A VIGS silencing vector for the jujube ZjCLA gene and its application

Abstract

The present application relates to the field of plant genetic engineering, in particular to a VIGS silencing vector of a jujube ZjCLA gene and application thereof. The present application provides application of a specific fragment in construction of a VIGS silencing vector of a jujube ZjCLA gene, wherein the specific fragment comprises a nucleotide sequence as shown in SEQ ID NO. 1, and the jujube ZjCLA gene comprises a gene with a sequence number of XM_048477782.1. The VIGS silencing vector constructed by using the specific fragment provided by the present application can successfully infect jujube seedlings, induce endogenous ZjCLA of the jujube to be silenced, effectively reduce the expression level of the jujube ZjCLA gene, obtain a virus-induced gene silencing trait, and verify the function of the jujube ZjCLA gene, which has application value in functional gene research of the jujube. In addition, the present application also establishes an efficient VIGS system of the jujube, which provides technical support for jujube functional genomics research.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, in particular to a VIGS silencing vector of the jujube ZjCLA gene and application thereof. Background Art

[0002] Virus-induced gene silencing (VIGS) involves inserting a target gene fragment into the viral genome. Upon infection of plant tissue, expression of the endogenous target gene homologous to the inserted fragment is suppressed, resulting in the loss of the corresponding trait. This allows for rapid verification of target gene function. The VIGS system offers numerous advantages, including ease of use, short cycle times, and the ability to avoid plant transformation. It has become an important reverse genetics tool, widely used in plant gene function studies.

[0003] Jujube, a plant of the genus Ziziphus in the family Rhamnaceae, is native to China. Its drought and infertility tolerance have yielded multiple economic, ecological, and social benefits. In recent years, molecular biology and genetic engineering research on key economic traits in jujube has deepened, leading to the identification of an increasing number of functional genes. As a perennial woody plant, there have been reports of transgenic plants being generated by transferring exogenous genes into organs such as stem tips, leaves, and hypocotyls via Agrobacterium tumefaciens. However, due to time-consuming, low-efficiency, and technical instability, this method has not been widely adopted. This makes it difficult to verify the functional genes of jujube itself, and there is an urgent need to establish a rapid and efficient system for verifying gene function. Summary of the Invention

[0004] To address these issues, the present invention provides a VIGS silencing vector for the jujube ZjCLA gene and its application. The VIGS silencing vector, constructed using the specific fragment provided by the present invention, can successfully infect jujube seedlings, establishing a highly efficient VIGS system for jujube, and providing technical support for jujube functional genomics research.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an application of a specific fragment in constructing a VIGS silencing vector of the jujube ZjCLA gene. The specific fragment comprises a nucleotide sequence as shown in SEQ ID NO.1, and the jujube ZjCLA gene comprises a gene with a sequence number of XM_048477782.1.

[0007] The application provides a VIGS silencing vector of a jujube ZjCLA gene, wherein the VIGS silencing vector comprises a specific fragment and a pTRV2 vector; the specific fragment comprises a nucleotide sequence as shown in SEQ ID NO. 1.

[0008] Preferably, the specific fragment is located between two enzyme cutting sites of EcoR I and Xho I of the pTRV2.

[0009] The application provides a primer pair for amplifying the specific fragment, wherein the specific fragment comprises a nucleotide sequence as shown in SEQ ID NO. 1, and the primer pair comprises an upstream primer CLA-EcoRI-F and a downstream primer CLA-XhoI-R.

[0010] The nucleotide sequence of the upstream primer CLA-EcoRI-F is shown in SEQ ID NO. 2.

[0011] The nucleotide sequence of the downstream primer CLA-XhoI-R is shown in SEQ ID NO. 3.

[0012] The application provides a VIGS silencing system of a jujube ZjCLA gene, wherein the VIGS silencing system comprises: agrobacterium bacterial liquid containing a pTRV1 vector and agrobacterium bacterial liquid containing a VIGS silencing vector; the VIGS silencing vector comprises the VIGS silencing vector in the above technical solution.

[0013] The volume ratio of the agrobacterium bacterial liquid containing the pTRV1 vector and the agrobacterium bacterial liquid containing the VIGS silencing vector is 1:1.

[0014] The OD values of the agrobacterium bacterial liquid containing the pTRV1 vector and the agrobacterium bacterial liquid containing the VIGS silencing vector are respectively 1.0-1.5.

