An electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer

The electrochemiluminescence sensor constructed through carbon dot and Au@Ag2S resonance energy transfer solves the problem of PML/RARα fusion gene detection, and realizes high-sensitivity quantitative detection, which is suitable for early diagnosis and treatment monitoring of acute promyelocytic leukemia.

CN116067948BActive Publication Date: 2025-07-29FUJIAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310154064.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-23
Publication Date
2025-07-29
Estimated Expiration
2043-02-23

AI Technical Summary

Technical Problem

The prior art is difficult to effectively detect the PML/RARα fusion gene in acute promyelocytic leukemia, affecting the early diagnosis and treatment effect.

Method used

Carbon dots are used as electrochemiluminescence energy donor and Au@Ag2S core-shell nanoparticles are used as energy receptors to construct an electrochemiluminescence sensor based on resonant energy transfer, and a high sensitivity detection of PML/RARα fusion gene is achieved using the DNA "sandwich" structure.

Benefits of technology

It realizes high-sensitive quantitative detection of PML/RARα fusion gene, with small background interference, stable signal, wide linear range, fast detection and simple operation, and is suitable for early clinical diagnosis and prognosis monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116067948B_ABST
    Figure CN116067948B_ABST
Patent Text Reader

Abstract

The present invention discloses an electrochemiluminescence sensor for detecting the PML / RARα fusion gene of acute promyelocytic leukemia based on the resonance energy transfer between carbon dots and Au@Ag₂S. Carbon dots are used as electrochemiluminescence reagents. By forming a CDs / PAMAM / reduced graphene oxide composite (CDs / PAMAM / rGO), the CDs are modified on the electrode surface. Utilizing the resonance energy transfer of the electrochemiluminescence (ECL) signal of Au@Ag₂S nanoparticles (Au@Ag₂S NPs) to the CDs, the ECL signal of the CDs is quenched with high efficiency. Combining the hybridization of the capture DNA probe with the target DNA and the Au@Ag₂S NPs-labeled auxiliary DNA probe to form a "sandwich" structure, an ECL biosensor for detecting the PML / RARα fusion gene of acute promyelocytic leukemia is established. The constructed ECL biosensor has the advantages of simplicity, low cost, and high sensitivity, and is expected to become a tool for the diagnosis and treatment of acute promyelocytic leukemia.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an electrochemiluminescence sensor for detecting the PML / RARα fusion gene of acute promyelocytic leukemia based on carbon dots and Au@Ag2S resonance energy transfer, belonging to the field of inspection technology. This biosensor can be used for the detection of the PML / RARα fusion gene of acute promyelocytic leukemia. Background Art

[0002] Acute promyelocytic leukemia (APL) is clinically very severe. It is a malignant disease of the human hematopoietic tissue. It has a fast onset, rapidly deteriorates, has a high mortality rate, is very difficult to treat, and seriously endangers people's physical health. The vast majority of APL patients have a characteristic chromosomal translocation of t(17;15)(q21;q22), which causes the RARα gene located on chromosome 17 to rearrange with the PML gene located on chromosome 15, resulting in the generation of the PML / RARα fusion gene, inhibiting the normal functions of the PML and RARα genes, and affecting cell proliferation and differentiation. This fusion gene has become a specific marker gene for APL. The quantitative analysis and detection of PML / RARα are crucial for the early clinical diagnosis, treatment, and prognosis monitoring of APL.

[0003] Carbon dots (CDs) are environmentally friendly nanoparticles with a particle size of less than 10 nm and good dispersibility. Due to their outstanding performance in biocompatibility and water solubility, as well as their advantages such as low cytotoxicity and low preparation cost, they have attracted the great attention of many researchers. In particular, they also have unique optical properties, such as electrochemiluminescence, chemiluminescence, fluorescence, etc., making CDs widely used in the fields of biomedicine, optical devices, and biosensing. ]Therefore, as a new type of ECL luminescent probe, CDs have been gradually applied to various ECL analysis and detection systems. There are a large number of oxygen-containing functional groups (such as carboxyl groups and hydroxyl groups, etc.) on the surface of carbon dots, which make carbon dots have good water solubility. They are extremely easy to fall off when directly drop-coated on the electrode surface. To solve the problems existing in the application of water-soluble carbon dots in solid-state ECL biosensors, it can be achieved by finding excellent immobilization materials. The CDs are firmly modified on the electrode by using the immobilization material to generate a stable ECL signal response. Graphene has outstanding electrical conductivity and electron transfer ability, and a large specific surface area, etc., and can become an ideal immobilization material for CDs and be applied in electrochemiluminescence sensors. The polyamidoamine (PAMAM) dendrimer is used to reduce graphene oxide (GO) to prepare a reduced graphene oxide (rGO) composite material (PAMAM / rGO) rich in amino groups on the surface. Using EDC / NHS activation coupling, the CDs / PAMAM / rGO complex is synthesized. PAMAM is introduced into the ECL sensing interface. While realizing the immobilization of CDs on the electrode surface, it can also be used as a coreactant to enhance the ECL luminescence signal of the system.

