Application of miR-206-3p in regulation and control of skeletal muscle atrophy

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of miR-206-3p in regulation and control of skeletal muscle atrophy, and the change condition of the miR-206-3p level is measured by constructing an in-vitro cancer cachexia myotubular atrophy model; it is verified that in-vitro addition of miR-206-3p mimics relieves in-vitro myotube atrophy induced by a cancer conditioned culture medium, inhibits expression of a myotube marker gene and inhibits proteolysis and metabolism pathways and cell apoptosis of myotubes, so that myotube atrophy induced by cancer cachexia is inhibited. The invention opens up a new thought for the research of cachexia pathogenesis, and also provides a potential new target for the research and development of cachexia treatment and / or cachexia prevention drugs.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of miR-206-3p in regulating skeletal muscle atrophy. Background Technology

[0002] Cachexia is caused by a variety of chronic or terminal diseases, with cancer being a significant cause of its symptoms. In cancer patients, the overall prevalence of cachexia ranges from 40% at the initial diagnosis stage to 70% in the advanced stages. Its main characteristic is the loss of muscle mass and function, which not only severely reduces patients' quality of life but also weakens tolerance to anticancer treatments due to muscle depletion, thereby reducing patient survival rates.

[0003] Skeletal muscle atrophy, primarily characterized by skeletal muscle loss, is the primary clinical manifestation of cachexia. This includes progressive loss of skeletal muscle mass, volume, and strength, essentially an imbalance between increased protein breakdown and decreased synthesis. Increased protein breakdown is mainly due to overactivation of the ubiquitin-proteasome and autophagy-lysosome pathways. The ubiquitin-proteasome pathway is the main degradation pathway mediating progressive protein loss in cachexia, while increased apoptosis and inflammation in skeletal muscle cells also contribute to decreased skeletal muscle mass. How these signaling pathways alter the skeletal muscle microenvironment, thereby affecting the physiological function of skeletal muscle cells and ultimately leading to muscle atrophy, requires further investigation. Currently, there are no effective drugs to reverse cachexia clinically, and the role of miR-206-3p in the development and progression of cancer cachexia induced by liver cancer remains unclear. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the purpose of this invention is to apply miR-206-3p in regulating skeletal muscle atrophy. By adding miR-206-3p to an in vitro tumor cachexia myotube atrophy model, myotube cell atrophy is alleviated, the expression of muscle atrophy marker genes is inhibited, and myotube protein catabolism pathways and cell apoptosis are suppressed, thereby inhibiting cancer cachexia-induced myotube atrophy.

[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows: This invention provides the application of miR-206-3p in regulating skeletal muscle atrophy caused by cancer cachexia. It inhibits skeletal muscle atrophy by increasing the level of miR-206-3p in atrophied skeletal muscle cells caused by cancer cachexia; The nucleotide sequence of miR-206-3p is shown in SEQ ID NO.1.

[0006] Preferably, by adding thyroid hormone to cancer cachexia mice, the expression of endonuclease in cachexia skeletal muscle is increased, promoting the conversion of pre-miR-206-3p to mature miR-206-3p, thereby increasing the expression level of miR-206-3p and inhibiting skeletal muscle atrophy.

[0007] Preferably, the direct target gene of miR-206-3p is Ngfr Gene.

[0008] Preferably, the concentration of the added thyroid hormone is 0.1 mg / kg.

[0009] Preferably, by increasing the level of miR-206-3p in atrophied skeletal muscle cells caused by cancer cachexia, the atrophy-related genes are inhibited. FbxO31 , FbxO32 , Trim63, Becn1 , Atg5 , Bax The expression of myoblasts is increased. Myhc The expression of [a substance] inhibits the catabolism pathway of skeletal muscle proteins, thereby inhibiting skeletal muscle atrophy.

[0010] Preferably, skeletal muscle atrophy is inhibited by increasing the level of miR-206-3p in atrophied skeletal muscle cells caused by cancer cachexia, including increasing myotube diameter.

[0011] This invention also provides the application of miR-206-3p in indicative of cancer cachexia. The reduced levels of miR-206-3p in the skeletal muscle tissue of cachectic patients or cancer cachectic mice were detected as a biomarker for cancer cachexia.

