use of circncaph, psoriasis diagnostic / or therapeutic preparations

Abstract

This invention belongs to the field of psoriasis diagnosis and treatment technology, specifically involving the application of circNCAPH and diagnostic / therapeutic agents for psoriasis. Abnormally high expression of circNCAPH in psoriatic lesions was detected by qRT-PCR, suggesting that circNCAPH holds promise as a diagnostic marker for psoriasis. Due to the excellent silencing effect of siRNA, after ensuring that circNCAPH was suppressed, CCK8 and apoptosis experiments were performed on HaCaT keratinocyte cell lines with silenced circNCAPH. Compared to the NC group, the proliferation rate of cells in the siRNA group was significantly slower, and the proportion of late-stage apoptotic cells was significantly increased, indicating that silencing circNCAPH inhibited keratinocyte proliferation. Therefore, inhibiting circNCAPH can treat psoriasis, which has profound clinical significance and important prospects for widespread application.

Description

Technical Field

[0001] This invention belongs to the field of psoriasis diagnosis and treatment technology, specifically involving the application of circNCAPH and psoriasis diagnostic / or therapeutic agents. Background Technology

[0002] Psoriasis is a common chronic inflammatory skin disease worldwide, affecting more than 60 million people globally. It is characterized by well-defined, erythematous patches covered with silvery-white scales on normal skin, accompanied by significant itching. The cause of psoriasis is currently unknown, and it is prone to relapse and difficult to cure completely. Over the past thirty years, the incidence of psoriasis has been rising, placing a significant burden on individuals and society.

[0003] As a major component of the epidermis, keratinocytes play a crucial role in the pathogenesis of psoriasis. Excessive proliferation and abnormal differentiation of keratinocytes are the most prominent pathological features of psoriasis. Normally, it takes about 28 days for keratinocytes to migrate from the basal layer to the keratinocyte surface and shed, but in psoriasis patients, this time is shortened to 3-4 days. Furthermore, abnormal keratinocyte apoptosis also contributes to the pathogenesis of psoriasis.

[0004] Circular RNA (circRNA) is a novel class of non-coding RNAs with regulatory functions. It possesses a closed circular structure and is abundant in the eukaryotic transcriptome. circRNAs are formed by reverse splicing of pre-mRNA, resulting in a covalently linked circular transcript without a 5' cap and a 3' polyA tail. Most circRNAs consist of exon sequences, exhibiting conservation across different species and tissue- and developmental-stage expression specificity. Because circRNAs are insensitive to nucleases, they are more stable than linear RNAs, giving them a significant advantage in the development and application of novel clinical diagnostic markers.

[0005] With the development of high-throughput sequencing technology, an increasing number of circRNA molecules have been discovered, demonstrating great potential in the development of new diagnostic and therapeutic methods. We detected a 379 bp circNCAPH circRNA in psoriatic lesions and normal human skin tissue. Experiments revealed that this circRNA is associated with the occurrence and development of psoriasis, and may serve as a diagnostic marker and therapeutic target for psoriasis. Summary of the Invention

[0006] In view of this, the purpose of this invention is to address the above-mentioned technical problems by providing the application of reagents for detecting circNCAPH content in the preparation of psoriasis diagnostic preparations, and the application of reagents for inhibiting circNCAPH expression in the preparation of psoriasis therapeutic preparations, as well as corresponding diagnostic and therapeutic preparations.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] This invention provides the application of a reagent for detecting circNCAPH expression levels in the preparation of products for diagnosing psoriasis; the sequence of circNCAPH is shown in SEQ NO.1.

[0009] Furthermore, the reagents for detecting circNCAPH expression levels include qRT-PCR detection reagents targeting the circNCAPH circularization site.

[0010] The qRT-PCR primer sequences are as follows:

[0011] Upstream primer: 5'-AAACCAGGCACCAGGGGAA-3' as shown in SEQ NO.2;

[0012] Downstream primer: 5'-TCTGATTGGGAAGGAGCATCTTG-3', as shown in SEQ NO.3.