[0015] The application provides application of the VIGS silencing vector in the above technical solution or the VIGS silencing system in the above technical solution in silencing a jujube ZjCLA gene, wherein the jujube ZjCLA gene comprises a gene with a sequence number of XM_048477782.1.

[0016] The application provides a method for silencing a jujube ZjCLA gene, comprising the following steps:

[0017] The VIGS silencing system in the above technical solution is injected into the leaf back of a jujube seedling to obtain an infected jujube seedling.

[0018] Preferably, the jujube seedling comprises a seedling with completely unfolded cotyledons.

[0019] Preferably, obtaining the infected jujube seedlings further comprises treating the infected jujube seedlings in a 24℃ incubation room in darkness for 24h.

[0020] The application provides application of the VIGS silencing vector or the VIGS silencing system in identifying functions of a jujube ZjCLA gene.

[0021] Beneficial effects:

[0022] The application provides application of the specific fragment in constructing a VIGS silencing vector of a jujube ZjCLA gene, the specific fragment comprising a nucleotide sequence as shown in SEQ ID NO. 1, and the jujube ZjCLA gene comprising a gene with a sequence number of XM_048477782.1. The VIGS silencing vector constructed by using the specific fragment provided by the application can successfully infect jujube seedlings, induce silencing of endogenous ZjCLA in jujubes, effectively reduce the expression level of the jujube ZjCLA gene, obtain a virus-induced gene silencing trait, and verify the function of the jujube ZjCLA gene, which has application value in functional gene research of jujubes.

[0023] In addition, the application further establishes an efficient VIGS system of jujubes, and provides technical support for jujube functional genomics research. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0025] Figure 1 It is a PCR amplification diagram of the CLA specific fragment for VIGS silencing, and each lane represents a CLA specific fragment amplified at different annealing temperatures, wherein the annealing temperatures from left to right are 65℃, 64.5℃, 63.9℃, 62.8℃, 61.6℃, 60.5℃, 59.8℃, 58.4℃, 57.1℃, 55.8℃, 55.4℃, and 55℃.

[0026] Figure 2 It is a leaf whitening symptom of the seedling of Ziziphus jujuba Mill. after being infected by the silencing vector;

[0027] Figure 3 It is a real-time fluorescent quantitative PCR (qRT-PCR) detection of the expression of the jujube ZjCLA. DETAILED DESCRIPTION

[0028] The application provides application of a specific fragment in construction of a VIGS silencing vector of a jujube ZjCLA gene, and the specific fragment comprises a nucleotide sequence as shown in SEQ ID NO. 1, and specifically as follows: GAGCAGATCTATTGGGCTTAGCTCGATTCAAGTTTAATCAGGTCAGGAAAAGGCCATGTGGGGTTTTTGCATCACTTTCAGAGATGGGGGAGTATCATTCACAGAGACCACCAACTCCTCTCTTGGATACCATAAACTATCCAATTCACATGAAAAATCTATCTGTCAAGGAGCTTAAACAGCTATCGGATGAACTAAGGTCTGATGTCAT.

[0029] The jujube ZjCLA gene comprises a gene with a sequence number of XM_048477782.1.

[0030] The ZjCLA gene VIGS silencing vector is constructed by taking the ZjCLA gene specific fragment as a target fragment, can induce silencing of endogenous ZjCLA of jujube, effectively reduces the expression level of the jujube ZjCLA gene, obtains a virus-induced gene silencing trait, can verify the function of the jujube ZjCLA gene, and has application value in functional gene research of jujube.

[0031] The application further provides a VIGS silencing vector of a jujube ZjCLA gene, wherein the VIGS silencing vector comprises a specific fragment and a pTRV2 vector; and the specific fragment comprises a nucleotide sequence as shown in SEQ ID NO. 1.

[0032] In the application, the specific fragment is preferably located between two enzyme cutting sites of EcoR I and Xho I of the pTRV2.

[0033] The application further provides a primer pair for amplifying the specific fragment, wherein the specific fragment comprises a nucleotide sequence as shown in SEQ ID NO. 1, and the primer pair comprises an upstream primer CLA-EcoRI-F and a downstream primer CLA-XhoI-R.

[0034] The nucleotide sequence of the upstream primer CLA-EcoRI-F is shown in SEQ ID NO. 2, and specifically is as follows: TGTGAGTAAGGTTACCGAATTCGAGCAGATCTATTGGGCTTAGC.