[0012] This invention also provides the use of miR-206-3p in the preparation of drugs for inhibiting cancer cachexia.

[0013] This invention also provides an agent for inhibiting skeletal muscle atrophy caused by cancer cachexia. The formulation contains miR-206-3p. The beneficial effects of this invention are: This invention reveals that miR-206-3p is involved in the process of skeletal muscle atrophy caused by cancer cachexia. The in vitro addition of miR-206-3p inhibited myotube cell atrophy, opening up new avenues for the study of the pathogenesis of cachexia, providing a potential new target for the development of drugs for the treatment and / or prevention of cachexia, and providing a new direction for promoting the development of clinical treatment strategies for skeletal muscle atrophy in cancer cachexia. Attached Figure Description

[0014] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings: Figure 1 Cachexia leads to a decrease in the expression level of miR-206-3p in skeletal muscle. Here, A represents the miR-206-3p expression level in the anterior tibialis muscle of hepatocellular carcinoma cachexia mice detected by qPCR. B is an analysis using paired-samples t-tests to examine the changes in miR-206-3p expression in cachectic patients and healthy individuals in the published database GSE75437. .

[0015] Figure 2 for Ngfr It is a direct target gene of miR-206-3p. A represents the binding site of miR-206-3p to the 3'UTR of NGFR mRNA and the seed sequence for binding to the mutated miR-206-3p in the 3'UTR of NGFR mRNA; B represents the dual-luciferase activity between miR-206-3p and NGFR detected by a dual-luciferase assay (n = 3, ns difference not significant). ).

[0016] Figure 3 To investigate the regulation of miR-206-3p expression by thyroid hormones, qPCR was used to detect miR-206-3p in the tibialis anterior muscle of mice in each group after thyroid hormone treatment. Dicer and the expression levels of pre-miR-206-3p (n=3, ns) showed no significant difference. ).

[0017] Figure 4 To investigate the effect of miR-206-3p on inhibiting tumor-conditioned medium-induced myotube cell atrophy in vitro, A represents the results of MYHC immunofluorescence staining (scale bar = 130 μm) on miR-206-3p overexpression group (miR-206), LLC conditioned medium treatment group (CM), miR-206-3p-replenished CM group (CM + miR-206), and control group (Control). B represents the statistical analysis of myotube diameter using ImageJ software (n = 3, ns, no significant difference). ).

[0018] Figure 5To investigate the effect of miR-206-3p on inhibiting the activation of protein catabolism pathways in atrophic myotubes in vitro, qPCR was used to detect the expression levels of related genes in the ubiquitin-proteasome and autophagy-lysosome systems in cells of the miR-206-3p overexpression group (miR-206-3p), LLC conditioned medium treatment group (CM), miR-206-3p-replenished CM group (CM + miR-206-3p), and control group (Control). No significant differences were observed in the expression levels. ).

[0019] Figure 6 To increase the mitochondrial membrane potential level in in vitro myotubes using miR-206-3p. Figure A shows the changes in mitochondrial membrane potential (scalebar = 130 μm) in cells of the miR-206-3p overexpression group (miR-206-3p), LLC conditioned medium treatment group (CM), miR-206-3p-replenished CM group (CM + miR-206-3p), and control group (scalebar = 130 μm) detected by JC-1 staining; Figure B shows the fluorescence intensity statistical analysis of Figure A using ImageJ software. ) Detailed Implementation

[0020] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0021] The nucleotide sequence of miR-206-3p is UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO.1).

[0022] Example 1: Changes in miR-206-3p levels in skeletal muscle of cancer cachectic patients (1) Changes in miR-206-3p levels in skeletal muscle of a mouse model of cancer cachexia To construct an in situ cancer cachexia mouse model, a liver cancer mouse model was first prepared using high-pressure hydrodynamic tail vein injection. The method is as follows: 1) Select male mice of the ICR strain weighing approximately 28 g at 4 weeks and heat their tails with a hot water bag heated to 55 ℃; 2) Mix the target plasmid and physiological saline evenly according to the injection dosage (Table 1), with a total injection volume of 3 ml; 3) Draw up the plasmid mixture, fix the mouse in the tail vein injection device, heat the mouse tail, insert the syringe into the mouse tail vein, and push the syringe to ensure that the plasmid injection is completed within 6 seconds; 4) Remove the syringe and apply pressure with sterile cotton to stop bleeding; 5) Resume water and mouse food supply 6 hours after injection.

