., the regulatory region sequence, the promoter sequence, and the regulatory gene, i.e., the gene sequence encoding the transcriptional repressor protein that can specifically bind to arsenic, a total of 451 bp), whose nucleotide sequence is shown in SEQ NO.2.

[0014] As an embodiment of the present invention, the nucleotide sequence of the arsenic-inducible promoter is shown as SEQ ID NO.1, and the nucleotide sequence of the arsenic-binding protein gene is shown as SEQ ID NO.3.

[0015] As another embodiment of the present invention, the nucleotide sequence of the promoter is shown as SEQ ID NO.1, and the nucleotide sequence of the arsenic-binding protein gene is shown as SEQ ID NO.4.

[0016] As a preferred embodiment of the present invention, the nucleotide sequence of the promoter is shown in SEQ ID NO. 2, and the nucleotide sequence of the arsenic-binding protein gene is shown in SEQ ID NO. 3. The engineered bacteria carrying this expression cassette have better surface expression and arsenic-binding activity of the arsenic-binding protein, and better arsenic adsorption activity under high arsenic concentration conditions (e.g., arsenic concentration ≥40 μmol / L or arsenic concentration ≥160 μmol / L).

[0017] The bacterial surface display carrier protein of the present invention is one selected from ice nucleation protein, Lpp-OmpA, and OmpC, preferably the N-terminal domain of ice nucleation protein (INP).

[0018] In order to facilitate monitoring of the expression of the arsenic-binding protein, the expression cassette of the present invention further comprises a fluorescent protein gene.

[0019] Preferably, the expression cassette comprises an arsenic-inducible promoter, a bacterial surface display carrier protein gene, a fluorescent protein gene and an arsenic-binding protein gene in sequence from 5' to 3' direction.

[0020] The expression cassette of the present invention preferably has a sequence as shown in any one of SEQ ID NOs. 5 to 7.

[0021] Among them, as shown in SEQ ID NO. 5, positions 1 to 492 are the arsenic-inducible promoter system sequence, positions 599 to 1171 are the ice nucleation protein N-terminal domain sequence, positions 1178 to 1885 are the fluorescent protein gene sequence, and positions 1892 to 2245 are the arsenic-binding protein sequence. As shown in SEQ ID NO. 6, positions 1 to 451 are the arsenic-inducible promoter system sequence, positions 560 to 1132 are the ice nucleation protein N-terminal domain sequence, positions 1139 to 1846 are the fluorescent protein gene sequence, and positions 1853 to 2206 are the arsenic-binding protein sequence. As shown in SEQ ID NO. 7, positions 1 to 492 are the arsenic-inducible promoter sequence, positions 599 to 1171 are the ice nucleation protein N-terminal domain sequence, positions 1178 to 1885 are the fluorescent protein gene sequence, and positions 1892 to 2245 are the arsenic-binding protein sequence.

[0022] The expression cassette of the present invention may further comprise a transcription terminator located downstream of the arsenic-binding protein gene, preferably rrnBT1T2.

[0023] The expression cassette described above can be inserted into the genome of the engineered bacteria, or inserted into a plasmid vector for independent replication and inheritance.

[0024] In view of the above expression cassette, the present invention screens host bacteria that are compatible with the expression cassette and can achieve efficient and correct expression of the arsenic-binding protein on the bacterial surface.

[0025] Preferably, the engineered bacteria of the present invention is Escherichia coli containing a vector carrying the expression cassette, and the Escherichia coli is preferably Escherichia coli BL21 strain.

[0026] The plasmid vector into which the above-mentioned expression cassette is inserted can be a pUC series vector, a pBR322 series vector or a pACYC series vector.

[0027] The present invention also provides a method for constructing the engineered bacteria that specifically removes arsenic: the method comprises introducing the expression cassette or a vector carrying the expression cassette into a host bacterium to obtain the bacteria.

[0028] The present invention provides a preparation containing the engineered bacteria.

[0029] The preparation of the present invention can be a liquid preparation or a solid preparation, and is prepared by adding the engineered bacteria to auxiliary materials permitted in the field of microbial preparations.

