SNP molecular marker for identifying chicken blue shank trait and application thereof
By screening specific SNP sites of the MC1R gene in the chicken genome and using PCR and gene sequencing technologies to identify the blue-legged trait in chickens, the identification difficulties in existing technologies have been solved, achieving rapid and reliable identification results and providing a scientific basis for the protection and selection of genetic resources for the blue-legged trait in chickens.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-02
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies are insufficient for efficiently and accurately identifying the blue-foot trait in chickens, which affects the protection and selection of genetic resources for this trait.
Using SNP molecular marker technology, specific loci (MC1R_SNP1, MC1R_SNP2, MC1R_SNP3) of the MC1R gene located on chromosome 11 of the chicken genome were screened out. PCR amplification and gene sequencing were performed using specific amplification primers to determine the genotype of chicken foot color and thus identify haplotype combinations.
This technology enables rapid and reliable identification of the blue-foot trait in chickens, providing a scientific basis and theoretical support for the protection and selection of genetic resources.
Smart Images

Figure CN116064829B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to a SNP molecular marker for identifying chicken green feet traits and its application, and belongs to the technical field of animal husbandry and molecular biology. BACKGROUND
[0002] For chickens, foot color has always been one of the important traits in breeding. China is vast in territory, and due to the differences in natural conditions and dietary culture in different regions, the green foot trait has attracted the attention of consumers in Yunnan, Guizhou and Sichuan, etc. According to market consumer demand, it is important to breed chicken varieties with consumer favorite foot color in the chicken industry. Previous research on chicken green foot traits has mostly focused on incomplete dominant sex-linked inheritance, while current accurate and efficient selection using molecular markers is beneficial to the protection of chicken green foot trait genetic resources.
[0003] Therefore, a method for identifying chicken green feet is needed to provide a scientific basis for chicken green foot trait selection. SUMMARY
[0004] The present application aims to solve the problems in the prior art and provide a specific molecular marker for identifying chicken green feet, specifically a method for accurately distinguishing green foot chickens from yellow foot chickens by screening SNP sites related to green foot traits using SNP molecular marker technology, and using molecular markers for specific identification of chicken genetic resources. The second purpose of the present application is to provide haplotype combinations TCA / TCA and TCA / CCA of MC1R, which are mainly distributed in green foot chickens.
[0005] To achieve the above purpose, the present application is implemented by the following technical scheme: a SNP molecular marker for identifying chicken green foot traits, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, the SNP molecular marker is located on chromosome 11 of the chicken genome, and the SNP molecular marker has three mutations of C / T, T / C and G / A at positions 370, 513 and 575 of the MC1R gene, which are marked as MC1R_SNP1, MC1R_SNP2 and MC1R_SNP3, respectively.
[0006] MC1R_SNP1 represents MC1R_SNP1 (C-370-T); MC1R_SNP2 represents MC1R_SNP2 (T-513-C); and MC1R_SNP3 represents MC1R_SNP3 (G-575-A).
[0007] SEQ ID NO: 1: GCTTTGTAGGTGCTGCAGTTGTGCTCGGGGCCACGGCCTCCAGCCAGGGGGTCCCTGGGGGCTGAGGCCGGGGCCATGTCGATGCTGGCCCCCCTGCGCCTGCTGCGCGAGCCCTGGAACGCCAGTGAGGGCAACCAGAGCAATGCCACGGCCGGGGCCGGAGGTGCCTGGTGCCAGGGGCTGGACATCCCCAATGAGCTCTTCCTGACGCTGGGGCTGGTGAGCCTGGTGGAGAACCTGCTGGTGGTGGCCGCCATCCTCAAGAACAGGAATCTGCACTCGCCCACGTACTACTTCATCTGCTGCCTGGCCGTCTCCGACATGCTGGTGAGCGTCAGCAACCTGGCCAAGACGCTCTTCATGCTGCTGATGGAGCACGGCGTGC.
[0008] The application discloses a SNP molecular marker for identifying chicken foot color traits, and a primer pair for amplifying the SNP molecular marker.
[0009] The application discloses a SNP molecular marker for identifying chicken foot color traits, and a primer pair for amplifying the SNP molecular marker.
[0010] The application discloses a SNP molecular marker for identifying chicken foot color traits, and a primer pair for amplifying the SNP molecular marker.
[0011] Step 1): extracting genomic DNA of a chicken;
[0012] Step 2): selecting specific amplification primers MC1R-F and MC1R-R for the MC1R gene, and performing PCR amplification reaction on the DNA in step 1) to obtain a PCR product;
[0013] Step 3): performing gene sequence sequencing on the PCR product obtained in step 2), and determining a chicken foot color genotype through gene sequencing sequence and a peak graph;
[0014] Step 4): inputting the genotype obtained in step 3) into software to obtain an individual haplotype.
[0015] Further, the genomic DNA of the chicken in step 1) is chicken underwing vein blood sample genomic DNA.