[0023] Table 1. In situ cancer cachexia mouse tail vein plasmid injection system <![CDATA[pEF1α-hNRAS G12V ]]> pEF1α-AKT1 pEF1α-MYC pCAG-PBase Tumor induction rate experimental group 8 µg 8 µg 8 µg 8 µg 6 / 6 control group 0 µg 0 µg 0 µg 8 µg 0 / 6 Mice were euthanized 28 days after injection, and tibialis anterior muscle tissue was collected. The expression level of miR-206-3p was detected by qRT-PCR. The qRT-PCR steps used in this invention are as follows: tissue was lysed using Trizol solution (approximately 5 mg tissue added to 1 ml of Trizol), and total RNA was extracted and reverse transcribed into cDNA using qRT-PCR. qPCR primers for specific genes were designed, with U6 as an internal control, and amplification was performed on a real-time PCR instrument to detect the expression level of miR-206-3p. Detailed information on the primers used is as follows: U6-F: CTCGCTTCGGCAGCACA (SEQ ID NO.2); U6-R:AACGCTTCACGAATTTGCGT (SEQ ID NO.3); miR-206-3p-F: GCGCGTGGAATGTAAGGAAGT (SEQ ID NO.4); miR-206-3p-R: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCACAC (SEQ ID NO. 5).

[0024] The results showed that, compared with the control group, the expression level of miR-206-3p in the skeletal muscle of cancer cachexia mice was significantly reduced. Figure 1 A).

[0025] (2) The level of miR-206-3p in skeletal muscle is reduced in patients with cancer cachexia. To investigate the changes in miR-206-3p levels in cancer patients, this invention analyzed the expression level of miR-206-3p in clinical data of cancer cachexia. The GSE75473 dataset is miRNA transcriptome data from muscle biopsies of 22 cancer cachexia patients and 20 non-cachexia cancer patients by the Baracos research group in 2017. The inclusion and exclusion criteria are precisely described in the original paper "Gemcitabine plus nab-paclitaxel preserves skeletal and cardiac mass and function in a murine model of pancreatic cancer cachexia" (2023). Paired-samples t-test analysis showed that the expression level of miR-206-3p in skeletal muscle of cancer cachexia patients was significantly lower than that in the control group. Figure 1 B) It is speculated that miR-206-3p is associated with the loss of skeletal muscle mass caused by clinical cachexia.

[0026] Example 2 Ngfr It is a direct target gene of miR-206-3p. Downstream target factors of miR-206-3p were screened, and NGFR was identified. The seed sequence of NGFR bound to miR-206-3p, and the fragment obtained after mutation of the seed sequence, were ligated into a dual-luciferase reporter vector, and then dual-luciferase experiments were performed.

[0027] The experimental steps of the dual-luciferase used in this invention are as follows: 1) Vector construction; synthesis using gene synthesis methods. NGFR The 3' uncoding region of the gene contains the binding site ACAUUCC (WT) for miR-206-3p, and also the site GUAGAAG (mutant) for synthesizing NGFR and miR-206-3p seed sequences. Figure 2A represents the binding site of miR-206-3p to the 32-38 bp 3'UTR of NGFR mRNA and the seed sequence for miR-206-3p binding to the 3'UTR of mutant NGFR mRNA. The synthesized fragment and pmirGLO plasmid were added at a molar ratio of 5:1. The synthesized fragment was ligated into the pmirGLO plasmid via T4 ligation (Table 2), and further introduced into competent cells. The competent cells were seeded into LB solid culture plates containing ampicillin at a concentration of 100 μg / ml and cultured overnight. Single colonies were picked and immediately inoculated into LB liquid medium, cultured at room temperature with shaking for 12-16 h, and then plasmids were extracted and sent for analysis.