[0030] The present invention also provides the use of the engineered bacteria or the preparation in removing or recovering metal or non-metallic elements, or in treating metal or non-metallic element pollution in the environment. Preferably, the present invention provides the use of the engineered bacteria or the preparation in removing or recovering arsenic, or in treating arsenic pollution in the environment. The beneficial effect of the present invention is that the present invention constructs an expression cassette, vector and engineered bacteria for an arsenic-regulated arsenic-binding protein that can express arsenic-binding protein on the bacterial surface and has fluorescent properties by placing the fusion protein gene of the bacterial surface-displayed carrier protein-fluorescent protein-arsenic-binding protein downstream of an arsenic-inducible promoter. The engineered bacteria can not only efficiently express an arsenic-binding protein with arsenic-binding activity on its surface without the need for additional inducers, and has specific arsenic-binding properties, but also can monitor the expression of the arsenic-binding protein based on the fluorescent signal. The engineered bacteria for specifically removing arsenic provided by the present invention provide a new method and new idea for the treatment of arsenic pollutants in the environment, and have good application prospects. The engineered bacteria for specifically removing arsenic provided by the present invention provide a new method for the treatment of arsenic pollutants in the environment. At the same time, the engineered bacteria of the present invention provide a new idea, means and resource for constructing engineered bacteria with the function of removing specific metals using metal-specific inducible promoters and corresponding metal-specific regulatory proteins, which is of great significance in removing non-metal or metal pollution in the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 These are the growth and fluorescence intensity detection results of the induced bacteria and the non-induced bacteria in the method for constructing the As-GP vector in Example 1 of the present invention.

[0032] Figure 2 These are the growth and fluorescence intensity detection results of the induced bacteria and the non-induced bacteria in the As2-GP vector construction method in Example 1 of the present invention.

[0033] Figure 3 Schematic diagram of the structure of the As2-ICAR (A21) vector in Example 2 of the present invention.

[0034] Figure 4 Schematic diagram of the structure of the As1-ICAR (A11) vector in Example 3 of the present invention.

[0035] Figure 5 Schematic diagram of the structure of the As1-ICAR2 (A12) vector in Example 4 of the present invention.

[0036] Figure 6 This shows the growth conditions of different strains containing the As1-ICAR (A11) vector in Example 5 of the present invention.

[0037] Figure 7 The expression of fluorescent protein in different strains containing the As1-ICAR (A11) vector in Example 5 of the present invention is shown.

[0038] Figure 8 This is the growth status of different strains containing the As2-ICAR (A21) vector in Example 5 of the present invention.

[0039] Figure 9 This is the expression of fluorescent protein in different strains containing the As2-ICAR (A21) vector in Example 5 of the present invention.

[0040] Figure 10 This shows the growth conditions of different strains containing the As1-ICAR2 (A12) vector in Example 5 of the present invention.

[0041] Figure 11 The expression of fluorescent protein in different strains containing the As1-ICAR2 (A12) vector in Example 5 of the present invention is shown.

[0042] Figure 12 The results are a comparison of the arsenic removal effects of different engineered bacteria in Example 6 of the present invention.

[0043] above Figures 4 to 10 In the figure, A21-Top10 represents the Escherichia coli Top10 strain containing the As2-ICAR (A21) vector; A21-BL21 represents the Escherichia coli BL21 strain containing the As2-ICAR (A21) vector; A21-DH5α represents the Escherichia coli DH5α strain containing the As2-ICAR (A21) vector; the strains represented by other labels can be determined by referring to this naming method. DETAILED DESCRIPTION

[0044] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0045] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0046] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0047] Example 1 Construction of basic vector

[0048] 1. Construction of pUC-As vector

[0049] (1) Sequence design: A 662 bp DNA sequence was designed, which contained an arsenic-inducible promoter system (including an operator gene, i.e., a regulatory region sequence, a promoter sequence, and a regulatory gene, i.e., a gene sequence encoding a transcriptional repressor protein that can specifically bind to arsenic) (designed with reference to GenBank Accession No. X16045.1. The arsenic-inducible promoter from this source is named "Pars1" in the present invention, and its nucleotide sequence is shown in SEQ ID NO. 1; the transcriptional repressor protein that specifically binds to arsenic is named "ArsR1", and its nucleotide sequence is shown in SEQ ID NO. 3), a second regulatory region sequence, a ribosome binding site, and a multiple cloning enzyme cleavage site.

