Method for preparing insulin-secreting cells from mesenchymal stem cells mediated by CRISPRa

Abstract

The present invention provides a method for preparing insulin-secreting cells, the method comprising activating the expression of endogenous transcription factors Pdx1, NeuroD1 and / or Pax4 in mesenchymal stem cells, allowing the mesenchymal stem cells to differentiate across germ layers, and the obtained insulin-secreting cells can efficiently secrete insulin. Furthermore, the method does not require chemical induction.

Description

Technical Field

[0001] The present invention relates to the cross-technical field of molecular biology and cell biology, and in particular to a method for preparing insulin-secreting cells from umbilical cord mesenchymal stem cells mediated by CRISPRa. Background Art

[0002] Diabetes is a metabolic disease characterized by a relative or absolute deficiency of insulin. The International Diabetes Federation (IVD) predicts that by 2045, the number of diabetic patients worldwide will reach 700 million. At present, although pancreas or pancreatic islet transplantation is a means to fundamentally treat diabetes, the severe shortage of organ donors limits its clinical application, so direct transplantation of insulin-secreting cells (pancreatic β cells) has become a feasible alternative. The difficulty in directly sourcing pancreatic β cells has made in vitro induction of stem cells into insulin-secreting cells and then transplantation an alternative. Umbilical cord mesenchymal stem cells are the best choice for inducing insulin-secreting cells due to their relatively sufficient source, proliferation and differentiation potential, low immunogenicity, genetic stability and lack of ethical controversy.

[0003] The traditional method of inducing insulin-secreting cells is chemical induction. Although the induction scheme is constantly being optimized and improved, the operation procedure of chemical induction is still very complicated and inefficient because the induction of umbilical cord mesenchymal stem cells into insulin-secreting cells belongs to cross-germ layer differentiation. Although direct injection of transcription factors into cells can simplify the induction scheme to a certain extent, what is injected is generally only one type of gene transcription variant, which limits the ability of the injected gene to regulate cell differentiation. Summary of the invention

[0004] In order to solve the defects of the prior art, the present application provides a method for preparing insulin-secreting cells that can differentiate mesenchymal stem cells across germ layers without chemical induction. In particular, the method of the present application effectively avoids the cumbersome procedure of chemically inducing the differentiation of umbilical cord mesenchymal cells across germ layers into insulin-secreting cells, and also makes up for the lack of regulatory gene transcription variants caused by direct gene input to induce differentiation.

[0005] A first aspect of the present invention provides a method for preparing insulin-secreting cells, the method comprising activating the expression of endogenous transcription factors Pdx1, NeuroD1 and / or Pax4 in mesenchymal stem cells.

[0006] In a specific embodiment of the present invention, the preparation method comprises simultaneously activating the expression of endogenous transcription factors Pdx1, NeuroD1 and Pax4 in mesenchymal stem cells.

[0007] Preferably, the mesenchymal stem cells are derived from humans or non-human animals.

[0008] Preferably, the mesenchymal stem cells are derived from umbilical cord, bone marrow, umbilical cord blood or fat.

[0009] In a specific embodiment of the present invention, the mesenchymal stem cells are derived from the umbilical cord of human or non-human animals.

[0010] Preferably, the mesenchymal stem cells can be obtained by screening and extracting from the umbilical cord, bone marrow, umbilical cord blood or fat of human or non-human animals, or purchased as finished products.

[0011] Preferably, the non-human animals are non-human mammals, including but not limited to wild animals, zoo animals, economic animals, pets, experimental animals, etc. Preferably, the non-human mammals include but are not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0012] In a specific embodiment of the present invention, umbilical cord mesenchymal stem cells are the best material for inducing insulin-secreting cells due to their relatively abundant sources, easy to obtain in large quantities, proliferation and differentiation potential, low immunogenicity, genetic stability and lack of ethical controversy.

[0013] Preferably, the preparation method comprises introducing a vector system into mesenchymal stem cells, wherein the vector system comprises:

[0014] A) A vector expressing one or more sgRNAs and MS2 binding sites, or one or more vectors expressing sgRNAs and MS2 binding sites; wherein the sgRNAs may be the same or different.