[0028] Table 2 Connection System reaction system Dosage (µL) pmirGLO plasmid 100 ng 10x Ligase buffer 1 µl T4 DNA ligase 1 µl Synthesized fragments Add according to the calculation results Deionized water Make up to 10 μl 2) Culture and transfection of HEK293T cells: HEK293T cells were cultured normally, and transfection experiments were performed when the cell confluence was approximately 50%. Transfection experiments were conducted according to the following groups: Group 1: Transfection of cells with pmirGLO plasmid containing WT and miR-206-3p as a negative control, with 3 technical replicates; Group 2: Transfection of cells with pmirGLO plasmid containing WT and miR-206-3p, with 3 technical replicates; Group 3: Transfection of cells with pmirGLO plasmid containing a mutant and miR-206-3p as a negative control, with 3 technical replicates; Group 4: Transfection of cells with pmirGLO plasmid containing a mutant and miR-206-3p, with 3 technical replicates.

[0029] 3) Luciferase assay: Remove cells and place them on ice. Aspirate the original cell culture medium, add pre-cooled DMEM, and gently pipette to detach the cells. Transfer 75 µl to a 96-well plate, add 75 µl of Dual-GloR Reagent, and incubate in the dark for 30 min. Measure the fluorescence a value using a microplate reader. Add 75 µl of Dual-GloR stop & GloRReagent, incubate in the dark for 30 min, and measure the fluorescence b value using a microplate reader. Analyze the data.

[0030] The results showed that after co-transfection of miR-206-3p and luciferase reporter vector into HEK293T cells, miR-206-3p significantly inhibited the luciferase activity of vectors containing the wild-type NGFR-3'UTR region, but had no effect on the luciferase activity of vectors containing the mutant NGFR-3'UTR region. Figure 2 B). These results indicate that Ngfr It is a direct target gene of miR-206-3p.

[0031] Example 3 Thyroid hormones can regulate the expression of miR-206-3p. Thyroid hormones are key hormones regulating growth and development (especially in the central nervous system) and metabolism. They include thyroxine (T4) and triiodothyronine (T3), with T3 being the form that exerts the main biological activity. Clinically, hypothyroidism is characterized by type II myopathy, manifested as type II muscle fiber atrophy, accompanied by increased central nucleus count and mitochondrial abnormalities. In hyperthyroidism, accelerated protein turnover in skeletal muscle tissue is often observed, ultimately leading to decreased muscle strength and cross-sectional area. NGFR, or nerve growth factor receptor, is a neurotrophic factor family receptor that plays a role in neuronal survival, differentiation, axonal growth, and synaptic plasticity. Thyroid hormones (especially T3) are important positive regulators of NGFR expression; thyroid hormones regulate brain development by modulating NGFR and its downstream neurotrophic factor signaling pathways. Given the target relationship between miR-206-3p and NGFR, it is hypothesized that thyroid hormones can regulate miR-206-3p expression.

[0032] Mice were divided into four groups: a normal control group (Control), a thyroid hormone injection group (T3), a cancer cachexia group (Cancer), and a T3 intervention cancer cachexia group (Cancer+T3). A mouse orthotopic liver cancer model was constructed as previously described. Two weeks after plasmid injection, a palpable tumor could be felt subcutaneously in the mice. Subsequently, thyroid hormone or saline was injected intraperitoneally daily. The thyroid hormone injection dose was 0.1 mg / kg, while the control group received the same dose of saline. Mice were sacrificed on day 28 of the experiment, and tibialis anterior muscle tissue was collected from each group. The expression levels of the precursor miR-206-3p (pre-miR-206-3p), the ribonuclease DICER, and miR-206-3p were detected by qRT-PCR.

[0033] The primer details used for the above qRT-PCR assay are as follows: pre-miR-206-3p-F:CCAGGCCACATGCTTCTTTATA (SEQ ID NO.6); pre-miR-206-3p-R: CCAAAACCACACACTTCCTTAC (SEQ ID NO.7); Dicer-F:GTGGTTCGTTTTGATTTGCCC (SEQ ID NO.8); Dicer-R:CGTGTTGATTGTGACTCGTGGA (SEQ ID NO. 9).