[0016] Further, the sequence of the specific amplification primer MC1R-F used in the step 2) is shown as SEQ ID NO: 2, and the sequence of the primer MC1R-R is shown as SEQ ID NO: 3.
[0017] MC1R-F (SEQ ID NO: 2): GCTTTGTAGGTGCTGCAGTTGTG.
[0018] MC1R-R (SEQ ID NO: 3): CCATCCATCCTCCTGTCTGT.
[0019] Further, the sequencing result obtained in the step 3) is used to determine the corresponding genotype of the chicken foot color:
[0020] MC1R_SNP1: if the genotype is TT, it indicates that the tested individual is of the blue-foot homozygous genotype; if the genotype is CT, it indicates that the tested individual is of the yellow-foot heterozygous genotype; and if the genotype is CC, it indicates that the tested individual is of the yellow-foot homozygous genotype.
[0021] MC1R_SNP2: if the genotype is CC, it indicates that the tested individual is of the blue-foot homozygous genotype; if the genotype is CT, it indicates that the tested individual is of the yellow-foot heterozygous genotype; and if the genotype is TT, it indicates that the tested individual is of the yellow-foot homozygous genotype.
[0022] MC1R_SNP3: if the genotype is AA, it indicates that the tested individual is of the blue-foot homozygous genotype; if the genotype is AG, it indicates that the tested individual is of the yellow-foot heterozygous genotype; and if the genotype is GG, it indicates that the tested individual is of the yellow-foot homozygous genotype.
[0023] Further, the haplotype obtained in the step 4) is used to select individuals with the haplotype combination of TCA / TCA or TCA / CCA, wherein the proportion of TCA / TCA in the blue-foot population is the largest.
[0024] The present application has the following beneficial effects: the site and haplotype screened by using the molecular marker technology can realize the rapid identification of the chicken blue-foot trait, the operation is simple and the result is reliable, and the present application provides a theoretical reference for the genetic resource protection of the chicken blue foot. Meanwhile, the present application provides a scientific basis for the purposeful selection of the chicken blue-foot trait. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 The sequencing map of MC1R_SNP1-3 of the chicken blue-foot and yellow-foot individuals.
[0026] Figure 2 The haplotype analysis map of the chicken MC1R_SNP1-3 site. DETAILED DESCRIPTION
[0027] The application will be further described in detail below with reference to the specific embodiments, and the examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application.
[0028] Example 1: A method for identifying chicken green leg traits by screening SNP sites related to green leg traits using SNP molecular marker technology. The specific steps are as follows:
[0029] 1. Materials and methods
[0030] 1.1 Experimental materials
[0031] Select 29 individuals of green leg chicken, 20 individuals of Xueshan chicken, 13 individuals of Xianju chicken, 14 individuals of Taihu chicken, 21 individuals of Dagu chicken, and 25 individuals of Luyu chicken, i.e. 49 individuals of green leg chicken and 73 individuals of yellow leg chicken.
[0032] 1.2 Extraction of genomic DNA from tested individuals
[0033] Blood was collected from the wing vein of each chicken individual, and traditional phenol-chloroform method was used to extract total genomic DNA. The DNA concentration and purity were measured, the DNA mother liquor was diluted to 100 ng / μL, and was stored in a refrigerator at -20℃.
[0034] 1.3 Routine PCR reaction by PCR primers using the extracted genomic DNA as a template
[0035] 1.3.1 Selection of amplification primers
[0036] MC1R-F: GCTTTGTAGGTGCTGCAGTTGTG,
[0037] MC1R-R: CCATCCATCCTCCTGTCTGT;
[0038] 1.3.2 PCR reaction system and reaction conditions
[0039] a. The specific PCR reaction system is shown in the following table:
[0040] PCR reaction system
[0041]
[0042] b. The specific PCR reaction conditions are shown in the following table:
[0043] PCR reaction conditions
[0044]
[0045] 1.4 The obtained PCR amplification products were sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing of the amplification products
[0046] 1.5Statistical analysis of sequencing results was performed using ChromasPro software to obtain the genotype frequency distribution of each population.
[0047] 2. Results
[0048] According to Figure 1 determine the genotype of the individual to be tested at the MC1R_SNP1-3 loci. MC1R_SNP1 locus: homozygous blue-foot individual genotype is TT; heterozygous yellow-foot individual genotype is CT; homozygous yellow-foot individual genotype is CC. MC1R_SNP2 locus: homozygous blue-foot individual genotype is CC; heterozygous yellow-foot individual genotype is CT; homozygous yellow-foot individual genotype is TT. MC1R_SNP3 locus: homozygous blue-foot individual genotype is AA; heterozygous yellow-foot individual genotype is GA; homozygous yellow-foot individual genotype is GG.