[0015] B) a vector expressing the fusion protein MS2-P65-HSF1; and,

[0016] C) Vector expressing dCas9 protein.

[0017] Preferably, the vector is a bacterial vector, a fungal vector or a viral vector.

[0018] In a specific embodiment of the present invention, the vector is a phage vector, a baculovirus vector, a herpes virus vector, a poxvirus vector, an RNA virus vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector, etc., any vector in the prior art that can deliver genetic material into cells.

[0019] Preferably, the vector system further comprises other vectors required for packaging the virus.

[0020] Among them, the target site sequence of the sgRNA targeting the Pdx1 gene includes any one of SEQ ID NOs: 5-8 or a combination thereof, the target site sequence of the sgRNA targeting the NeuroD1 gene includes any one of SEQ ID NOs: 9-12 or a combination thereof, and the target site sequence of the sgRNA targeting the Pax4 gene includes any one of SEQ ID NOs: 13-16 or a combination thereof.

[0021] In a specific embodiment of the present invention, the preparation method comprises introducing sgRNA target site sequences SEQ ID NOs: 5-8 targeting the Pdx1 gene, sgRNA target site sequences SEQ ID NOs: 9-12 targeting the NeuroD1 gene, and sgRNA target site sequences SEQ ID NOs: 13-16 targeting the Pax4 gene into umbilical cord mesenchymal stem cells simultaneously or separately, so as to locate the transcription revelation site and activate the expression of the corresponding gene.

[0022] In a specific embodiment of the present invention, after the vector system is introduced into mesenchymal stem cells, the vector expressing sgRNA and MS2 binding site will be transcribed into sgRNA and RNA with a stem-loop structure that can specifically bind to the MS2 protein, and form a complex of "genomic DNA-dCas9-sgRNA-MS2binding site-MS2-P65-HSF1" structure with the other two vectors (the vector expressing the fusion protein MS2-P65-HSF1 and the vector expressing the dCas9 protein). Then, transcription is initiated and the corresponding gene expression is activated.

[0023] Preferably, the method further comprises the step of culturing the mesenchymal stem cells introduced with the vector system.

[0024] Preferably, the mesenchymal stem cells are cultured in a culture medium containing fetal bovine serum, and more preferably in a DMEM culture medium containing fetal bovine serum, wherein the culture medium preferably contains 1%-20%, more preferably 2%-10%, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) of fetal bovine serum.

[0025] Preferably, the culture medium further comprises a marker (eg, hygromycin) and an antibiotic (eg, puromycin).

[0026] Preferably, the culture medium used for the culture is added with one or a combination of two or more of fetal bovine serum, basic fibroblast growth factor FGFβ, B27 or nicotinamide. Preferably, the culture medium is DMEM culture medium.

[0027] In a specific embodiment of the present invention, the amount of fetal bovine serum added is 1%-20% of the culture medium, preferably 2%-10%, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20%.

[0028] In a specific embodiment of the present invention, the amount of nicotinamide added is 5-20 mmol / L, preferably 8-12 mmol / L, for example 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 mmol / L.

[0029] In a specific embodiment of the present invention, the amount of B27 added is 1%-10% of the culture medium, preferably 1-5%, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10%.

[0030] In a specific embodiment of the present invention, the amount of basic fibroblast growth factor FGFβ added is 0.1-5μ / mL, preferably 0.5-2μ / mL, for example 0.1, 0.2, 0.5, 1, 1.5, 2μ / mL of FGFβ.

[0031] In a specific embodiment of the present invention, the preparation method comprises inoculating mesenchymal stem cells into a DMEM medium containing 10% fetal bovine serum, and when the cell density is 70%-95% (e.g., 75%, 80%, 85%, 90%, 95%), infecting the cells with the vector system, and after infection for 12-48h (e.g., 12, 18, 20, 24, 30, 32, 35, 40, 42, 45, 48h), replacing the DMEM medium with antibiotics (e.g., puromycin) (preferably 10% fetal bovine serum, 400 μg / ml hygromycin and 5 μg / ml puromycin), and culturing for 2-5 days (preferably 3 days); replacing the DMEM medium containing 2% fetal bovine serum, 10 mmol / l nicotinamide and 2% B27, culturing for 7 days, and then adding 1 μ / ml FGFβ.