[0034] The results showed that the progression of cachexia decreased the expression of miR-206-3p in skeletal muscle, while thyroid hormone could reverse the expression of miR-206-3p in the skeletal muscle of cachectic mice. Furthermore, the expression of pre-miR-206-3p was increased in the skeletal muscle of cachectic mice. Dicer downregulation of expression ( Figure 3 A) This indicates that the occurrence of cancer cachexia was inhibited. Dicer The expression of endonucleases prevents timely cleavage of pre-miR-206-3p, thereby reducing the expression level of mature miR-206-3p. During this process, thyroid hormones can increase the expression of miR-206-3p in the skeletal muscle of cachectic mice. Dicer The expression of this substance promotes the conversion of pre-miR-206-3p to mature miR-206-3p.

[0035] Example 4 miR-206-3p inhibits myotube cell atrophy in vitro To investigate the effect of miR-206-3p on in vitro myotube atrophy, an in vitro tumor cachexia myotube atrophy model was constructed. Cells were then divided into four groups: a control group, a miR-206-3p-added group (miR-206-3p), a cachexia group (CM), and a miR-206-3p-replenished cachexia group (CM + miR-206-3p). After miR-206-3p treatment, cells were collected and fixed overnight in 4% neutral paraformaldehyde solution. Mature myotubes were labeled with MyHC antibody and subjected to immunofluorescence staining. Subsequently, the myotube diameter was statistically analyzed using ImageJ software.

[0036] The specific experimental steps are as follows: (1) In vitro isolation and culture of mouse skeletal muscle satellite cells Mice were euthanized by cervical dislocation. After complete skin disinfection with 75% alcohol, the hind limbs of wild-type mice were collected under aseptic conditions using sterile forceps. Cells were digested with collagenase II and Dispase II, and mouse skeletal muscle satellite cells (mSCs) were isolated and purified by differential adhesion. mSCs were cultured at 37°C and 5% CO2 in F10 medium containing 20% ​​(v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin. When the cell density reached 90%, the culture medium was changed to differentiation medium (DMEM containing 2% horse serum) and cultured at 37°C for another 3 days.

[0037] (2) Construction of an in vitro myotube atrophy model Mouse lung cancer cells (LLCs) were cultured at 37°C and 5% CO2 in DMEM containing 10% (v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin. When the cell density reached 40%, the medium was replaced with serum-free fresh medium, and the cells were cultured at 37°C for another 48 hours. The cell culture medium was then centrifuged at 3000 rpm for 30 minutes, and the supernatant was used as the LLC tumor cell conditioned medium (CM). CM was mixed with mSCs differentiation culture medium at a 1:1 ratio, and the mixture was used to treat mSCs myotubes for 24 hours to obtain an in vitro myotube atrophy model.

[0038] (3) MYHC immunofluorescence staining Dewaxing the slides to distilled water; rinsing with PBS for 5 min; preheating 0.01 M citrate retrieval buffer in a microwave oven; placing the slides in a citrate cup, then in an antigen heat retrieval pot, and microwaving for 15 min, followed by natural cooling to room temperature; rinsing with PBS for 3 min, wiping away PBS outside the specimen with filter paper, adding blocking solution, and blocking in a humidified chamber at room temperature for 2 h; wiping away the blocking solution with filter paper (do not wash); adding MYHC (1:200, Santa Cruz) primary antibody, and incubating overnight in a humidified chamber at 4 ℃; removing the humidified chamber and warming to room temperature for 30 min; washing away the primary antibody with PBS for 3 min × 5 times, wiping away PBS outside the specimen with filter paper; adding fluorescent secondary antibody, and incubating in a humidified chamber at room temperature in the dark for 1 h; washing away the secondary antibody with PBS for 3 min × 3 times, wiping away PBS outside the specimen with filter paper; adding DAPI and incubating in the dark for 2 min, allowing for nucleus visualization; mounting directly with coverslips, and examining under a microscope for photographic recording.

[0039] The results showed that, compared with the cachexia group, the myotube diameter was significantly increased in the miR-206-3p-replenished cachexia group. Figure 4 A), showing a statistically significant difference ( Figure 4 B) indicates that miR-206-3p can rescue myotube atrophy induced by tumor cell culture medium in vitro.