[0035] The nucleotide sequence of the downstream primer CLA-XhoI-R is shown in SEQ ID NO. 3, specifically: GGGACATGCCCGGGCCTCGAGATGACATCAGACCTTAGTTCATCC.

[0036] The primer pair provided by the present invention can specifically amplify the specific fragment, and the two ends of the amplified specific fragment contain two restriction enzyme sites, EcoR I and Xho I.

[0037] The present invention also provides a VIGS silencing system for the jujube ZjCLA gene, the VIGS silencing system comprising: an Agrobacterium liquid containing a pTRV1 vector and an Agrobacterium liquid containing a VIGS silencing vector; the VIGS silencing vector comprises the VIGS silencing vector described in the above scheme;

[0038] The volume ratio of the Agrobacterium solution containing the pTRV1 vector and the Agrobacterium solution containing the VIGS silencing vector is 1:1;

[0039] The OD values ​​of the Agrobacterium culture solution containing the pTRV1 vector and the Agrobacterium culture solution containing the VIGS silencing vector are 1.0 to 1.5 respectively.

[0040] In the present invention, the Agrobacterium preferably includes Agrobacterium GV3101.

[0041] In the present invention, the OD value of the Agrobacterium culture containing the pTRV1 vector is 1.0-1.5, preferably 1.3-1.5, more preferably 1.5; the OD value of the Agrobacterium culture containing the VIGS silencing vector is 1.0-1.5, preferably 1.3-1.5, more preferably 1.5.

[0042] The present invention compounded an Agrobacterium liquid containing a pTRV1 vector and an Agrobacterium liquid containing a VIGS silencing vector at appropriate concentrations and volume ratios to obtain a VIGS silencing system, which can successfully infect jujube seedlings, effectively reduce the expression level of the jujube ZjCLA gene, and realize simple, efficient, and low-cost identification of the jujube ZjCLA gene function.

[0043] In the present invention, the preparation method of the VIGS silencing system preferably includes: adjusting the Agrobacterium culture solution containing the pTRV1 vector and the Agrobacterium culture solution containing the VIGS silencing vector to OD values ​​of 1.0 to 1.5, respectively, and standing at room temperature for 2 to 3 hours. After standing at room temperature, the Agrobacterium culture solution containing the pTRV1 vector and the Agrobacterium culture solution containing the VIGS silencing vector are mixed in equal volumes to obtain the VIGS silencing system. In the present invention, the room temperature is preferably 20 to 25°C, more preferably 23 to 25°C, and more preferably 24°C.

[0044] In the present application, the standing time is preferably 2-3h, further preferably 2.5-3h, and more preferably 3h. The present application can improve the activity of the bacterial solution by standing for an appropriate time, thereby improving the infection effect.

[0045] The present application also provides the VIGS silencing vector or the VIGS silencing system in the above technical solution for silencing the jujube ZjCLA gene, wherein the jujube ZjCLA gene comprises a gene with the sequence number of XM_048477782.1.

[0046] The present application also provides a method for silencing the jujube ZjCLA gene, comprising the following steps:

[0047] The VIGS silencing system in the above technical solution is injected into the leaf back of the jujube seedling to obtain the infected jujube seedling.

[0048] In the present application, the jujube seedling preferably comprises a cotyledon fully expanded seedling, and more preferably an acid jujube seedling with fully expanded cotyledons. The cotyledon fully expanded seedling in the present application is preferably a seedling that is cultured for 7-10d after the seed germination is 1cm.

[0049] In the present application, after the infected jujube seedling is obtained, the infected jujube seedling is preferably dark-treated in a 24℃ culture room for 24h, which can best complete the infection and make the transformation efficiency reach the highest.

[0050] In the present application, the pTRV2 virus silencing expression vector plasmid containing the ZjCLA gene specific fragment is transformed into the agrobacterium, and after the bacterial solution activity reaches the highest after standing at room temperature for 2-3h, the agrobacterium bacterial solution containing pTRV1 and the agrobacterium bacterial solution containing pTRV2-ZjCLA are mixed in equal volume, the needle injection method is used to infect the acid jujube seedling leaf by using the silencing system, the endogenous ZjCLA of the acid jujube is induced to be silenced, the expression level of the jujube ZjCLA gene is effectively reduced, the virus-induced gene silencing trait is obtained, the function of the jujube ZjCLA gene can be verified, and the jujube ZjCLA gene has application value in the functional gene research of jujube.