[0032] The second aspect of the present invention provides an insulin-secreting cell obtained by the above-mentioned preparation method.

[0033] In the third aspect of the present invention, an sgRNA or an sgRNA combination is provided, wherein the target site sequence of the sgRNA targeting the Pdx1 gene comprises any one of SEQ ID NOs: 5-8 or a combination thereof, the target site sequence of the sgRNA targeting the NeuroD1 gene comprises any one of SEQ ID NOs: 9-12 or a combination thereof, and / or the target site sequence of the sgRNA targeting the Pax4 gene comprises any one of SEQ ID NOs: 13-16 or a combination thereof.

[0034] In a fourth aspect of the present invention, a vector comprising the above sgRNA or sgRNA combination or a combination of vectors comprising the above sgRNA is provided, wherein the sgRNAs in the combination may be the same or different.

[0035] The fifth aspect of the present invention provides a vector system comprising the above-mentioned vector.

[0036] Preferably, the vector system further comprises:

[0037] A vector expressing the fusion protein MS2-P65-HSF1; and / or,

[0038] C) Vector expressing dCas9 protein.

[0039] Preferably, the vector system further comprises other vectors required for packaging the virus.

[0040] Preferably, the vector is a bacterial vector, a fungal vector or a viral vector.

[0041] In a specific embodiment of the present invention, the vector is a phage vector, a baculovirus vector, a herpes virus vector, a poxvirus vector, an RNA virus vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector, etc., any vector in the prior art that can deliver genetic material into cells.

[0042] In a sixth aspect, the present invention provides a cell comprising the above-mentioned sgRNA or sgRNA combination, the above-mentioned vector or the above-mentioned vector system.

[0043] Preferably, the cell is a microbial cell (eg, bacteria, fungi, virus), or may be a plant cell, an animal cell or a human cell.

[0044] In a specific embodiment of the present invention, the cells include but are not limited to Escherichia coli, mesenchymal stem cells, and HEK293.

[0045] In a seventh aspect, the present invention provides a use of the above-mentioned sgRNA or sgRNA combination, the above-mentioned vector system, and the above-mentioned cells in preparing insulin-secreting cells.

[0046] In an eighth aspect of the present invention, there is provided an application of the above-mentioned sgRNA or sgRNA combination, the above-mentioned vector system, the above-mentioned cell or the insulin-secreting cell obtained by the above-mentioned preparation method, wherein the application comprises:

[0047] A) Lowering blood sugar;

[0048] B) Treat and / or prevent diabetes;

[0049] C) preparing a medicament for treating and / or preventing diabetes.

[0050] In a ninth aspect of the present invention, a drug is provided, comprising the above-mentioned sgRNA or sgRNA combination, the above-mentioned vector system, the above-mentioned cells or insulin-secreting cells obtained by the above-mentioned preparation method, and pharmaceutically acceptable excipients.

[0051] In the tenth aspect of the present invention, a method for treating diabetes is provided, which comprises administering the above-mentioned sgRNA or sgRNA combination, vector system, cells, insulin-secreting cells obtained by the above-mentioned preparation method, insulin secreted by the insulin-secreting cells obtained by the above-mentioned preparation method, or the above-mentioned drug to an individual.

[0052] In the eleventh aspect of the present invention, a method for lowering blood sugar is provided, the method comprising applying the above-mentioned sgRNA or sgRNA combination, vector system, cells, insulin-secreting cells obtained by the above-mentioned preparation method, insulin secreted by the insulin-secreting cells obtained by the above-mentioned preparation method, or the above-mentioned drug to an individual.

[0053] The preparation method of insulin-secreting cells provided by the present invention adopts CRISPRa (CRISPR activation) technology to utilize Cas9 protein (dCas9) without enzymatic activity, and under the guidance of gRNA, the transcriptional activation element can be accurately positioned in the promoter region of the gene to activate the expression of the gene. This method of accurately activating the expression of endogenous genes in cells can effectively activate and upregulate the expression of transcription factors related to the differentiation of insulin-secreting cells, so that mesenchymal stem cells can differentiate across germ layers. More importantly, the present invention constructs a method that does not require chemical induction, and utilizes the sgRNA combination specifically selected in this application and the constructed vector system to allow mesenchymal stem cells to transdifferentiate into insulin-secreting cells.