[0040] Example 5: miR-206 inhibits the expression of genes related to protein catabolism pathways in atrophic myotubules. Skeletal muscle atrophy is essentially an imbalance between increased protein breakdown and decreased protein synthesis. The ubiquitin-proteasome pathway is the main degradation pathway mediating the progressive loss of proteins in cachexia. The muscle-specific E3 ubiquitin ligase muscle atrophy box F gene (Atrogin-1 / Fbx032) and muscle-specific ring finger protein 1 (MuRF1) are upregulated in different skeletal muscle atrophy models. Activation of the autophagy-lysosomal pathway can also lead to skeletal muscle atrophy. This system is characterized by increased expression of autophagy-specific proteins (such as Beclin-1, LC3B, and p62), leading to the selective removal of damaged organelles, including macromolecules such as proteins and RNA, from the cell.

[0041] To further investigate the function of miR-206-3p in in vitro myotube atrophy, cells were divided into four groups: control group, miR-206-3p-added group (miR-206-3p), cachexia group (CM), and miR-206-3p-replenished cachexia group (CM + miR-206-3p). An in vitro myotube atrophy model was constructed as described previously. After adding miR-206-3p miR-3p, cells were lysed with Trizol solution (500 µl of Trizol added to each 24-well well) after 24 h, and total RNA was extracted and reverse transcribed into cDNA using qRT-PCR. qPCR primers for specific genes were designed, with 18S as an internal control, and amplification was performed using a real-time PCR instrument to detect myoblastic factor MYHC and ubiquitin-proteasome-related genes. FbxO31 , FbxO32 and Trim63 and related genes in the autophagy-lysosome system Becn1 , Atg5 , Bax , Bcl2 The level of expression.

[0042] This embodiment uses 18S as an internal reference. The primer details are as follows: 18S-F: CCTGCGGCTTAATTTGACTC (SEQ ID NO. 10); 18S-R:ATGCCAGAGTCTCGTTCGTT(SEQ ID NO.11); Myhc-F:ACCCTCCCAAGTACGACAAG(SEQ ID NO.12); Myhc-R:CGTTATACACTGGCAGCCAC(SEQ ID NO.13); FbxO31-F:CGAATCTTGCACACGGACAC(SEQ ID NO.14); FbxO31-R:ATCGGTGAAGCAGTTTTGCAT(SEQ ID NO.15); FbxO32-F:AAGCATTGATGCGTGGGGTA(SEQ ID NO.16); FbxO32-R:ATTTGGCCACCAGGAGATGG(SEQ ID NO.17); Trim63-F:GAGGGGCTACCTTCCTCTCA(SEQ ID NO.18); Trim63-R:TTTACCCTCTGTGGTCACGC(SEQ ID NO.19); Becn1-F:CAGGAACTCACAGGAGCCATT(SEQ ID NO.20); Becn1-R:ATCAGATGCCTCCCCGATCA(SEQ ID NO.21); Atg5-F: ACCCCTGAAATGAGTTTTCCAGA (SEQ ID NO.22) Atg5-R: GGTTGATGGCCCAAAACTGG (SEQ ID NO.23) Bax-F:CTCAAGGCCCTGTGCACTAA(SEQ ID NO.24); Bax-R:GGTCCCGAAGTAGGAGAGGA(SEQ ID NO.25); Bcl2-F:CAACATCGCCCTGTGGATGA(SEQ ID NO.26); Bcl2-R:ATGGCCCATTTTGACCCAGAA(SEQ ID NO.27)。

[0043] The results showed that, compared with the cachexia group (CM), the miR-206-3p-replenished cachexia group had lower levels of myotube cells. Myhc , Bcl2 The expression of was elevated, and at the same time FbxO31 , FbxO32 , Trim63, Becn1 , Atg5 , Bax The expression of miR-206-3p was reduced, indicating that miR-206-3p can reverse the in vitro CM-induced atrophy of myoblasts in myotubes. Myhc and genes related to protein catabolism pathways FbxO31 , FbxO32 , Trim63, Becn1 , Atg5 , Bax , Bcl2 The expression ( Figure 5 This reduces protein catabolism in atrophic myotubes, thereby inhibiting skeletal muscle atrophy. Treatment with miR-206-3p downregulates pro-apoptotic factors in tumor cachexia myotubes. Bax The expression of [certain substances] was increased, and anti-apoptotic factors were upregulated. Bcl2 The expression of miR-206-3p indicates that miR-206-3p can inhibit the level of apoptosis in cachectic myotubes.