[0050] (2) Construction of the pUC-As vector: The 662 bp DNA fragment was synthesized by whole gene synthesis (Sangon Biotech (Shanghai) Co., Ltd.) and cloned into the pUC57 plasmid (Sangon Biotech (Shanghai) Co., Ltd.) between the Sac I and Hind III restriction sites to construct the pUC-As vector. The accuracy of the synthesized gene sequence and the cloned restriction sites were verified by sequencing.

[0051] 2. Construction of As-BTT vector

[0052] The purpose of this step is to add a transcription terminator to the pUC-As vector.

[0053] (1) Construction of As-BTT vector: Using pBV220 plasmid (a commercially available vector) as a template, PCR amplified a 472 bp rrnBT1T2 fragment (the fragment contains the transcription terminator required by the present invention). Premix ExTaq reagent (TaKaRa) was used, the amplification system was 25 μL, the upstream primer sequence was 5'-AACTGCAGAGCTTCTGTTTTGGCGGATG (PstI), and the downstream primer sequence was 5'-ATGCATGCCATGAGCGGATACATATTTGAATG (SphI). The rrnBT1T2 fragment was purified and recovered by agarose gel electrophoresis, and the fragment was cloned by TA ( 19-T vector, TaKaRa Company), the rrnBT1T2 fragment was obtained by double digestion of the T vector with PstI and SphI, and the rrnBT1T2 fragment was ligated with the pUC-As vector fragment constructed in step 1 after double digestion with PstI and SphI (T4 DNA ligase, TaKaRa Company, according to the instruction manual).

[0054] (2) Transformation and Identification: The ligation product from step (1) was used to transform E. coli DH5α, plated on LB agar plates containing ampicillin (50 μg / mL, the same below), and cultured overnight at 37°C. Single colonies were picked and placed in liquid LB containing ampicillin (5 mL) and cultured overnight at 37°C at 200-250 rpm. Plasmids were extracted from the overnight culture and sequenced to verify the accuracy of the sequence.

[0055] 3. Construction of As-GP vector

[0056] In order to test the arsenic-induced expression function of the constructed As-BTT vector, the fluorescent protein reporter gene was inserted into the As-BTT vector, and the expression of the fluorescent protein was observed by adding arsenic inducer. If the fluorescent protein is expressed normally, that is, the bacteria show fluorescent characteristics, it can be explained that the As-BTT vector has arsenic-induced expression characteristics, and the arsenic-induced expression system constructed based on Pars1 is correct.

[0057] (1) Preparation of linearized vector: The As-BTT vector obtained in step 2 was constructed by double digestion with NcoI and PstI, and the target band was recovered and purified by gel electrophoresis.

[0058] (2) Preparation of target DNA fragment: Using sfGFP plasmid (Shanghai Linyuan Biotechnology Co., Ltd.) as a template, a 717 bp sfGFP fragment was amplified. Pfu DNA polymerase (Suzhou Hongxun Biotechnology Co., Ltd.) was used. The upstream primer sequence was: 5'-TGTTGTGGATCCAAGAAGGAGATATACCATGGCAATGCGTAAAGGCGAAG-3' (NcoI), and the downstream primer sequence was: 5'-TCTCTCATCCGCCAAA ACAGAAGCTCTGCAGTCATTTGTACAGTTCATC-3' (PstI).

[0059] (3) Construction of As-GP vector: The recombination reaction system was prepared on ice with a total volume of 20 μL, containing 10 μL of the target DNA fragment and the linearized vector (volume ratio 1:1) and 10 μL of 2× recombinase reaction solution (Suzhou Hongxun Biotechnology Co., Ltd.). The reaction was incubated at 50°C for 60 minutes and then cooled on ice.