[0054] The "activation" mentioned in the present invention may be to activate a gene that was not expressed originally to become expressed, or to activate a gene that was originally expressed at a low level to become expressed at a high level.

[0055] The "NeuroD1 gene" mentioned in the present invention stands for Neuronal Differentiation 1, neuronal differentiation 1 gene.

[0056] The "Pdx1" described in the present invention: pancreatic and duodenal homeobox domain 1 gene.

[0057] “Pax4” mentioned in the present invention: paired box gene 4 (PAX family transcription factor).

[0058] MS2 protein: stands for Multiple sclerosis,susceptibility to,2, multiple sclerosis sensitivity 2 gene.

[0059] P65 protein: stands for RELA proto-oncogene, NF-kB subunit, RELA proto-oncogene, NF-kB subunit gene.

[0060] HSF1 protein: stands for heat shock transcription factor 1, heat shock transcription factor 1 gene.

[0061] The "HEK293" mentioned in the present invention stands for human embryonic kidney 293 cells.

[0062] The "dCas9" described in the present invention is a protein formed by mutating the Cas9 cleavage site. It only has the ability to bind to the genome and sgRNA, but does not have the ability to cut DNA.

[0063] The “plurality” mentioned in the present invention means more than 2, including but not limited to 2-50, preferably 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.

[0064] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0065] The "pharmaceutically acceptable excipients" described in the present invention include, but are not limited to, one or more of carriers, excipients, diluents, wetting agents, fillers, binders, lubricants, disintegrants, antioxidants, buffers, suspending agents, solubilizers, thickeners, stabilizers, flavoring agents and preservatives.

[0066] The "drug" described in the present invention can be administered by any suitable route, such as gastrointestinal administration (e.g., oral) or parenteral administration (e.g., intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.).

[0067] The "drug" described in the present invention can be in any suitable dosage form, such as a dosage form for gastrointestinal administration or a dosage form for parenteral administration, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, aerosols, effervescent tablets, pills, gels, etc.

[0068] The various dosage forms of the drug of the present invention can be prepared according to conventional production methods in the pharmaceutical field.

[0069] The "individual" described in the present invention can be a human or a non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0070] The "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0071] The terms “comprising” or “including” described in the present invention are open-ended terms. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0073] Figure 1 : The structure diagram of the modified lentiviral vector. The lentiviral vectors are Lenti-dCas9-VP64-T2A-BlastR, Lenti-MS2-P65-HSF1-T2A-HygroR, and Lenti-sgRNA2.0-PuroR.

[0074] Figure 2 :sgRNA sequence of Pdx1 gene and its position in the gene.

[0075] Figure 3 :sgRNA sequence of NeuroD1 gene and its position in the gene.

[0076] Figure 4 :The sgRNA sequence of Pax4 gene and its position in the gene.

[0077] Figure 5 : BsmBI restriction site and sticky ends formed after Lenti-sgRNA2.0-PuroR was digested with BsmBI.

[0078] Figure 6 :The activation efficiency of Pdx1, NeuroD1 and Pax4 genes after sgRNA transfection and co-transfection of HEK293 cells. A.RT-PCR analysis of the activation efficiency of different sgRNAs. B.qPCR analysis of the expression level of Pdx1 after transfection with different sgRNAs. C.qPCR analysis of the expression level of NeuroD1 after transfection with different sgRNAs. D.qPCR analysis of the expression level of Pax4 after transfection with different sgRNAs. Among them, CN is a negative control, sgRNA1-4 is a mixture of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 in equal molar ratios, and CP is a positive control.

[0079] Fig. 7A : The relative expression levels of insulin-related genes were analyzed by RT-PCR at 7d, 10d, 17d and 21d after lentiviral dCas9-SAM / sgRNA co-infection of umbilical cord mesenchymal stem cells.