[0051] The present application also provides the VIGS silencing vector or the VIGS silencing system in the above technical solution for silencing the jujube ZjCLA gene, wherein the jujube ZjCLA gene comprises a gene with the sequence number of XM_048477782.1.

[0052] In order to further illustrate the present application, the VIGS silencing vector of the jujube ZjCLA gene and the application thereof provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the protection scope of the present application.

[0053] Embodiment 1

[0054] A VIGS silencing vector of a jujube ZjCLA gene is constructed by the following method:

[0055] RNA of leaf tissue of Ziziphus jujuba Mill. is extracted by using a plant tissue RNA rapid extraction kit (DP452) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and jujube cDNA is obtained by reverse transcription by using a one-step genomic cDNA first strand synthesis premix kit (KR118) of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0056] The above cDNA is used as a template to perform PCR amplification by using an upstream primer CLA-EcoRI-F and a downstream primer CLA-XhoI-R, 2×Taq PCR premix reagent II (KT211) of Tiangen Biochemical Technology (Beijing) Co., Ltd. is used, and a jujube ZjCLA specific fragment gene is obtained by purification, as shown in Figure 1 The nucleotide sequence of the upstream primer CLA-EcoRI-F is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer CLA-XhoI-R is shown in SEQ ID NO. 3.

[0057] The reaction system of the PCR amplification is as follows: cDNA 1 μL, CLA-EcoRI-F 1 μL, CLA-XhoI-R 1 μL, 2×Taq PCR Master Mix II 12.5 μL, and ddH2O 9.5 μL.

[0058] The reaction process of the PCR amplification is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing for 30 s, 72℃ extension for 30 s, a total of 40 cycles; 72℃ reaction for 10 min; and the annealing temperatures are 65℃, 64.5℃, 63.9℃, 62.8℃, 61.6℃, 60.5℃, 59.8℃, 58.4℃, 57.1℃, 55.8℃, 55.4℃, and 55℃, respectively.

[0059] It can be known from Figure 1 that the ZjCLA specific band can be amplified in the above temperature range.

[0060] The pTRV2 was simultaneously double-digested by restriction endonuclease EcoR I and Xho I produced by Thermo Company, and the enzyme digestion system was 50 μL, including 20 μL water, 20 μL plasmid, 2 μL restriction endonuclease EcoR I, 2 μL restriction endonuclease Xho I and 6 μL 10×FastDigest Green Buffer, the enzyme digestion temperature was 37℃, and the enzyme digestion time was 30 min, and the reaction product was subjected to agarose gel treatment after enzyme digestion, and the gel was recovered by using the general agarose gel DNA recovery kit produced by TIANGEN Company, and the method was referred to the kit instruction;

[0061] The pEASY seamless cloning kit produced by Quan Shi Jin Company was used to connect the above-mentioned ZjCLA specific fragment to the digested pTRV2, the reaction system was 10 μL, the ligation temperature was 50℃, the ligation time was 15 min, the method was referred to the kit instruction, and the ligation product was obtained.

[0062] 5 μL of the ligation product was transferred into the E. coli DH5ɑ produced by TIANGEN Company, and was cultured in the solid LB culture medium added with kanamycin (Kan) for 24 h, and a positive single colony was picked, and after the positive clone was identified by PCR, glycerol was added to preserve the bacterial liquid, and the sequencing verification was performed by Tianjin Qikexin Biotechnology Co., Ltd., and the ligation product obtained after the verification was correct was the successfully connected VIGS silencing vector pTRV2-ZjCLA.

[0063] Example 2

[0064] A VIGS silencing system of jujube ZjCLA gene, the VIGS silencing system is composed of the following components: agrobacterium liquid 1 containing pTRV1 vector and agrobacterium liquid 2 containing the VIGS silencing vector prepared in example 1;

[0065] The volume ratio of the agrobacterium liquid 1 and the agrobacterium liquid 2 is 1:1;

[0066] The OD value of the agrobacterium liquid 1 and the agrobacterium liquid 2 is 1.5.