[0004] The electrochemiluminescence (ECL) reaction process has two stages: electrochemistry and chemiluminescence, and it has the analysis advantages of both. This method has the advantages of simple instrument device, low background signal, strong selectivity, low reagent cost, and wide linear range, etc., and has received extensive attention. The electrochemiluminescence resonance energy transfer technology (ECL-RET) applies electrochemiluminescence as a donor light source in the resonance energy transfer system and has been widely studied in recent years and has great research potential. It has many remarkable advantages: no need for an excitation light source, which can reduce background noise, and it is not easy to occur phenomena such as photobleaching, light scattering, and direct excitation of the receptor itself when using dyes as donors or receptors.

[0005] The present invention discloses an electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer. Using the prepared carbon dots as the ECL energy donor and Au@Ag2S core-shell nanoparticles (Au@Ag2SNPs) as the energy transfer acceptor, an electrochemiluminescence biosensor with a "sandwich" structure is designed for the detection of the acute promyelocytic leukemia PML / RARα fusion gene. Summary of the Invention

[0006] 1. The object of the present invention is to provide an electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer.

[0007] 2. The electrochemiluminescence biosensor described in the present invention is based on the principle of electrochemiluminescence resonance energy transfer. Carbon dots are used as the ECL energy donor, and Au@Ag2S core-shell nanoparticles are used as the energy transfer acceptor. By utilizing the high-efficiency quenching of the ECL signal of CDs by Au@Ag2S core-shell nanoparticles and combining with the DNA "sandwich" structure, an electrochemiluminescence biosensor is constructed, and the quantitative detection of the acute promyelocytic leukemia PML / RARα fusion gene is successfully realized.

[0008] 3. A preparation method of an electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer comprises the following steps in sequence:

[0009] (1) Synthesis of carbon dots (CDs)

[0010] In this experiment, carbon fiber is used as the precursor, nitric acid is used as the oxidant, and CDs are synthesized by the heating reflux method. The experimental process is as follows: 750 mg of accurately weighed carbon fiber is cut into fine small segments and placed in a 250 mL three-necked round-bottom flask. 150 mL of 7.5 M nitric acid solution is added to the round-bottom flask. A spherical condenser is used for condensation reflux, and the oil bath is heated until the reaction solution in the round-bottom flask boils. Starting from the boiling of the solution, the reaction is carried out for 12 hours, and then the reaction is ended and naturally cooled to room temperature. The reaction solution after the reaction is collected. An appropriate amount of NaOH solid is added to adjust the pH of the synthesized CDs solution to neutral, and then centrifuged at 8000 rpm for 10 min to remove the precipitate. Then, it is filtered successively through microporous membranes (0.45 μm and 0.22 μm) to remove impurities, and the filtered solution is filled into a dialysis bag with a molecular weight cut-off (MWCO) of 1000 Dalton and dialyzed for 48 hours to remove small molecule salts. Then, the fully dialyzed solution is ultrafiltered with an ultrafiltration tube with a molecular weight cut-off of 3 kD (10000 rpm, 30 min), and the solution with a molecular weight greater than 3 kD is collected, which is the carbon dots required for the experiment. After rotary evaporation and concentration and freeze-drying, a certain mass of CDs solid is obtained. Finally, it is formulated into a high-concentration CDs mother liquor with ultrapure water and stored at 4 °C for standby.