[0060] (4) Transformation and identification: 10 μL of the recombinant reaction solution was used to transform E. coli DH5α competent cells, spread onto LB agar plates containing ampicillin (50 μg / ml, the same below), and cultured overnight at 37°C. Single colonies were picked and placed in liquid LB containing ampicillin (final concentration of 50 μg / ml, volume 5 mL) and cultured overnight at 37°C at 200-250 rpm. Plasmids were extracted from the overnight culture and sequenced to verify the accuracy of the sequence.

[0061] (5) Expression of fluorescent protein: A monoclonal colony of E. coli DH5α containing the As-GP vector was picked and inoculated into LB liquid culture medium containing ampicillin. When the OD600 value was between 0.5 and 0.8 at 37°C, the bacterial solution was divided into two parts. An arsenic inducer solution with a final arsenic concentration of 30 μmol / L was added to one part of the bacterial solution (induced bacteria), and sterile deionized ultrapure water was added to replace the arsenic inducer solution to the other part of the bacterial solution (non-induced bacteria). The time of starting to add the arsenic inducer was 0 h. After culturing for 4 h after adding the inducer, the OD600 and fluorescence intensity values of the bacterial solution were detected respectively. The growth and fluorescence intensity detection results of each strain are shown in Figure 2. Figure 1 .Depend on Figure 1 The results show that the fluorescence intensity of the induced bacteria is much higher than that of the non-induced bacteria, indicating that the As-GP vector has arsenic-induced expression characteristics and the arsenic-induced promoter can function normally.

[0062] 4. Construction of As2-GP vector

[0063] The Escherichia coli genome contains an arsenic-inducible promoter different from the aforementioned sequence (the present invention names the arsenic-inducible promoter sequence derived from the E. coli DH5α genome "Pars2", and its nucleotide sequence is shown in SEQ ID NO.2, and the transcriptional repressor protein that specifically binds to arsenic is named "ArsR2", and its nucleotide sequence is shown in SEQ ID NO.4). A Pars2 fragment including an operator gene, i.e., a regulatory region sequence, a promoter sequence, and a regulatory gene, i.e., a gene sequence encoding a transcriptional repressor protein that can specifically bind to arsenic, was cloned from the E. coli DH5α genome. The Pars2 fragment was used to replace the arsenic-inducible promoter in the As-GP vector to form an As2-GP vector. The expression of the fluorescent protein was observed by adding an arsenic inducer. If the fluorescent protein is expressed normally, i.e., the bacteria exhibit fluorescent characteristics, it can be indicated that the Pars2 fragment has the function of arsenic-induced expression. It should be noted that the Pars2 fragment does not contain the second regulatory region sequence.

[0064] (1) Extraction of E. coli DH5α genome: 1.5 ml of overnight cultured E. coli DH5α bacterial solution was taken and the E. coli DH5α genome was extracted using a bacterial genomic DNA extraction kit (spin column method) (Beijing Puboxin Biotechnology Co., Ltd.). For specific procedures, please refer to the instruction manual of Beijing Puboxin Biotechnology Co., Ltd.

[0065] (2) Construction of As2-GP vector: The Pars2 fragment (including the operator gene, i.e., the regulatory region sequence, the promoter sequence, and the regulatory gene, i.e., the gene sequence encoding the transcriptional repressor protein that can specifically bind to arsenic) was amplified by PCR using the extracted DH5α genome as a template. The arsenic-induced promoter sequence derived from the E. coli DH5α genome was named "Pars2" and the transcriptional repressor protein that specifically binds to arsenic was named "ArsR2" in the present invention. The PCR reaction premix kit Premix Taq TM (ExTaq TM Version 2.0), the upstream primer sequence is: 5'-AGGAATTCCCGCGGTTACCTTCCTCT GCACTTACAC-3'(EcoRI), the downstream primer sequence is 5'-CGACGGATCCTTA ACTGCAAATGTTCTTACTGTCCCC-3'(BamHI). The PCR target fragment was recovered and purified by agarose gel electrophoresis, and the fragment was cloned by TA ( 19-T vector, TaKaRa), double-digest the T vector with EcoRI and BamHI to obtain the Pars2 fragment, and ligate the fragment into the EcoRI and -BamHI sites in the As-GP constructed in step 3 (cut the As-GP vector with EcoRI and -BamHI, and recover the large fragment for ligation). Use T4 DNA ligase (TaKaRa) as the ligase, and perform the operation according to the instruction manual.