[0013] The present invention also provides a psoriasis diagnostic kit, comprising: the above-mentioned reagent for detecting circNCAPH expression level.

[0014] This invention provides the application of a reagent that inhibits circNCAPH expression in the preparation of psoriasis treatment agents.

[0015] The sequence of circNCAPH is shown in SEQ NO.1.

[0016] Furthermore, the reagent used to inhibit the expression of circular RNA circNCAPH includes siRNA.

[0017] Furthermore, the siRNA is as follows:

[0018] Justice chain (5'-3')AACCAGGCACCAGGGGAAGAATT, as shown in SEQ NO.4.

[0019] The antisense chain (5'-3')UUCUUCCCCUGGUGCCUGGUUTT is shown in SEQ NO.5.

[0020] The reagents for inhibiting circNCAPH include a negative control:

[0021] Justice chain (5'-3')UUCUCCGAACGUGUCACGUTT, as shown in SEQ NO.6;

[0022] The antisense chain (5'-3')ACGUGACACGUUCGGAGAATT is shown in SEQ NO.7.

[0023] This invention provides a psoriasis treatment formulation comprising the aforementioned reagent for inhibiting the expression of circular RNA circNCAPH. However, this invention is not limited to the siRNA and negative control described above.

[0024] Psoriasis treatments also include reagents required for siRNA transfection.

[0025] This invention provides the reagent for inhibiting circNCAPH expression in the preparation of a formulation that slows down keratinocyte proliferation and promotes keratinocyte apoptosis; the sequence of circNCAPH is shown in SEQ NO.1.

[0026] The present invention also provides an agent for slowing down the proliferation of keratinocytes, including the above-mentioned inhibitory agents.

[0027] Reagents for expressing circular RNA circNCAPH.

[0028] The sequence of the circular RNA circNCAPH described in this invention is as follows:

[0029] GGAAGAAATGATTTCCCTTGGGGATGGAGACATCAGGACCATGTGCCCCCTTCTGTCTATGAAACCTGGAGAATATTCTTATTTCAGTCCTCGGACCATGTCGATGTGGGCTGGCCCGGATCACTGGCGCTTTAGGCCTCGACGCAAACAAGATGCTCCTTCCCAATCAGAAAACAAAAAGAAGAGTAC AAAAAAAGATTTTGAAATTGACTTTGAAGATGATATTGACTTTGATGTATATTTTAGAAAAACAAAGGCTGCTACTATTCTGACCAAGTCCACTTTGGAGAACCAGAATTGGAGAGCTACCACCCTTCCTACAGATTTCAACTACAATGTTGACACTCTGGTCCAGCTTCACCTCAAACCAGGCACCAGG

[0030] This invention detected abnormally high expression of circNCAPH in psoriatic lesions using qRT-PCR, and inhibiting its expression in keratinocytes suppressed cell proliferation and promoted apoptosis. These findings suggest that circNCAPH holds promise as a diagnostic marker and novel therapeutic target for psoriasis. Attached Figure Description

[0031] Figure 1 The expression level of circNCAPH in psoriatic lesion epidermal tissue and normal epidermal tissue was detected by qRT-PCR.

[0032] The expression level of circNCAPH was analyzed using the internal reference gene RPLP0 as a reference, and normal epidermal tissue was normalized to 1. The two-sided Mann-Whitney U test was used, and p < 0.05 was considered statistically significant, while p < 0.0001 was considered statistically significant.

[0033] RPLP0 is used as a reference.

[0034] Upstream primer: 5'-TGGTCATCCAGCAGGTGTTCGA-3', as in SEQ NO.8

[0035] Downstream primer: 5'-ACAGACACTGGCAACATTGCGG-3', as in SEQ NO.9;

[0036] Figure 2 To detect the silencing efficiency of si-circNCAPH in HaCaT cells using qRT-PCR;

[0037] The expression level of circNCAPH was analyzed with GAPDH as a reference. The negative control group was normalized to 1. A two-sided unpaired t-test was used. p<0.05 was considered statistically significant, and ***p<0.001.