[0011] (2) Preparation of CDs / PAMAM / rGO composite

[0012] First, PAMAM / rGO was prepared by the following method: Weigh 6 mg of GO and prepare it into a 1 mg / mL aqueous solution. Ultrasonically disperse it evenly (500 W, 5 h), transfer it into a clean three-necked round-bottom flask, and slowly add 6 mL of PAMAM solution (1 mg / mL) under stirring. Place it in an oil bath at 120 °C and heat it for reflux condensation reaction for 1 h. After the reaction is completed, cool it to room temperature, centrifuge the reaction solution, and wash the precipitate 3 - 5 times to wash away the excess PAMAM. After freeze-drying the precipitate, a black powder sample is obtained.

[0013] Take 300 μL of the CDs prepared above, add an appropriate amount of EDC and NHS mixed solution, stir and react at room temperature for 0.5 h, then add 180 μL of PAMAM / rGO solution, and continue to stir and react for 12 h. Finally, centrifuge and wash the obtained precipitate to get the CDs / PAMAM / rGO solid, disperse it evenly in 480 μL of ultrapure water, and store it at 4 °C for standby.

[0014] (3) Preparation of Au@Ag2S core-shell nanoparticles

[0015] Synthesis of Au nanoparticles (AuNPs): Quickly add 1 mL of 1% sodium citrate to 100 mL of boiling 0.01% HAuCl4 solution, stir and react for 10 min, and then wine-red AuNPs are obtained. Then, using AuNPs as seeds, continue to synthesize Au@Ag NPs: Take 50 mL of the above AuNPs, boil and stir vigorously, add 1 mL of AgNO3 solution (4 mg / mL) to the boiling AuNPs, then gradually add 1 mL of 1% sodium citrate dropwise, and continue to boil for 1 h. The solution turns orange-yellow, cool it to room temperature, and store it at 4 °C.

[0016] Take 10 mL of Au@Ag NPs, add an appropriate amount of 0.010 M Na2S solution under continuous stirring, and then stir and react at room temperature for 12 h. After the reaction is completed, collect the reaction solution to obtain blue-violet Au@Ag2S core-shell nanoparticles (Au@Ag2S NPs), and store them at 4 °C.

[0017] (4) Preparation of auxiliary DNA-Au@Ag2S NPs

[0018] Take the prepared 0.75 mL of Au@Ag2S NPs and add them to a clean 2 mL EP tube. Then add 0.25 mL of the auxiliary DNA probe (5'-SH-C6-CTGCCTCCCCGGCGCCACTGGCCACGTGGT -3') solution. The mixture is left to stand overnight at 4 °C. Then wash it with 10 mM Tris-HCl buffer and centrifuge at 10000 rpm. Finally, redisperse the auxiliary DNA-Au@Ag2S NPs complex in Tris-HCl buffer and store it at 4 °C for further use.

[0019] (5)Construction and target DNA detection of electrochemiluminescence biosensor

[0020] The GCE is polished successively with 1.0, 0.3, and 0.05 μm Al2O3 powders, and then sonicated in 1:1 HNO3, absolute ethanol, and ultrapure water respectively and dried with N2. Subsequently, 5 μL of the well-dispersed CDs / PAMAM / rGO solution is evenly dropped onto the surface of the GCE and dried in an oven at 45 °C to form a film. The CDs / PAMAM / rGO modified electrode is obtained.

[0021] To activate the carboxylic acid of the CDs immobilized on the electrode surface, the CDs / PAMAM / rGO modified electrode is immersed in 1 mL of a mixed solution containing 20 mg of EDC and 10 mg of NHS. After activation for 0.5 h, it is rinsed thoroughly with ultrapure water and dried with nitrogen. Then, 8 μL of the capture DNA probe (5'-NH2-C6-TTTTTTAACTGCTGCTCTGGGTCTCAATGG-3') is dropped onto the electrode surface and self-assembled at room temperature for 2 h, rinsed with Tris-HCl buffer, and dried with nitrogen. The capture probe is self-assembled on the surface of the glassy carbon electrode modified with CDs / PAMAM / rGO (CDs / PAMAM / rGO / GCE) through amide bonds.