[0066] (3) Transformation and identification: The ligation solution was used to transform E. coli TOP10 competent cells, spread onto LB agar plates containing ampicillin (50 μg / ml, the same below), and cultured overnight at 37°C. Single colonies were picked and placed in liquid LB containing ampicillin (final concentration of 50 μg / ml, volume 5 mL) and cultured overnight at 37°C at 200-250 rpm. Plasmids were extracted from the overnight culture and the sequence accuracy was verified by sequencing.

[0067] (4) Expression of fluorescent protein: Pick a single clone colony and inoculate it into LB liquid culture medium containing ampicillin. When the OD600 value is between 0.5 and 0.8 at 37°C, divide the bacterial solution into two parts. Add an arsenic inducer solution with a final arsenic concentration of 30 μmol / L to one part of the bacterial solution (induced bacteria), and add sterile deionized ultrapure water instead of the arsenic inducer solution to the other part of the bacterial solution (non-induced bacteria). The time of starting to add the arsenic inducer is 0h. After 4h of incubation with the inducer, the OD600 and fluorescence intensity values of the bacterial solution are detected respectively. The growth and fluorescence intensity test results of each strain are shown in Figure 2. Figure 2 .Depend on Figure 2The results showed that the fluorescence intensity of the induced bacteria was much higher than that of the non-induced bacteria, indicating that the As2-GP vector has arsenic-induced expression characteristics and the arsenic-induced promoter can function normally.

[0068] Example 2 Construction of Arsenic Binding Protein Expression Vector As2-ICAR (A21)

[0069] The purpose of constructing the As2-ICAR (A21) vector in this example is to obtain an expression vector in which the expression of the arsenic-specific binding protein ArsR1 is controlled by the Pars2 arsenic-inducible promoter. This expression vector was obtained by replacing the ribosome binding site sequence - sfGFP sequence in the As2-GP vector with a designed and synthesized ICAR sequence fragment. The designed and synthesized ICAR sequence includes the regulatory region sequence of the arsenic-inducible promoter Pars2, the ribosome binding site sequence, the N-terminal domain sequence of the ice nucleation protein inaK gene, the red fluorescent protein mCherry sequence, and the arsenic binding protein ArsR1 sequence. The regulatory region sequence of the arsenic-inducible promoter Pars2 added to the ICAR sequence serves as the second regulatory region sequence of Pars2 in the As2-ICAR vector.

[0070] The As2-GP vector prepared in Example 1 contains an arsenic-inducible promoter system and a fluorescent protein sfGFP. In this example, the fluorescent protein sfGFP sequence was removed during the construction of A21, and an ICAR sequence fragment was inserted. The front end of the ICAR sequence fragment includes a regulatory region sequence of an arsenic-inducible promoter (Pars2), i.e., a repression site. Adding this regulatory region sequence can better control the background expression of the arsenic-inducible promoter.

[0071] A 1761 bp ICAR sequence fragment designed by the whole gene synthesis was independently designed (Suzhou Hongxun Biotechnology Co., Ltd.), which included the regulatory region sequence of the arsenic-inducible promoter Pars2, the ribosome binding site sequence, the N-terminal domain sequence of the ice nucleation protein inaK gene, the red fluorescent protein mCherry sequence, and the arsenic binding protein ArsR1 sequence. The ICAR fragment was then cloned between the BamHI and PstI restriction sites of the As2-GP vector to construct the As2-ICAR vector ( Figure 3 ).