[0080] Figure 7B : When umbilical cord mesenchymal stem cells were co-infected with lentiviral dCas9-SAM / sgRNA for 7d, 10d, 17d and 21d, the relative expression levels of insulin-related genes were analyzed by qPCR.

[0081] Figure 8 : Insulin secretion in the cell culture supernatant after umbilical cord mesenchymal stem cells were infected with lentiviral dCas9-SAM / sgRNA for 7d, 10d, 17d and 21d.

[0082] Fig. 9 : Effect of sugar induction on cellular insulin secretion on the 21st day. DETAILED DESCRIPTION

[0083] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0084] The lentiviral vectors Lenti-dCas9-VP64_Blast (#61425), Lenti-MS2-P65-HSF1_Hygro (#61426) and Lenti-sgRNA2.0 (#61427) used in the examples are all from Addgene.

[0085] The PGK-PuroR used in the examples was purchased from SBI (System Biosciences), product catalog number: CD810A-1.

[0086] Example 1: Lenti-dCas9-SAM / sgRNA2.0 vector construction

[0087] 1. The Lenti-dCas9-VP64_Blast and Lenti-MS2-P65-HSF1_Hygro vectors transformed the EF1a promoter into a CMV promoter.

[0088] According to the analysis of plasmid vector restriction sites, CMV promoter primers with NheI and BsiWI restriction sites were designed. The primer sequences are:

[0089] NheI-CMV-F: 5'-GCTAGCCCCGTTACATAACTTACGG-3' (SEQ ID NO: 1),

[0090] CMV-BsiWI-R: 5'-CGTACGGATCTGACGGTTCACTAAA-3' (SEQ ID NO: 2);

[0091] The NheI-CMV-BsiWI DNA fragment was amplified from the company's existing plasmid with a CMV promoter, and the fragment was connected to a blunt-end cloning vector to construct a pEasy-CMV vector, and the correct single clones were screened for standby. Lenti-dCas9-VP64_Blast, Lenti-MS2-P65-HSF1_Hygro and pEasy-CMV plasmids were double-digested with NheI-BsiWI, and the enzyme digestion system is shown in Table 1.

[0092] Table 1: Enzyme digestion system

[0093] Plasmids 1 μg NeA 1μl BqI 1μl 10×CutSmart Buffer 5μl <![CDATA[ddH2O]]> Make up to 50 μl

[0094] Overnight at 37°C, 1% agarose gel electrophoresis was used to separate the digestion products, and the fragments of 12820bp (Lenti-dCas9-VP64_Blast), 10471bp (Lenti-MS2-P65-HSF1_Hygro) and 521bp (CMV) were recovered and purified. The 12820bp and 10471bp fragments were ligated with the 521bp fragment using T4 ligase. The reaction products were transformed into stbl3 competent E. coli, spread on LB solid plates containing Amp, cultured at 37°C overnight, and positive clones were screened, which were the modified lentiviral vectors Lenti-dCas9-VP64-T2A-BlastR and Lenti-MS2-P65-HSF1-T2A-HygroR, as shown in the attached Figure 1 .

[0095] 2. Lenti-sgRNA2.0 plasmid was transformed to transform EF1a-BleoR into PGK-PuroR.

[0096] According to the analysis of plasmid vector restriction sites, PGK-PuroR primers with BamHI and EcoRI were designed, and the sequence is:

[0097] BamHI-PGK-F: 5'-GGATCCGGGTAGGGGAGGCGCTTTTC-3' (SEQ ID NO: 3), and PuroR-EcoRI-R: 5'-GAATTCTCAGGCACCGGGCTTGCGGG-3' (SEQ ID NO: 4), using the plasmid with PGK-PuroR as a template, DNA high-fidelity polymerase amplified the BamHI-PGK-PuroR-EcoRI fragment, ligated to the blunt-end vector, constructed the pEasy-PGK-PuroR vector, screened the correct clones for use. Lenti-sgRNA2.0 and pEasy-PGK-PuroR were double-digested with BamHI-EcoRI, and the enzyme digestion system is shown in Table 2.