[0022] The prepared electrode was placed into 100 µL of a hybridization solution containing an auxiliary probe labeled with Au@Ag2S NPs at a certain concentration and the target DNA. After hybridization at 37 °C for 1 hour, it was taken out, washed with Tris-HCl buffer solution at pH 7.40, and dried with nitrogen. Electrochemiluminescence and electrochemical impedance spectroscopy were detected. At this time, the capture DNA hybridized with the target DNA (5'-ACCACGTGGCCAGTGGCGCCGGGGAGGCAGCCATTGAGACCCAGAGCAGCAGTT -3') and the auxiliary DNA labeled with Au@Ag2S NPs to form a "sandwich" structure. The Au@Ag2S NPs approached the CDs immobilized on the electrode surface, which could quench the ECL signal of the carbon dots. According to the change value of the ECL signal before and after the formation of the "sandwich" structure, highly sensitive quantitative detection of the target DNA was achieved.

[0023] Advantages of the present invention:

[0024] The electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on the resonance energy transfer between carbon dots and Au@Ag2S of the present invention has the advantages of small background interference, stable signal, wide linear range, low detection limit, rapid detection, simple operation, good stability and reproducibility, and will have broad application prospects in clinical early diagnosis and prognosis monitoring. Brief Description of the Drawings

[0025] Figure 1 It is the working principle diagram of the electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on the resonance energy transfer between carbon dots and Au@Ag2S of the present invention.

[0026] Figure 2 It is the high-resolution transmission electron micrograph (A, C, D in the figure) and particle size distribution diagram (B in the figure) of the carbon dots in the electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on the resonance energy transfer between carbon dots and Au@Ag2S of the present invention.

[0027] Figure 3 It is the high-resolution transmission electron micrographs of Au NPs (A in the figure), Au@Ag NPs (B in the figure), and Au@Ag2S NPs (C in the figure) in the electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on the resonance energy transfer between carbon dots and Au@Ag2S of the present invention.

[0028] Figure 4In the electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer of the present invention, the ultraviolet-visible absorption spectra (a-d) of Au@Ag2S NPs, with the addition amounts of Na2S being 0.4 (a), 0.5 (b), 0.6 (c), and 0.8 mL (d); the ECL spectrum (e) of CDs.

[0029] Figure 5 In the electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer of the present invention, the ECL signal-potential curve graph (A) of different DNA concentrations and the linear relationship graph (B) of different concentrations of DNA and △I ECL In A of the figure: a-g: 0 (a), 0.005 (b), 0.05 (c), 0.5 (d), 5 (e), 50 (f), 500 pM (g). Specific implementation manners

[0030] In order to make the technical problems, technical solutions and effects to be solved by the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments and drawings, but the protection scope of the present invention is not limited to the following embodiments.

[0031] As Figure 1 shown, the working principle diagram of the electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer of the present invention: Prepare carbon dots (CDs) and graphene oxide (GO) with carboxyl groups rich on the surface, and couple them to the PAMAM / rGO material by using EDC / NHS to obtain the CDs / PAMAM / rGO composite. The composite can be directly drop-coated on the surface of the glassy carbon electrode (GCE) and stably exist, generating a strong ECL signal. Then, use the capture DNA probe modified with amino group (-NH2) to be chemically coupled and fixed on the electrode surface constructed by CDs / PAMAM / rGO. When the capture DNA hybridizes with the target DNA and the auxiliary DNA probe labeled with Au@Ag2S NPs to form a "sandwich" structure, at this time, Au@Ag2S NPs approach the CDs immobilized on the electrode surface. Due to the overlap of the ultraviolet absorption spectrum of Au@Ag2S NPs and the ECL spectrum of CDs, a quenching effect on the ECL signal of carbon dots can be produced. According to the change value of the ECL signal before and after the formation of the "sandwich" structure, high-sensitivity quantitative detection of the acute promyelocytic leukemia PML / RARα fusion gene is realized.

[0032] Example 1:

[0033] Preparation of carbon dots with electrochemiluminescence and their characterization in an electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer are as follows:

[0034] (1) As shown in Figure 2 , carbon fibers were used as precursors and nitric acid was used as an oxidant to synthesize CDs by the heating reflux method. The experimental process was as follows: 750 mg of precisely weighed carbon fibers were cut into small pieces and placed in a 250 mL three-necked round-bottom flask. 150 mL of 7.5 M nitric acid solution was added to the round-bottom flask. A spherical condenser was used for condensation reflux, and the oil bath was heated until the reaction solution in the round-bottom flask boiled. Starting from the boiling of the solution, the reaction was carried out for 12 hours, and then the reaction was terminated. It was naturally cooled to room temperature, and the reaction solution (synthesized CDs solution) was collected. An appropriate amount of NaOH solid was added to adjust the pH of the synthesized CDs solution to neutral, and then centrifuged at 8000 rpm for 10 min to remove the precipitate. Then, it was successively filtered through microporous membranes (0.45 μm and 0.22 μm) to remove impurities. The filtered solution was filled into a dialysis bag with a molecular weight cut-off (MWCO) of 1000 Dalton and dialyzed for 48 hours to remove small molecular salts. The fully dialyzed solution was ultrafiltered with an ultrafiltration tube with a MWCO of 3 kD (10000 rpm, 30 min), and the solution with a molecular weight greater than 3 kD was collected as the carbon dots required for the experiment. After rotary evaporation and concentration and freeze-drying, a certain mass of CDs solid was obtained. Finally, it was formulated into a high-concentration CDs mother liquor with ultrapure water. An appropriate concentration of CDs aqueous solution was drop-coated on a copper mesh covered with an ultrathin carbon film and left to dry naturally at room temperature. The morphological structure was observed under a transmission electron microscope. The results were as shown in Figure 2 A, and it could be clearly seen that the prepared CDs were spherical nanoparticles with good dispersibility and relatively uniform particle size distribution. According to the TEM characterization results, the particle size of CDs was statistically analyzed by NanoMeasurer software, and the average particle size was 3.19 nm ( Figure 2 B). The prepared carbon dots had obvious lattice characteristics, and the lattice constant was 0.21 nm ( Figure 2 D). This lattice constant was due to the sp 2 hybridization inside the graphite carbon.

[0035] (2) Preparation of CDs / PAMAM / rGO composite materials

[0036] The preparation of CDs / PAMAM / rGO materials includes: weighing graphene oxide (GO) solids to prepare a 6 mL 1 mg / mL aqueous solution, and after ultrasonic dispersion (500 W, 5 h), taking 6 mL of the GO solution and transferring it into a clean three-necked round-bottom flask. Under stirring, slowly add 6 mL of polyamide-amine dendrimer PAMAM solution (1 mg / mL, produced by Sigma-Aldrich). Place it in an oil bath at 120 °C, heat and condense and reflux for 1 h, then cool to room temperature. Centrifuge the reaction solution, wash the precipitate 3 - 5 times to remove the excess PAMAM, and then freeze-dry the precipitate to obtain a black powder solid sample of PAMAM / rGO. Take 300 μL of 0.5 mg / mL CDs solution, add 60 μL of a mixed solution of EDC (50 mg / mL) and NHS (20 mg / mL), stir and react at room temperature for 0.5 h, then add 180 μL of 0.5 mg / mL PAMAM / rGO solution, and continuously stir and react for 12 h. Finally, centrifuge and wash the obtained precipitate to prepare the CDs / PAMAM / rGO material.

[0037] Example 2:

[0038] In an electrochemiluminescence sensor for detecting the PML / RARα fusion gene of acute promyelocytic leukemia based on the resonance energy transfer between carbon dots and Au@Ag2S, the synthesis and characterization of Au@Ag2S core-shell nanoparticles are as follows:

[0039] (1) As Figure 3 shown, the synthesis of Au nanoparticles (AuNPs): quickly add 1 mL of 1 wt% sodium citrate to 100 mL of boiling 0.01 wt% HAuCl4 solution, stir and react for 10 min to obtain wine-red AuNPs. Then, using AuNPs as seeds, continue to synthesize Au@Ag NPs: take 50 mL of the above AuNPs, boil and stir vigorously, add 1 mL of AgNO3 solution (4 mg / mL) to the boiling AuNPs, then gradually add 1 mL of 1 wt% sodium citrate dropwise, and continue boiling for 1 h. The solution turns orange-yellow and is cooled to room temperature. The synthesis of Au@Ag2S core-shell nanoparticles: take 10 mL of Au@Ag NPs, add an appropriate amount of 0.010 M Na2S solution under continuous stirring, and then stir and react at room temperature for 12 h. After the reaction is completed, collect the reaction solution to obtain blue-violet Au@Ag2S core-shell nanoparticles (Au@Ag2S NPs), which are stored at 4 °C for standby. The morphological changes of Au NPs, Au@Ag NPs, and Au@Ag2S NPs are characterized by HRTEM, as Figure 3As shown, the HRTEM image of Au NPs shows that the nanomaterial presents a uniform spherical shape ( Figure 3 A in), with an average particle size of about 40 nm and good dispersibility; Au@Ag core-shell nanoparticles (Au@Ag NPs) were obtained by reducing with AgNO3, and the particle size increased to about 55 nm ( Figure 3 B in), and Au@Ag NPs further reacted with Na2S solution to form Au@Ag2S NPs, and it was observed that the nanoparticles continued to increase to 65 nm ( Figure 3 C in).