[0072] The accuracy of the synthesized gene sequence and the cloned restriction enzyme sites were verified by sequencing. The nucleotide sequence of the arsenic-inducible promoter of vector A21 (As2-ICAR vector) is shown in SEQ ID NO. 2, and the nucleotide sequence of the arsenic-binding protein gene is shown in SEQ ID NO. 3. The nucleotide sequence of the expression cassette is shown in SEQ ID NO. 6, which contains the arsenic-inducible promoter (1-451 bp), the N-terminal domain sequence of the ice nucleation protein (560-1132 bp), the fluorescent protein gene (1139-1846 bp), the arsenic-binding protein gene (1853-2206 bp), and rrBT1T2 (2213-2684 bp).

[0073] Example 3 Construction of Arsenic Binding Protein Expression Vector As1-ICAR (A11)

[0074] The purpose of constructing the As1-ICAR (A11) vector in this example is to obtain an expression vector in which the expression of the arsenic-specific binding protein ArsR1 is controlled by the Pars1 arsenic-inducible promoter. This vector is obtained by replacing the arsenic-inducible promoter expression system in the As2-ICAR (A21) vector with the Pars1 fragment containing the complete arsenic-inducible promoter expression system obtained from the As1-GP vector. The Pars1 fragment contains the corresponding operator gene, i.e., the regulatory region sequence; the promoter sequence; the regulatory gene, i.e., the gene sequence encoding the transcriptional repressor protein that specifically binds to arsenic; and the second regulatory region sequence.

[0075] The As1-GP vector was double-digested with SacII and NcoI to obtain the Pars1 fragment (602 bp) containing the complete arsenic-induced promoter expression system. The As2-ICAR vector was double-digested with SacII and NcoI to obtain a large fragment (4786 bp) containing the ICAR fragment. The Pars1 fragment was ligated with the large fragment (4786 bp) containing the ICAR fragment to construct the As1-ICAR vector ( Figure 4 ). The accuracy of the sequence was verified by sequencing. The nucleotide sequence of the arsenic-inducible promoter of vector A11 (As1-ICAR) is shown in SEQ ID NO.1, and the nucleotide sequence of the arsenic-binding protein gene is shown in SEQ ID NO.3; the nucleotide sequence of the expression cassette is shown in SEQ ID NO.5, which contains an arsenic-inducible promoter system (1-492 bp), an ice nucleation protein N-terminal domain sequence (599-1171 bp), a fluorescent protein gene (1178-1885 bp), an arsenic-binding protein gene (1892-2245 bp), and rrBT1T2 (2252-2723 bp).

[0076] Example 4 Construction of Arsenic Binding Protein Expression Vector As1-ICAR2 (A12)

[0077] The purpose of constructing the As1-ICAR2(A12) vector in this example is to obtain an expression vector in which the expression of the arsenic-specific binding protein ArsR2 is controlled by the Pars1 arsenic-inducible promoter, which is obtained by replacing the ArsR1 gene fragment induced by arsenic in the As1-ICAR(A11) vector with the ArsR2 gene fragment.

[0078] (1) Preparation of linearized vector: The As1-ICAR vector was double-digested with SalI and PstI, and the target band was recovered and purified by gel electrophoresis.

[0079] (2) Preparation of target DNA fragment: The arsenic binding protein ArsR2 gene fragment was amplified by PCR using the As2-GP vector as a template. Pfu DNA polymerase (Suzhou Hongxun Biotechnology Co., Ltd.) was used. The upstream primer sequence was: 5'-CGGCATGGACGAGCTGTACAAGGTCGACATGTCATTTCTGTTACCCATCCA ATTG-3' (SalI), and the downstream primer sequence was: 5'-CTCTCATCCGCC AAAACAGAAGCTCTGCAGTTAACTGCAAATGTTCTTACTGTCCCCGGAAC-3' (PstI).