[0067] The VIGS silencing system is prepared by the following method:

[0068] The pTRV1 plasmid and the pTRV2-ZjCLA prepared in example 1 were respectively transferred into GV3101 competent cells by freeze-thaw method, and the positive agrobacterium colonies after transformation were respectively picked and verified by PCR, and after the verification was correct, the agrobacterium strains pTRV1 and the agrobacterium strains pTRV2-ZjCLA were obtained;

[0069] Before VIGS infection for 3 days, the Agrobacterium strains pTRV1 and pTRV2-ZjCLA were streaked on LB solid medium containing 50 mg / L kanamycin (Kan, Sigma) and 50 mg / L rifampicin (Rif, Sigma) (kan and Rif), and cultured at 28°C for 2 days, and then single colonies of pTRV1 and pTRV2-ZjCLA were picked into 2 mL LB liquid medium for small shaking, and cultured at 28°C overnight;

[0070] The small amount of shaken Agrobacterium pTRV1 and pTRV2-ZjCLA were inoculated into 100 mL of LB liquid medium containing 100 μL of rifampicin (50 mg / ml), 50 μL of kanamycin (100 mg / mL), 5 mL of MES (pH 5.7, 0.2M) and 20 μL of acetosyringone (concentration of 0.1M) and cultured at 28°C overnight;

[0071] The next morning, the shaken pTRV1 and pTRV2-ZjCLA were poured into 50 mL centrifuge tubes, centrifuged at 6000 rpm for 10 min at room temperature, the supernatant was discarded, and the bacterial suspension was suspended with the infection buffer (preparation method: 1 mL of MgCl2 (1M), 5 mL of MES (pH 5.7, 0.2M), 200 μL of acetosyringone (0.1M), and 100 mL of water), and the OD 600 was adjusted to 1.5, vortexed, and then incubated at room temperature for 3 h to obtain the pTRV1 Agrobacterium resuspension and the pTRV2-ZjCLA Agrobacterium resuspension;

[0072] The pTRV1 Agrobacterium resuspension and the pTRV2-ZjCLA Agrobacterium resuspension were mixed in equal amounts to obtain the VIGS silencing system (i.e., the infection bacterial liquid).

[0073] Comparative Example 1

[0074] An infection bacterial liquid was prepared by the following method:

[0075] The pTRV1 plasmid and the pTRV2 plasmid were respectively transformed into GV3101 competent cells by freeze-thaw method, and the positive Agrobacterium colonies after transformation were picked for PCR verification, and after verification, the Agrobacterium strains pTRV1 and pTRV2 were obtained;

[0076] Before VIGS infection, Agrobacterium strains pTRV1 and pTRV2 were activated by streaking on LB solid medium containing 50 mg / L kanamycin (Kan, Sigma) and 50 mg / L rifampicin (Rif, Sigma) respectively, and cultured at 28℃ for 2 days. Then, single colonies of pTRV1 and pTRV2 were picked into 2 mL LB liquid medium respectively for small-scale shaking culture at 28℃ overnight.

[0077] The small-scale shaking culture of Agrobacterium strains pTRV1 and pTRV2 were inoculated into 100 mL LB liquid medium containing 100 μL rifampicin (50 mg / mL), 50 μL kanamycin (100 mg / mL), 5 mL MES (pH 5.7, 0.2 M) and 20 μL acetosyringone (0.1 M) respectively, and cultured at 28℃ overnight.

[0078] The next morning, the shaking culture of pTRV1 and pTRV2 was poured into 50 mL centrifuge tubes respectively, centrifuged at 6000 rpm for 10 min at room temperature, and the supernatant was discarded. The bacterial cells were suspended in infection buffer (preparation method: 1 mL MgCl2 (1 M), 5 mL MES (pH 5.7, 0.2 M), 200 μL acetosyringone (0.1 M), and dilute to 100 mL) respectively, and the OD 600 was adjusted to 1.5. After vortex mixing, the mixture was allowed to stand at room temperature for 3 h to obtain the pTRV1 and pTRV2 Agrobacterium resuspension.

[0079] The pTRV1 and pTRV2 Agrobacterium resuspension were mixed in equal amounts to obtain the infection bacterial solution.

[0080] Application Example 1

[0081] A method for identifying the function of jujube ZjCLA gene, comprising the following steps:

[0082] (1) Cultivation of jujube seedling material

[0083] Intact jujube seeds were selected, disinfected with 0.5 wt.% sodium hypochlorite solution for 10 min, washed with distilled water for 3 times, and then soaked overnight. After the surface water of the seeds was absorbed, the seeds were wrapped with two layers of gauze and placed in a culture dish. 30 jujube seeds were placed in each culture dish, and the culture dish was placed in a constant temperature and light incubator, with a temperature setting of 25℃ and a light / dark cycle of 16 h light / 8 h dark. After 3 days of cultivation, the jujube seeds were transplanted into culture pots when they germinated to 1 cm. After the cotyledons were fully expanded, the jujube seedlings were used for infection.