[0049] Statistical analysis was performed on the genotypes of different foot color chicken individuals at MC1R_SNP1-3 loci (Table 1). Among them, 94% of the individuals in the blue-foot population were found to have homozygous genotype at MC1R_SNP1 (C-370-T) locus and 6% had heterozygous genotype, while 70% of the individuals in the yellow-foot population had homozygous genotype and 30% had heterozygous genotype; 100% of the individuals in the blue-foot population were found to have homozygous genotype at MC1R_SNP2 (T-513-C) locus and no heterozygous genotype, while 70% of the individuals in the yellow-foot population had homozygous genotype and 30% had heterozygous genotype; 100% of the individuals in the blue-foot population were found to have homozygous genotype at MC1R_SNP3 (G-575-A) locus and no heterozygous genotype, while 70% of the individuals in the yellow-foot population had homozygous genotype and 30% had heterozygous genotype.
[0050] Table 1 Genotype of individuals of different foot color types (blue, yellow)
[0051]
[0052] Example Example 2: Identification of haplotype combinations of MC1R_SNP1-3 loci for chicken blue-foot trait
[0053] 1. Haplotype construction
[0054] The genotype data of all individuals at MC1R_SNP1-3 loci obtained by the above PCR sequencing method was input into Haploview software to obtain the individual haplotype, and the degree of pairwise linkage disequilibrium between the loci was calculated, represented by the standardized linkage disequilibrium coefficient D', and finally the distribution of different haplotype combinations in blue-foot chickens and yellow-foot chickens was statistically analyzed.
[0055] 2. Results
[0056] According toFigure 2 The results of the pairwise linkage disequilibrium analysis of the three loci of MC1R gene show that the square color is red, indicating complete linkage, and the number indicates the linkage disequilibrium coefficient D' between the loci. The linkage disequilibrium coefficient between MC1R_SNP1 and MC1R_SNP2 is 0.98, the linkage disequilibrium coefficient between MC1R_SNP1 and MC1R_SNP3 is 0.95, and the linkage disequilibrium coefficient between MC1R_SNP2 and MC1R_SNP3 is 1. Three haplotypes are found in the experiment, which are CTG, TCA and CCA, and the frequencies are 0.504, 0.467 and 0.016, respectively. The haplotype combinations of blue feet are TCA / TCA and TCA / CCA, and the proportion of TCA / TCA in the blue foot population is the largest (94%); the remaining haplotype combinations are yellow feet.
[0057] The above shows and describes the basic principles and main features of the present application and the advantages of the present application. Those skilled in the art should understand that the present application is not limited to the above examples, and the above examples and descriptions in the specification are only to illustrate the principles of the present application. Without departing from the spirit and scope of the present application, various changes and improvements can be made to the present application, and these changes and improvements all fall within the scope of the claimed present application. The scope of protection of the present application is defined by the appended claims and their equivalents.
Claims
1. The use of a SNP molecular marker for identifying chicken greenish foot trait, characterized in that, The SNP molecular marker is located on chromosome 11 of a chicken genome, and the SNP molecular marker is located in the MC1R gene; the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO:1, and three mutations of C / T, T / C and G / A are present at positions 144, 287 and 349, respectively, and are marked as MC1R_SNP1, MC1R_SNP2 and MC1R_SNP3, respectively. The application method is as follows: Step 1): extracting chicken genomic DNA; Step 2): selecting specific amplification primers for the MC1R gene, and then performing PCR amplification reaction by taking the DNA of step 1) as a template to obtain a PCR product, wherein the PCR product contains the SNP molecular marker; Step 3): performing gene sequence sequencing on the PCR product obtained in step 2), and determining the chicken foot color genotype by gene sequencing sequence and peak graph; MC1R_SNP1: if the genotype is TT, it indicates that the tested individual is an all-blue foot genotype; if the genotype is CT, it indicates that the tested individual is a yellow foot heterozygous genotype; and if the genotype is CC, it indicates that the tested individual is a yellow foot homozygous genotype; MC1R_SNP2: if the genotype is CC, it indicates that the tested individual is an all-blue foot genotype; if the genotype is CT, it indicates that the tested individual is a yellow foot heterozygous genotype; and if the genotype is TT, it indicates that the tested individual is a yellow foot homozygous genotype; MC1R_SNP3: if the genotype is AA, it indicates that the tested individual is an all-blue foot genotype; if the genotype is AG, it indicates that the tested individual is a yellow foot heterozygous genotype; and if the genotype is GG, it indicates that the tested individual is a yellow foot homozygous genotype; Step 4): inputting the genotype obtained in step 3) into software to obtain individual haplotypes, and selecting individuals with haplotype combinations of TCA / TCA and TCA / CCA.
2. Use according to claim 1, characterized in that: In step 1), the chicken genomic DNA is chicken underwing vein blood sample genomic DNA.
3. The use according to claim 1, characterized in that: In step 2), the specific amplification primers used are MC1R-F and MC1R-R, the sequence of the MC1R-F is shown as SEQ ID NO:2, and the sequence of the primer MC1R-R is shown as SEQ ID NO:3.
Citation Information
Patent Citations
Identification and application methods for MC1R gene haplotype
CN110273010A
SNP (Single Nucleotide Polymorphism) molecular marker related to green foot character of 817-type broiler chickens and application
CN112662790A