[0038] GAPDH as a reference

[0039] Upstream primer: 5'-ACCACAGTCCATGCCATCACT-3', as in SEQ NO.10

[0040] Downstream primer: 5'-TGACCTTGCCCACAGCCTT-3', as in SEQ NO.11;

[0041] Figure 3 The effect of silencing circNCAPH in vitro on the CCK8 assay in HaCaT cells; *p<0.05, **p<0.01.

[0042] Figure 4The effect of silencing circNCAPH in vitro on the apoptosis rate of HaCaT cells; A. Flow cytometry, B. Statistical graph of apoptotic cell proportion, *p<0.05. Detailed Implementation

[0043] The following examples are intended to further illustrate the present invention, but not to limit it.

[0044] Example 1: Expression of circNCAPH in psoriasis tissues and cells

[0045] 1. Twenty-three psoriatic lesion tissues and 20 normal skin tissues were collected from the Department of Dermatology, Xiangya Second Hospital, Central South University. After dermal-epidermal separation, epidermal tissues were collected to investigate the expression difference of circNCAPH in the epidermal tissues of the two groups of samples. All lesion tissue providers were diagnosed with psoriasis vulgaris by skin histopathology examination at our hospital and were excluded from having other skin diseases such as systemic lupus erythematosus, atopic dermatitis, eczema, and neurodermatitis. No topical corticosteroids, retinoids, vitamin D3 derivatives, or calcineurin inhibitors were used on the affected skin in the past two weeks. Normal skin tissue providers were excluded from having skin diseases such as psoriasis, systemic lupus erythematosus, atopic dermatitis, eczema, and neurodermatitis. The collection of all experimental tissue samples was authorized by the Ethics Committee of Xiangya Second Hospital, Central South University, and the specimen donors gave their consent.

[0046] 2. Extraction of RNA from tissues / cells

[0047] RNA was extracted manually from tissues using the TRIZOL method, with strict enzyme-free operation throughout the process and careful maintenance of low temperature.

[0048] (1) Personnel and environment preparation: Experimenters should wear disposable masks and gloves, spray and wipe the experimental table with 0.1% exogenous RNase inhibitor, and prepare experimental equipment such as pipettes, enzyme-free tip tips, 1.5mL enzyme-free EP tubes, and 2mL enzyme-free grinding tubes.

[0049] (2) Preparation of experimental materials: Cool the high-speed low-temperature centrifuge to 4°C, and insert chloroform, isopropanol, anhydrous ethanol and enzyme-free water into the ice box or place them in a 4°C refrigerator for pre-cooling. Equilibrate TRIZOL to room temperature.

[0050] (3) Collect the tissue powder or cell precipitate after grinding with liquid nitrogen into 1 mL TRIZOL and lyse at room temperature for 10 minutes.

[0051] (4) Add 200 μL of chloroform to each tube, shake vigorously for at least 15 seconds, and let stand at room temperature for 5-10 minutes. Centrifuge at 12,000 g for 15 minutes at 4℃. While waiting for centrifugation, prepare a new 1.5 mL enzyme-free EP tube and label it.

[0052] (5) After centrifugation, gently remove the EP tube from the centrifuge well and insert it into the EP tube rack in the ice box. Do not shake the EP tube vigorously to avoid disrupting the liquid layering. Observation shows that the liquid in the tube is divided into three layers: the upper layer is a colorless aqueous phase, which is the RNA layer; the middle layer is a white membrane-like layer, which is the protein layer; and the bottom layer is a pink organic phase, which mainly contains organic substances such as phenol red and chloroform. Use a 200μL pipette to slowly aspirate the upper colorless liquid into a labeled 1.5mL enzyme-free EP tube, avoiding contact with the white protein layer and the lower pink liquid. You can aspirate three times to obtain 400-500μL of the upper aqueous phase liquid.