[0044] Example 6: miR-206 increases mitochondrial membrane potential levels in in vitro myotubes.

[0045] During apoptosis, the mitochondrial transmembrane potential is usually disrupted. Apoptosis leads to the loss of the myotube nucleus, thereby exacerbating myotube atrophy and muscle loss. JC1 is a cationic dye that can penetrate the cell membrane. In the normal mitochondrial environment, JC1 polymerizes to form a polymer, emitting red fluorescence. However, in unhealthy mitochondria, JC1 exists as a monomer and emits green fluorescence. Mitochondrial membrane potential was detected using a JC-1 cell staining kit, and the staining results were statistically analyzed.

[0046] The specific experimental steps are as follows: In vitro muscle cells were divided into four groups: control group, miR-206-3p-added group (miR-206-3p), cachexia group (CM), and miR-206-3p-replenished cachexia group (CM + miR-206-3p). JC-1 staining working solution was prepared. The cell culture plate was removed, the original cell culture medium was aspirated, and the cells were washed three times with PBS. 1 ml of cell culture medium and 1 ml of the prepared working solution were added, and the cells were incubated in a cell culture incubator for 20 min. The staining buffer was diluted with deionized water at a ratio of 1:4, mixed well, and incubated on ice. After staining, the working solution was removed, and the cells were washed three times with the prepared buffer. 1 ml of cell culture medium was added, and the cells were photographed using a fluorescence microscope.

[0047] The results showed that JC-1 reflects the mitochondrial membrane potential state through fluorescence color changes. At high potential, it aggregates in the mitochondrial matrix to form J-aggregates emitting red fluorescence, while at low potential, it exists as monomers emitting green fluorescence. The red fluorescence / green fluorescence ratio in the miR-206-3p addition group (CM + miR-206-3p) was significantly increased compared to the muscular atrophy group (CM). Figure 6 A) indicates that miR-206-3p can increase the mitochondrial membrane potential level in tumor cachexia myotubes, leading to miR-206-3p inhibiting apoptosis.

[0048] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0049] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of miR-206-3p in regulating skeletal muscle atrophy caused by cancer cachexia, characterized in that, It inhibits skeletal muscle atrophy by increasing the level of miR-206-3p in atrophied skeletal muscle cells caused by cancer cachexia; The nucleotide sequence of miR-206-3p is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, By adding thyroid hormone to cancer cachexia mice, the expression of endonuclease in cachexia skeletal muscle was increased, promoting the conversion of pre-miR-206-3p to mature miR-206-3p, thereby increasing the expression level of miR-206-3p and inhibiting skeletal muscle atrophy.

3. The application according to claim 2, characterized in that, The direct target gene of miR-206-3p is Ngfr Gene.

4. The application according to claim 2, characterized in that, The concentration of the added thyroid hormone is 0.1 mg / kg.

5. The application according to claim 1, characterized in that, By increasing the level of miR-206-3p in atrophied skeletal muscle cells caused by cancer cachexia, and inhibiting muscle atrophy-related genes... FbxO31 , FbxO32 , Trim63, Becn1 , Atg5 , Bax The expression of myoblasts is increased. Myhc The expression of [a substance] inhibits the catabolism pathway of skeletal muscle proteins, thereby inhibiting skeletal muscle atrophy.

6. The application according to claim 1, characterized in that, By increasing the level of miR-206-3p in atrophied skeletal muscle cells caused by cancer cachexia, skeletal muscle atrophy is inhibited, including an increase in myotube diameter.

7. The application of miR-206-3p in indicative of cancer cachexia, characterized in that, The reduced levels of miR-206-3p in the skeletal muscle tissue of cachectic patients or cancer cachectic mice were detected as a biomarker for cancer cachexia.

8. Application of miR-206-3p in the preparation of drugs that inhibit cancer cachexia.

9. An agent for inhibiting skeletal muscle atrophy caused by cancer cachexia, characterized in that, The formulation contains miR-206-3p.

Images