[0098] Table 2: Enzyme digestion system

[0099]

[0100]

[0101] Incubate overnight at 37°C, separate the digestion products by 1% agarose gel electrophoresis, purify and recover DNA fragments of 8351 bp (Lenti-sgRNA2.0) and 1146 bp (PGK-PuroR), connect with T4 ligase, transform the ligation products into stbl3 competent E. coli, screen the positive clones, and the transformed lentiviral plasmid Lenti-sgRNA2.0-PuroR is shown in the attached figure. Figure 1 .

[0102] 3. sgRNA design and vector construction

[0103] The sgRNAs for Pdx1, NeuroD1, and Pax4 genes were designed using the CHOPCHOP (version 3) online sgRNA design tool. The target sequences of the sgRNAs and their locations in the genes are shown in the attached Figure 2 , 3 and 4, specific,

[0104] sgRNA sequence of Pdx1 gene:

[0105] sgRNA1: gccccgcggagcctatggtg (SEQ ID NO: 5)

[0106] sgRNA2: atcacggcccccggctgaac (SEQ ID NO: 6)

[0107] sgRNA3: gggcctagcctcttagtgcg (SEQ ID NO: 7)

[0108] sgRNA4:gttttcgtgagcgcccattt (SEQ ID NO: 8)

[0109] sgRNA sequence of NeuroD1 gene:

[0110] sgRNA1: ggcggggagacgagcaaggcg (SEQ ID NO: 9)

[0111] sgRNA2: gggtaggggtggagggtgag (SEQ ID NO: 10)

[0112] sgRNA3: agaccatatggcgcatgccg (SEQ ID NO: 11)

[0113] sgRNA4: cggcatacaaatgggcaggt (SEQ ID NO: 12)

[0114] sgRNA sequence for Pax4 gene:

[0115] sgRNA1: gtgacatcactggctactcc (SEQ ID NO: 13)

[0116] sgRNA2: tcctcctctctcctctgctc (SEQ ID NO: 14)

[0117] sgRNA3: tgcctcagggctggtgtcag (SEQ ID NO: 15)

[0118] sgRNA4: atggaaggacacagtgggtc (SEQ ID NO: 16)

[0119] According to the sticky ends obtained after the endonuclease BsmBI single enzyme digestion of Lenti-sgRNA2.0-PuroR (attached Figure 5 ), design the sgRNA insertion vector sequence, and send it to a commercial company for synthesis.

[0120] The single-stranded oligodeoxyribonucleotide synthesized by a commercial company was synthesized into a double-stranded one. Specifically, the synthesized lyophilized powder was dissolved into 10 μM, 5 μl of each complementary chain was added to a 0.2 ml PCR tube and then placed in a PCR instrument. The reaction program was 37°C, 10 min; 95°C, 5 min; and the temperature dropped by 1.5°C per minute until it reached room temperature.

[0121] Phosphorylation of double-stranded sgRNA. T4 polynucleotide kinase was used to phosphorylate the synthesized double-stranded sgRNA. The reaction system is shown in Table 3.

[0122] Table 3: Reaction system

[0123] Double-stranded sgRNA 1μl 10×T4PNK buffer 1μl T4PNK 0.25μl <![CDATA[ddH2O]]> Final volume 10 μl

[0124] 37℃, 1h, store at -20℃.

[0125] sgRNA vector construction. Lenti-sgRNA2.0-PuroR was digested with endonuclease BsmBI. The restriction enzyme system is shown in Table 4.

[0126] Table 4: Enzyme digestion system

[0127] Lenti-sgRNA2.0-PuroR 1 μg 10×CutSmart Buffer 5μl BbI 0.5μl <![CDATA[ddH2O]]> Make up to 50 μl

[0128] 37℃, 20min. 1% agarose gel separation of enzyme digestion products, purification and recovery of large fragments. T4 ligase ligated double-stranded sgRNA and Lenti-sgRNA2.0-PuroR (attached Figure 5 ), the ligation products were transformed into stbl3 Escherichia coli competent cells, and positive clones were screened by sequencing.