[0053] (6) Add an equal volume of pre-cooled isopropanol (about 500 μL) to each tube, tighten the cap, invert the EP tube, mix gently, and let stand at room temperature for 10 minutes (or place at -20°C for 30 minutes, or incubate overnight at -80°C).

[0054] (7) Centrifuge at 4℃, 12,000g for 10 min. While waiting for centrifugation, prepare 75% ethanol (anhydrous ethanol: enzyme-free water = 3:1), and insert it into an ice box to pre-cool after preparation.

[0055] (8) After centrifugation, carefully discard the supernatant, add 1 mL of the above-prepared 75% ethanol to each tube, tighten the cap, invert the EP tubes, and tap the tube walls to make the RNA adhering to the bottom of the tube float in the liquid. This washing is more thorough and can reduce organic contamination.

[0056] (9) Centrifuge at 4℃, 7,500g for 5 minutes.

[0057] (10) After centrifugation, a porcelain white gelatinous precipitate can be seen at the bottom or side wall of the tube, which is RNA. After pouring out the liquid in the tube, centrifuge again at 4°C, 7,500g for 5 minutes.

[0058] (11) Carefully aspirate the remaining liquid in the tube using a pipette until it is completely aspirated. Place the open end of the EP tube on the EP tube rack to air dry naturally. When the precipitate becomes translucent, add an appropriate amount of enzyme-free water according to the size of the precipitate, and place it in a 4°C refrigerator for half an hour to allow it to fully dissolve.

[0059] (12) Mix the RNA solution by pipetting, and use a Nanodrop 2000 micro spectrophotometer to detect the RNA concentration and OD value. The RNA sample can be stored at -80℃ or directly start subsequent experiments.

[0060] 3. mRNA reverse transcription to synthesize cDNA

[0061] The Prime Script reverse transcription kit, developed by TaKaRa Corporation of Japan, was used. TMThis experiment was conducted using the RT reagent kit with gDNA Eraser (RR047), which includes two steps: genomic DNA removal and cDNA synthesis. The procedure was performed according to the kit instructions.

[0062] (1) Personnel and environment preparation: Experimenters should wear disposable masks and gloves, spray and wipe the experimental table with 0.1% exogenous RNase inhibitor, and prepare experimental equipment such as pipettes, enzyme-free tip tips, 1.5mL enzyme-free EP tubes, and enzyme-free PCR tubes.

[0063] (2) Preparation of experimental materials: Take out the required reagents in kit RR047 from -20℃, wait for them to thaw, tap the tube wall to mix the liquid in the tube, and then insert it into the ice box for later use.

[0064] (3) Remove genomic DNA: Prepare the reaction solution in an enzyme-free PCR tube according to the system shown in Table 1 below.

[0065] Table 1. Genomic DNA Removal Reaction System

[0066]

[0067] (4) Mix the above-added reagents with the sample RNA, spot-dissociate the sample, and place it in a PCR instrument. Perform the reaction according to the following procedure:

[0068] ①42℃, 2min; ②4℃, ∞.

[0069] (5) Reverse transcription reaction: Prepare the reverse transcription reaction solution according to the system shown in Table 2 below.

[0070] Table 2 Reverse transcription reaction system

[0071]

[0072] (6) Mix the above-added reagents with the sample RNA, spot-dissociate the sample, and place it in a PCR instrument. Perform the reaction according to the following procedure:

[0073] ①37℃, 15min; ②85℃, 5sec; ③4℃, ∞.

[0074] (7) After reverse transcription, 20 μL of cDNA stock solution was obtained. After diluting 4 times with 60 μL of enzyme-free water, it was aliquoted and stored at -20℃.

[0075] 4. Real-time quantitative PCR reaction

[0076] TB from TaKaRa Corporation of Japan Premix Ex Taq TMThe PCR reaction solution was prepared using the II (Tli RNaseH Plus) kit, and the instructions for use were followed. Table 3 shows the preparation system of the PCR reaction solution.