[0080] (3) Construction of As1-ICAR2 vector: The recombination reaction system was prepared on ice with a total volume of 20 μL, containing 10 μL of the target DNA fragment and the linearized vector (volume ratio 1:1) and 10 μL of 2× recombinase reaction solution (Suzhou Hongxun Biotechnology Co., Ltd.). The reaction was incubated at 50°C for 60 minutes and then cooled on ice.

[0081] (4) Transformation and identification: 10 μL of the recombination reaction solution was used to transform E. coli TOP10 competent cells, spread on LB agar plates containing ampicillin (50 μg / ml, the same below), and cultured at 37°C overnight. Single clones were picked and placed in liquid LB containing ampicillin (final concentration of ampicillin 50 μg / ml, volume 5 mL), and cultured at 37°C at 200-250 rpm overnight. The overnight culture solution was used to extract the plasmid and obtain the As1-ICAR2 vector ( Figure 5) sequencing to verify the accuracy of the sequence. The nucleotide sequence of the arsenic-inducible promoter expression system of vector A12 (As1-ICAR2) is shown in SEQ ID NO. 1, and the nucleotide sequence of the arsenic-binding protein gene is shown in SEQ ID NO. 4. The nucleotide sequence of the expression cassette is shown in SEQ ID NO. 7, which contains the arsenic-inducible promoter system (1-492 bp), the N-terminal domain sequence of the ice nucleation protein (599-1171 bp), the fluorescent protein gene (1178-1885 bp), the arsenic-binding protein gene (1892-2245 bp), and rrBT1T2 (2252-2723 bp).

[0082] Example 5 Construction of engineered bacteria specifically for arsenic removal and detection of fusion protein expression

[0083] The A11 vector, A21 vector, and A12 vector constructed in the above examples were respectively transformed into competent cells of E. coli Top10, E. coli DH5α, and E. coli BL21. The transformed competent cells were spread on LB agar medium containing ampicillin, and the plate was placed at room temperature until the liquid was absorbed. Invert the plate and culture at 37°C. Colonies will appear after 12 to 16 hours. Pick out the single clone colonies and culture them in liquid LB medium containing ampicillin at 37°C with shaking (200 rpm) overnight. The next morning, inoculate them into new liquid LB medium containing ampicillin at a ratio of 2% and culture at 37°C with shaking until the OD 600 When the OD value of each bacterial solution reaches 0.5-0.8, the bacterial solution is divided into two parts. One part of the bacterial solution (induced bacteria) is added with an arsenic inducer solution with a final arsenic concentration of 150 μmol / L, and the other part of the bacterial solution (non-induced bacteria) is added with sterile deionized ultrapure water instead of the arsenic inducer solution. The time of starting to add the arsenic inducer is 0h. At 6h after adding the inducer, the OD value of the bacterial solution is detected. 600 and fluorescence intensity values. The growth and fluorescence intensity test results of each strain are shown as follows: Figure 6 、 Figure 7 、 Figure 8 、 Figure 9 、 Figure 10 and Figure 11 shown.

[0084] By comparing the OD values of genetically engineered bacteria constructed by transforming A11 vector, A21 vector and A12 vector respectively into three host bacteria, E.coli Top10, E.coli DH5α and E.coli BL21 under arsenic induction conditions, the results showed that the OD values of genetically engineered bacteria constructed by transforming A11 vector, A21 vector and A12 vector respectively were significantly different from those constructed by transforming A11 vector and A21 vector respectively. 600 The values (which indicate the growth status) and fluorescence intensity values showed that when the engineered bacteria were induced with 150 μM arsenic, the OD values of E. coli Top10 and E. coli DH5α strains containing A11 vector, A21 vector and A12 vector were significantly higher than those of non-induced bacteria.600 The values all showed a significant downward trend, but the growth curves of the E. coli BL21 strains with the three vectors were similar to those of the uninduced strains. Furthermore, the fluorescence intensities of the E. coli BL21-induced strains with the three vectors were higher than those of the E. coli Top10 and E. coli DH5α-induced strains with the three vectors. Therefore, the E. coli BL21 strain is more suitable as a host strain than the E. coli DH5α and E. coli TOP10 strains. In subsequent experiments, the E. coli BL21 strain was selected as the host strain for constructing genetically engineered bacteria that specifically remove arsenic.