[0040] (2) Preparation of auxiliary DNA-Au@Ag2S NPs (auxiliary probe labeled with Au@Ag2S NPs)

[0041] Take 0.75 mL of the prepared Au@Ag2S NPs and add them to a clean 2 mL EP tube. Add 0.25 mL of the auxiliary DNA probe (5'-SH-C6-CTGCCTCCCCGGCGCCACTGGCCACGTGGT -3', produced by Sangon Biotech (Shanghai) Co., Ltd.) solution. The mixture is left standing overnight at 4 °C. Then wash with 10 mM Tris-HCl buffer and centrifuge at 10000 rpm. Finally, the auxiliary DNA-Au@Ag2S NPs complex (auxiliary probe labeled with Au@Ag2S NPs) is redispersed in Tris-HCl buffer and stored at 4 °C for further use.

[0042] Example 3:

[0043] The overlapping diagram of the ultraviolet-visible absorption spectrum of Au@Ag2S NPs and the ECL spectrum of CDs in an electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer is as follows:

[0044] In the process of electrochemiluminescence resonance energy transfer, effective overlap between the energy donor and acceptor spectra is a necessary condition for energy transfer. The ECL emission peak of CDs as the energy donor is around 565 nm (as shown in Figure 4 e), which overlaps most with the absorption peak of Au@Ag2S NPs synthesized with 0.4 mL of Na2S (as shown in Figure 4 a, with a maximum absorption wavelength of around 540 nm), which is conducive to the occurrence of resonance energy transfer. Therefore, Au@Ag2S core-shell nanoparticles with an absorption wavelength of around 540 nm are used to construct an electrochemiluminescence resonance energy transfer biosensor by utilizing the energy transfer between the emission of CDs and Au@Ag2S NPs.

[0045] Example 4:

[0046] For the quantitative detection of the PML / RARα fusion gene in acute promyelocytic leukemia in an electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer, it is as follows:

[0047] The GCE (3 mm in diameter) was polished successively with Al2O3 powders of 1.0, 0.3 and 0.05 μm, and then sonicated in 1:1 HNO3 (HNO3 concentration 8 M), absolute ethanol and ultrapure water respectively, and dried with N2. Subsequently, 5 μL of the well-dispersed CDs / PAMAM / rGO solution prepared in Example 1 was evenly drop-coated on the surface of the GCE, and dried in an oven at 45 °C to form a film, obtaining a CDs / PAMAM / rGO modified electrode. Before the experiment, the CDs / PAMAM / rGO modified electrode was immersed in 1 mL of a mixed solution containing 20 mg of EDC and 10 mg of NHS, activated for 0.5 h, rinsed thoroughly with ultrapure water, and dried with nitrogen. Then, 8 μL of the capture DNA probe (capture probe: 5'-NH2-C6-TTTTTTAACTGCTGCTCTGGGTCTCAATGG-3', Sangon Biotech (Shanghai) Co., Ltd.) was added dropwise onto the electrode surface and self-assembled at room temperature for 2 h, rinsed with Tris-HCl buffer solution, and dried with nitrogen. The capture probe (5'-NH2-C6-TTTTTTAACTGCTGCTCTGGGTCTCAATGG-3') was self-assembled on the surface of the glassy carbon electrode modified with CDs / PAMAM / rGO (CDs / PAMAM / rGO / GCE) through amide bonds. The assembled electrode was placed into 100 μL of a hybridization solution containing the auxiliary probe labeled with Au@Ag2S NPs prepared in Example 2 and the target DNA (also known as the target DNA: 5'-ACCACGTGGCCAGTGGCGCCGGGGAGGCAGCCATTGAGACCCAGAGCAGCAGTT-3', produced by Sangon Biotech (Shanghai) Co., Ltd.). After hybridization at 37 °C for 1 h, it was taken out, washed with Tris-HCl buffer solution at pH 7.40, and dried with nitrogen. A standard three-electrode system was adopted, with the working electrode being the prepared ssDNA / CDs / PAMAM / rGO modified glassy carbon electrode, the reference electrode being the Ag / AgCl electrode, the counter electrode being the Pt wire, and the supporting electrolyte being a 100 mM PBS solution containing 100 mM K2S2O8. Electrochemiluminescence and electrochemical impedance spectroscopy were detected. At this time, the capture DNA in the ssDNA / CDs / PAMAM / rGO modified glassy carbon electrode hybridized with the target DNA and the auxiliary DNA labeled with Au@Ag2S NPs to form a "sandwich" structure. The Au@Ag2S NPs were close to the CDs immobilized on the electrode surface, which could quench the ECL signal of the carbon dots. According to the change value of the ECL signal before and after the formation of the "sandwich" structure, highly sensitive quantitative detection of the target DNA was achieved. The experimental results obtained were: the ECL signal-potential curve graphs of different DNA concentrations (A in the figure) and different concentrations of DNA and △I ECLLinear relationship diagram (B in the figure), such as Figure 5 shown. △I ECL is linearly correlated with the logarithm of the target DNA concentration, and its linear concentration range is: 0.005 - 500 pM. The regression equation of this sensor is: △I ECL / a.u. = 3511.52 + 829.19×lgC(pM), the correlation coefficient (r) = 0.996, and the detection limit reaches 0.72 fM.