[0077] Table 3 Real-time quantitative PCR reaction system

[0078]

[0079] (1) Preparation of experimental materials: Take 2×TB green Premix Ex Taq II, upstream primer, downstream primer and cDNA out from -20℃, after thawing, tap the tube wall to mix the liquid in the tube, spot it and insert it into the ice box for later use.

[0080] (2) For the same amplified gene, a mixture consisting of 2×TB green Premix ExTaq II, upstream primer, downstream primer and enzyme-free water can be prepared according to the reaction number + 1. After mixing, add 9 μL to each well of the PCR reaction plate, and finally add the corresponding template.

[0081] (3) After the PCR reaction plate is completely sealed with the sealing film, centrifuge at 2,500 rpm for 20 seconds.

[0082] (4) Place the PCR reaction plate in the corresponding module of the Light Cycler 96 real-time PCR instrument, set the reaction program as shown in Table 4 below, start amplification, and detect the expression of the target gene.

[0083] Table 4. Real-time quantitative PCR amplification reaction conditions

[0084]

[0085] Upstream primer: 5'-AAACCAGGCACCAGGGGAA-3' as shown in SEQ NO.2;

[0086] Downstream primer: 5'-TCTGATTGGGAAGGAGCATCTTG-3', as shown in SEQ NO.3.

[0087] (5) Relative Quantitative Analysis of Genes: After each denaturation cycle, the instrument automatically records the average fluorescence value of the last 10% of the previous cycle, which represents the PCR yield at the end of the previous cycle, and this is accumulated sequentially. After all reactions are completed, the fluorescence intensity values ​​of all reaction wells are obtained, an amplification curve is automatically generated, and the data is converted for analysis. We set a threshold within the range of exponential growth of the curve, and perform relative quantitative analysis based on the number of cycles that the fluorescence intensity of each reaction well reaches the threshold, i.e., the Ct value. The calculation formula is: Relative expression level = 2^-ΔΔCt (where ΔCt = target gene Ct value - internal reference gene Ct value, ΔΔCt = experimental group ΔCt - control group ΔCt average value).

[0088] The results showed that the expression level of circNCAPH in the epidermal tissue of psoriatic lesions was significantly higher than that in normal skin epidermal tissue. Figure 1 ).

[0089] Example 2: Detection of the effect of silencing circNCAPH expression in keratinocyte lines

[0090] Specific siRNAs were designed targeting the circNCAPH circularization site using Lipofectamine. TM RNAiMAX liposomes were used to transfect HaCaT cells, and the medium was replaced with fresh complete medium 6 hours after transfection. 48 hours after transfection, cells were collected, and the expression level of circNCAPH in HaCaT cells transfected with si-circNCAPH and its corresponding negative control was detected using real-time quantitative PCR. The siRNAs are as follows:

[0091] Justice chain (5'-3')AACCAGGCACCAGGGGAAGAATT, as shown in SEQ NO.4.

[0092] The antisense chain (5'-3')UUCUUCCCCUGGUGCCUGGUU TT is shown in SEQ NO.5.

[0093] The reagents for inhibiting circNCAPH include a negative control:

[0094] The justice chain (5'-3') UUCUCCGAACGUGUCACGUTT, as shown in SEQ NO.6,

[0095] The antisense chain (5'-3')ACGUGACACGUUCGGAGAATT is shown in SEQ NO.7.

[0096] The results showed that compared with the control group (i.e., the negative control mentioned above), si-circNCAPH significantly reduced the expression of circNCAPH in HaCaT cells, demonstrating that the silencing efficiency of si-circNCAPH on circNCAPH was greater than 50%. Figure 2 ).