[0084] (2) Use a disposable 1 ml syringe (without a needle) to draw the infecting bacterial solution prepared in Example 2, use a needle to lightly scratch the wound, and then inject the bacterial solution directly into the back of the cotyledons of the sour jujube seedlings with slight pressure to diffuse the bacterial solution in the leaves. The sour jujube seedlings injected with the infecting bacterial solution were cultured in the dark at 24 ° C in a culture room for 24 hours, and then transferred to 16 hours of light and 8 hours of dark culture conditions, which were recorded as the experimental group. In addition, a blank control group and a negative control group were set up, wherein the plant injected with the resuspension without bacterial solution was set as the blank control group, and the plant injected with the infecting bacterial solution prepared in Comparative Example 1 was set as the negative control group.

[0085] (4) Phenotypic observation

[0086] After injection, the leaves can be observed to have obvious circular marks and the leaves are filled with liquid. Figure 2 It can be seen that the experimental group inoculated with pTRV2-ZjCLA began to show leaf albinism symptoms, indicating that the silencing vector began to take effect, and the leaves of the control plants did not show albinism.

[0087] (5) Virus detection

[0088] Leaves of the blank control group (untreated), empty control group (empty control), and experimental group (TRV-ZjCLA) ​​were taken respectively, and three parallel experiments were repeated in each group. Leaf RNA was extracted using the TIANGEN RNA extraction kit and reverse transcribed into cDNA according to the kit instructions.

[0089] In order to detect the silencing effect of the viral vector, ZjCLA real-time quantitative primers were designed and real-time fluorescence quantitative PCR was used to detect the expression level in the leaves of sour jujube seedlings. Actin was used as an internal reference. The primer sequences are as follows:

[0090] ZjCLA-F:ATCAATTGGAGGCTTTGGAT, SEQ ID NO.4;

[0091] ZjCLA-R:ACTGTTGCTGCAATATGAGA, SEQ ID NO.5;

[0092] ZjACT-F: AGCCTTCCTGCCAACGAGT, SEQ ID NO.6;

[0093] ZjACT-R:TTGCTTCTCACCCTTGATGC, SEQ ID NO.7;

[0094] The reaction system of the real-time fluorescent quantitative PCR amplification is: cDNA 1 muL, ZjCLA-F or ZjACT-F 0.4 muL, ZjCLA-R or ZjACT-R 0.4 muL, 2xSuperRealPreMixPlus 10 muL and ddH2O 8.2 muL;

[0095] The reaction process of the real-time fluorescent quantitative PCR amplification is: 95 DEG C pre-denaturation for 15 min; 95 DEG C denaturation for 10 s, 50 DEG C annealing for 30 s, 72 DEG C extension for 30 s, a total of 40 cycles; 72 DEG C reaction for 10 min.

[0096] The detection results are shown in Figure 3 and Table 1.

[0097] Table 1 relative expression amount of ZjCLA gene in different leaves

[0098] Group Unprocessed No-load control TRV-ZjCLA Relative expression 1 1.07 0.17

[0099] From Figure 3 and Table 1, it can be seen that the VIGS silencing vector constructed by the specific fragment can successfully infect jujube seedlings, induce the silencing of endogenous ZjCLA of jujube, and effectively reduce the expression level of the ZjCLA gene of jujube.

[0100] Comparative application example 1

[0101] Pour the prepared pTRV1 and pTRV2 bacterial liquid into 50 mL centrifuge tubes respectively, centrifuge at 6000 rpm for 10 min at room temperature, discard the supernatant, and suspend the bacteria with the infection buffer suspension (preparation method: 1 mL MgCl2 (1M), 5 mL MES (pH 5.7, 0.2M), 200 muL acetosyringone (0.1M), and constant volume to 100 mL), adjust OD 600 to 0.8, vortex uniformly, and then stand at room temperature for 3 h to obtain the pTRV1 agrobacterium resuspension and the pTRV2 agrobacterium resuspension; mix the pTRV1 agrobacterium resuspension and the pTRV2 agrobacterium resuspension in equal volumes to obtain the infection bacterial liquid.