[0129] Example 2: Identification of the efficiency of dCas9-SAM / sgRNA in activating endogenous expression

[0130] HEK293 cells were inoculated into 6-well cell culture plates in DMEM supplemented with 10% fetal bovine serum and 4 mM L-glutamine, and cultured in a 37°C, 5% CO2 incubator until the cell density reached 70%. The transfection reagent Lipofectamine 3000 was used to co-transfect Lenti-dCas9-VP64-T2A-BlastR, Lenti-MS2-P65-HSF1-T2A-HygroR, and Lenti-sgRNA2.0-PuroR. The transfection system is shown in Table 5.

[0131] Table 5: Transfection system

[0132] Opti-MEM medium 125μl Total plasmid DNA (molar ratio 1:1:1) 2.5 μg P3000 5ul Lipofectamine 3000 3μl

[0133] Place at room temperature for 15 minutes, culture in a 37°C, 5% CO2 incubator for 24 hours, replace with fresh culture medium, culture for 48 hours, and collect cells. Total RNA was extracted using the Invitrogen TRIzol RNA extraction kit. The extraction process is described in the product instructions. The quality of the extracted RNA sample was identified by 1% agarose gel electrophoresis.

[0134] TakaRa PrimeScript RT reagent Kit was used to synthesize cDNA (see product description for details).

[0135] The cDNA samples were analyzed by qPCR and RT-PCR using ABI-7500. Untransfected HEK293 cells were used as negative controls and labeled as CN, pancreatic islet cells were used as positive controls and labeled as CP, GAPDH was used as an internal control, and the primer sequences are shown in Table 6.

[0136] Table 6: Primer sequences

[0137]

[0138]

[0139] The relative gene expression was measured using 2 -ΔΔC The specific method is as follows:

[0140] GAPDH gene was used as an internal reference, and its Ct values ​​in the cell samples of CN and Pdx1_sgRNA1 were expressed as Ct(GAPDH_CN) and Ct(GAPDH_Pdx1_sgRNA1), respectively. The Ct values ​​of the two samples to be tested were Ct(CN) and Ct(Pdx1_sgRNA1), respectively.

[0141] ΔCt(CN)=Ct(CN)-Ct(GAPDH_CN);

[0142] ΔCt(Pdx1_sgRNA1)=Ct(Pdx1_sgRNA1)-Ct(GAPDH_Pdx1_sgRNA1);

[0143] ΔΔCt=ΔCt(Pdx1_sgRNA1)-ΔCt(CN);

[0144] The relative expression level of Pdx1 in cells transfected with Pdx_sgRNA1 is 2 of that in CN samples. -ΔΔCt .

[0145] The results showed that for the three genes Pdx1, NeuroD1 and Pax4, the activation efficiency of the four sgRNAs alone was not high (see Appendix Figure 6 ), but the activation efficiency of the four sgRNAs acting synergistically was significantly increased.

[0146] Example 3: Preparation and verification of lentiviral packaging and insulin-secreting cells

[0147] Lentivirus packaging uses a four-plasmid system, PEI is used as a transfection reagent, and HEK293 cells are co-transfected. The medium is changed after 12 hours, and the supernatant is collected after 72 hours. The virus is purified and concentrated by purification column. The virus titer is determined by qPCR. Among them, the sgRNAs of Pdx1, NeuroD1 and Pax4 genes all act synergistically with four sgRNAs.

[0148] 1. dCas9-SAM / sgRNA activates endogenous genes of umbilical cord mesenchymal stem cells to prepare insulin-secreting cells

[0149] P3 generation umbilical cord mesenchymal stem cells were inoculated into DMEM medium containing 10% fetal bovine serum. When the cell density was 80%, the lentivirus Lenti-dCas9-VP64-T2A-BlastR, Lenti-MS2-P65-HSF1-T2A-HygroR and Lenti-sgRNA2.0-PuroR prepared in Example 1 were co-infected with cells. After 24 hours of infection, the DMEM medium containing antibiotics (10% fetal bovine serum, 400 μg / ml hygromycin (Hygromcin) and 5 μg / ml puromycin (Puromycin)) was replaced for three days. Then the DMEM medium containing 2% fetal bovine serum, 10mmol / l nicotinamide and 2% neural cell growth agent (B27) was replaced, cultured for 7 days, and then 1μ / ml FGFβ was added. Umbilical cord mesenchymal stem cells not infected with lentivirus were used as parallel controls.