[0097] Example 3: In vitro silencing of circNCAPH inhibits the proliferation of keratinocytes

[0098] Use Lipofectamine TM RNAiMAX liposomes were used to transfect si-circNCAPH and its corresponding negative control into HaCaT cells to silence circNCAPH expression. At four time points—before transfection and at 24h, 48h, and 72h+ post-transfection—the original culture medium in the cell culture plates was aspirated, and fresh complete culture medium containing 10% CCK8 solution was added. The cells were incubated at 37°C, and the absorbance at 450nm was measured after 40 minutes. The results showed that before transfection, there was no significant difference in CCK8 levels between the two groups, indicating uniform cell seeding and consistent initial cell numbers. From 48h post-transfection, compared with the control group, the CCK8 level in the si-circNCAPH group was significantly lower and maintained this difference until 72h post-transfection. Figure 3 The results showed that silencing circNCAPH could inhibit the proliferation of keratinocytes, indicating that circNCAPH has a promoting effect on the proliferation of keratinocytes.

[0099] Example 4: In vitro silencing of circNCAPH promotes apoptosis in keratinocytes

[0100] Use Lipofectamine TM RNAiMAX liposomes were used to transfect si-circNCAPH and its corresponding negative control into HaCaT cells to silence circNCAPH expression. Forty-eight hours after transfection, cells were collected, and flow cytometry was used to detect the apoptosis level of HaCaT cells. The reagents used in this experiment were the Annexin V-FITC / PI Apoptosis Detection Kit from Shanghai Yisheng Pharmaceutical Co., Ltd., and the procedure was performed according to the manufacturer's instructions.

[0101] (1) HaCaT cells were seeded into 12-well plates and treated with Lipofectamine. TM RNAiMAX liposomes were used to transfect si-circNCAPH and its corresponding negative control into HaCaT cells to silence circNCAPH expression. After culturing for 48 hours, the cells were then tested.

[0102] (2) Digest cells with trypsin without EDTA, collect cells into flow cytometry tubes, and take a portion of cells from the sample tubes as FITC single-positive tubes, PI single-positive tubes, and Blank tubes. Centrifuge at 300g, 4℃ for 5min.

[0103] (3) Wash the cells twice with pre-cooled PBS, centrifuge at 300g and 4℃ for 5min.

[0104] (4) Discard the PBS and add 100 μL of 1×Binding Buffer to resuspend the cells.

[0105] (5) Add 5 μL Annexin V-FITC to the sample tube and FITC single positive tube, mix well, and react at room temperature in the dark for 10 min.

[0106] (6) Add 10 μL of PI Staining Solution to the sample tube and PI single anode tube, mix well, and react at room temperature in the dark for 10 min.

[0107] (7) Add 400 μL of 1×Binding Buffer, mix well, place on ice, and detect by flow cytometry within 1 hour.

[0108] (8) Analysis of the proportion of apoptotic cells: Copy the flow cytometry data, adjust the compensation value using FlowJo software, use FITC as the x-axis and PI as the y-axis, and divide the cells into four quadrants based on the boundary between the yin and yang groups of the two, where the lower left quadrant is for live cells, the lower right quadrant is for early apoptotic cells, and the upper right quadrant is for late apoptotic cells.

[0109] The results showed that, compared with the control group, the proportion of late apoptosis in the si-circNCAPH group was significantly increased. Figure 4 The results showed that silencing circNCAPH could promote apoptosis of keratinocytes, indicating that circNCAPH has an inhibitory effect on apoptosis of keratinocytes.

Claims

1. Use of an agent for inhibiting expression of circNCAPH in the preparation of a psoriasis treatment preparation, wherein the sequence of the circNCAPH is shown as SEQ NO. 1; and the agent for inhibiting expression of circNCAPH is siRNA. The sequence of the siRNA is as follows: Sense strand 5'-3' AACCAGGCACCAGGGGAAGAATT; Antisense strand 5'-3' UUCUUCCCCUGGUGCCUGGUUTT.

2. Use according to claim 1, characterized in that, The agent for inhibiting expression of circNCAPH slows down the proliferation of keratinocytes and promotes apoptosis of keratinocytes.

Images