[0085] Compared with their corresponding non-induced strains, the genetically engineered bacteria constructed by transforming A11, A21 and A12 vectors into E. coli Top10, E. coli DH5α and E. coli BL21 respectively showed significantly improved fluorescence characteristics, indicating that the constructed fusion proteins can be normally expressed and exert normal fluorescence characteristics in these three strains. In addition, the fluorescence intensity values of the induced strains can also be seen that the OD of the BL21 strain carrying the A21 vector is significantly higher than that of the induced strain. 600 The fluorescence intensity value of the BL21 strain carrying the A21 vector is lower than that of the BL21 strain carrying the A12 vector, but the fluorescence intensity value of the BL21 strain carrying the A21 vector is higher, indicating that the fluorescence characteristics of the fusion protein expressed by the BL21 strain carrying the A21 vector are significantly higher than those of the fusion protein expressed by the A12 vector.

[0086] Example 6 Detection of the ability of engineered bacteria to remove arsenic

[0087] Single clones of E. coli BL21 containing A11 vector (A11-BL21), E. coli BL21 containing A21 vector (A21-BL21), and E. coli BL21 containing A12 vector (A12-BL21) were picked, cultured overnight, and inoculated into LB medium containing ampicillin at a ratio of 2%. The OD of the engineered bacteria was 0.05. 600 When the argon concentration is approximately 0.6-1.0, the cells are centrifuged and retained. The cells are then resuspended in arsenic-containing solutions of varying concentrations (10, 40, and 160 μmol / L) and cultured at 30°C for 1 hour. The cells are then centrifuged and the arsenic content of the supernatant is determined. If the arsenic content in the supernatant is lower than the arsenic content in the solution before culture, this demonstrates that the engineered bacteria are capable of adsorbing and removing arsenic (using empty BL21 cells without a plasmid and BL21 cells containing the pUC57 plasmid as controls). The arsenic removal efficiency is measured by the amount of arsenic adsorbed per gram of dry cell. The arsenic content in the supernatant is determined using inductively coupled plasma mass spectrometry (ICP-MS).

[0088] The results are as follows Figure 12As shown, the results showed that compared with the control bacteria (BL21 empty bacteria without plasmid and BL21 bacteria containing pUC57 plasmid), the arsenic removal effects of A11-BL21 and A21-BL21 were higher than those of the control bacteria in the three concentration groups (P<0.05), and the arsenic removal effects of A12-BL21 bacteria in the 10 and 40 μmol / L concentration groups were higher than those of the two control bacteria (P<0.05), but there was no statistical difference in the 160 μmol / L concentration group with the two control bacteria.

[0089] Comparison of the arsenic removal efficiencies of A11-BL21, A21-BL21, and A12-BL21 revealed that, except for the 10 μmol / L concentration group, A21-BL21 showed no statistically significant difference in arsenic removal compared to A11-BL21. However, the 40 and 160 μmol / L concentration groups all showed higher arsenic removal efficiencies than A11-BL21 (P < 0.05). Furthermore, A21-BL21 exhibited higher arsenic removal efficiencies than A12-BL21 at all three concentration groups (P < 0.05). These results indicate that A21-BL21 significantly outperforms A11-BL21 and A12-BL21 in arsenic removal by adsorption.

[0090] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. An engineered bacterium capable of specifically removing arsenic, characterized in that: The engineered bacteria is an Escherichia coli BL21 strain containing a vector carrying an arsenic-binding protein expression cassette; The vector is a pUC57 plasmid; The expression cassette includes an arsenic-inducible promoter, a bacterial surface display carrier protein gene, a fluorescent protein gene and an arsenic-binding protein gene in sequence from the 5' to the 3' direction; The sequence of the expression cassette is shown in SEQ ID NO.

6.

2. Use of the engineered bacteria according to claim 1 in removing or recovering arsenic, or in treating arsenic pollution in the environment.

Images