[0150] 2. Expression of insulin-related genes

[0151] Cells were collected on days 7, 10, 17, and 21 after infection, and total RNA was extracted using the Invitrogen TRIzol RNA extraction kit. The quality of the extracted RNA was identified by 1% agarose gel electrophoresis. cDNA was synthesized using the TakaRa PrimeScript RT reagent Kit. cDNA samples were analyzed by qPCR and RT-PCR using ABI-7500. GAPDH was used as an internal reference, and the primer sequences are shown in Table 6. The relative expression of genes was measured using 2 -ΔΔC Law.

[0152] The results showed (Figure 7) that the expression levels of Pdx1, NeuroD1, Pax4, Ngn3 and Nkx6.1 gradually increased in the first 17 days, but began to decrease on the 21st day, while Glut2 and insulin began to be expressed on the 10th day, and the expression levels gradually increased, reaching the maximum on the 21st day, indicating that umbilical cord mesenchymal cells began to form insulin-secreting cells on the 10th day.

[0153] 3. Analysis of insulin secretion

[0154] The supernatants were collected on the 7th, 10th, 17th and 21st days after infection, and the insulin secretion was measured by Abcam insulin ELISA kit. The results showed that the changes in the insulin content in the cell culture supernatant were consistent with the changes in the insulin gene expression in the cells (Figures 7 and 8). The maximum insulin secretion was detected on the 21st day, which was 8.306±1.173μg / l4. Effect of sugar induction on insulin secretion

[0155] On the 21st day, the cells were first cultured in DMEM low-glucose medium (5.5 mM glucose) for 3 h, and the supernatant was collected. Then the cells were cultured in DMEM high-glucose medium (25 mM glucose) for 3 h, and the supernatant was collected. The Abcam insulin ELISA kit was used to measure the insulin secretion. The results show (see Appendix Fig. 9 ), when cultured with high sugar, the insulin secretion was 15.789±1.205μg / l, which was 2.62 times that of that in low sugar culture.

[0156] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0157] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. A method for preparing insulin-secreting cells, characterized in that: The preparation method comprises activating endogenous transcription factors in mesenchymal stem cells Pdx1 , NeuroD1 or Pax4 Expression; Wherein, the preparation method comprises introducing a vector system into mesenchymal stem cells, and the vector system comprises: A) Vector expressing sgRNA and MS2 binding site; B) A vector expressing the fusion protein MS2-P65-HSF1; and, C) Vector expressing dCas9 protein; Among them, targeted Pdx1 The target site sequence of the sgRNA of the gene comprises SEQ ID NO: 5-8, targeting NeuroD1 The target site sequence of the sgRNA of the gene comprises SEQ ID NO: 9-12, targeting Pax4 The target site sequence of the sgRNA of the gene includes SEQ ID NOs: 13-16.

2. The preparation method according to claim 1, characterized in that: The mesenchymal stem cells are derived from the umbilical cord, bone marrow, umbilical cord blood or fat of humans or non-human animals.

3. The preparation method according to claim 1, characterized in that: The vector is a viral vector.

4. An insulin-secreting cell obtained by the preparation method according to any one of claims 1 to 3.

5. A sgRNA combination for constructing gene-overexpressed mesenchymal stem cells, characterized in that: Targeting Pdx1 The target site sequence of the sgRNA of the gene comprises SEQ ID NO: 5-8, or, targeting NeuroD1 The target site sequence of the sgRNA of the gene comprises SEQ ID NO: 9-12, or, targeting Pax4 The target site sequence of the sgRNA of the gene includes SEQ ID NOs: 13-16.

6. A vector comprising the sgRNA combination of claim 5.

7. A vector system comprising the vector according to claim 6.

8. A drug, characterized in that The drug comprises the insulin-secreting cells according to claim 4, the sgRNA combination according to claim 5, the vector according to claim 6, the vector system according to claim 7, and pharmaceutically acceptable excipients.

Images