[0102] Use a disposable 1 mL syringe (without needle) to suck the infection bacterial liquid prepared in example 2, use a needle to slightly scratch a wound, and then inject the bacterial liquid directly on the back of the cotyledon of the ziziphus jujuba seedling through slight pressure to make the bacterial liquid diffuse in the leaf. The ziziphus jujuba seedling injected with the infection bacterial liquid is cultured in a 24 DEG C culture room in darkness for 24 h, and then cultured under the condition of 16 h light and 8 h darkness, which is recorded as the experimental group. In addition, a blank control group and a negative control group are set, wherein the resuspension without bacterial liquid is set as the blank control group, and the plant injected with the infection bacterial liquid prepared in comparative example 1 is set as the negative control group.

[0103] The blank control group (untreated), the empty control group (empty control), and the experimental group leaves (TRV-ZjCLA) were taken, and three parallel repeated experiments were set in each group. The TIANGEN RNA extraction kit was used to extract the leaf RNA, and the reverse transcription was performed to obtain the cDNA, and the method was referred to the kit instructions.

[0104] In order to detect the silencing effect of the virus vector, the ZjCLA real-time quantitative primer was designed, the expression amount in the jujube seedling leaves was detected by using the real-time fluorescent quantitative PCR, the internal reference was Actin, and the primer sequence, reaction system and reaction process were referred to the application example 1.

[0105] The detection results are shown in Table 2.

[0106] Table 2 Relative expression amount of ZjCLA gene in different leaves

[0107]

[0108]

[0109] Compared with the application example 1, it can be known from Table 2 that when the OD value of the bacterial liquid is 0.8, the VIGS infection effect of the jujube seedling is poor, and the expression amount is not significantly reduced.

[0110] In summary, the VIGS silencing vector constructed by using the specific fragment provided by the application can successfully infect the jujube seedling, effectively reduces the expression level of the jujube ZjCLA gene, and can realize simple, efficient and low-cost identification of the jujube ZjCLA gene function.

[0111] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. Application of a specific fragment in constructing a VIGS silencing vector for the jujube ZjCLA gene. The nucleotide sequence of the specific fragment is shown in SEQ ID NO.

1. The jujube ZjCLA gene includes a gene with sequence number XM_048477782.

1.

2. A VIGS silencing vector for the jujube ZjCLA gene, characterized in that: The VIGS silencing vector includes a specific fragment and a pTRV2 vector; the nucleotide sequence of the specific fragment is shown in SEQ ID NO.

1.

3. The VIGS silencing vector according to claim 2, characterized in that The specific fragment is located between the EcoR I and Xho I restriction enzyme cutting sites of pTRV2.

4. A VIGS silencing system for the ZjCLA gene of jujube, characterized in that: The VIGS silencing system comprises: an Agrobacterium liquid containing a pTRV1 vector and an Agrobacterium liquid containing a VIGS silencing vector; the VIGS silencing vector comprises the VIGS silencing vector according to claim 2 or 3; The volume ratio of the Agrobacterium solution containing the pTRV1 vector and the Agrobacterium solution containing the VIGS silencing vector is 1:1; The OD values ​​of the Agrobacterium culture solution containing the pTRV1 vector and the Agrobacterium culture solution containing the VIGS silencing vector are 1.0 to 1.5 respectively.

5. Use of the VIGS silencing vector according to claim 2 or 3 or the VIGS silencing system according to claim 4 in silencing the jujube ZjCLA gene, wherein the jujube ZjCLA gene includes the gene with sequence number XM_048477782.

1.

6. A method for silencing the ZjCLA gene in jujube, characterized in that: The following steps are involved: The VIGS silencing system according to claim 4 is injected into the back of leaves of jujube seedlings to obtain infected jujube seedlings.

7. The method according to claim 6, characterized in that The jujube seedlings include seedlings with fully expanded cotyledons.

8. The method according to claim 6, characterized in that After obtaining the infected jujube seedlings, the method further includes placing the infected jujube seedlings in a dark culture room at 24° C. for 24 hours.

9. Use of the VIGS silencing vector according to claim 2 or 3 or the VIGS silencing system according to claim 4 in constructing albino jujube leaves, wherein the jujube ZjCLA gene includes the gene with sequence number XM_048477782.1.

Images