Claims

1. A preparation method of an electrochemiluminescence sensor for detecting the acute promyelocytic leukemia PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer, characterized in that, It includes the following steps: (1) The glassy carbon electrode (GCE) is polished successively with 1.0, 0.3, and 0.05 μm alumina powders, and then sonicated in 1:1 HNO3, absolute ethanol, and ultrapure water respectively and dried with N2. Subsequently, 5 μL of the well-dispersed CDs / PAMAM / rGO solution is evenly dropped onto the surface of the GCE and dried in an oven at 45 °C to form a film, obtaining the CDs / PAMAM / rGO modified electrode; (2) The CDs / PAMAM / rGO modified electrode is immersed in 1 mL of a mixed solution containing 20 mg of EDC and 10 mg of NHS. After activation for 0.5 h, it is rinsed thoroughly with ultrapure water and dried with nitrogen. Then, 8 μL of the capture DNA probe is dropped onto the surface of the CDs / PAMAM / rGO modified electrode. After self-assembly at room temperature for 2 h, it is rinsed with Tris-HCl buffer solution and dried with nitrogen. The capture DNA probe is assembled on the surface of the CDs / PAMAM / rGO modified glassy carbon electrode (CDs / PAMAM / rGO / GCE) through amide bonds, obtaining the ssDNA / CDs / PAMAM / rGO modified electrode; (3) The prepared ssDNA / CDs / PAMAM / rGO modified electrode is placed into 100 μL of a hybridization solution containing Au@Ag2S NPs-labeled auxiliary DNA probe and target DNA. After hybridization at 37 °C for 1 hour, at this time, the capture DNA probe hybridizes with the target DNA and the Au@Ag2S NPs-labeled auxiliary DNA probe to form a "sandwich" structure, and then electrochemiluminescence detection is carried out. The Au@Ag2S NPs approach the CDs immobilized on the surface of the modified electrode, which can quench the electrochemiluminescence signal of the carbon dots. According to the change value of the ECL signal before and after the formation of the "sandwich" structure, the quantitative detection of the target DNA of the PML / RARα fusion gene in acute promyelocytic leukemia is realized.

2. The preparation method of an electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer according to claim 1, wherein The preparation of the CDs / PAMAM / rGO material includes the following steps: Weigh graphene oxide (GO) solid and prepare a 6 mL aqueous solution with a concentration of 1 mg / mL. After ultrasonic dispersion, take 6 mL of the GO solution and transfer it into a clean three-necked round-bottom flask. Under stirring, slowly add 6 mL of a PAMAM solution with a concentration of 1 mg / mL, place it in an oil bath at 120 °C, heat and condense for reflux reaction for 1 h, then cool to room temperature. Centrifuge the reaction solution, wash the precipitate 3 - 5 times to remove the excess PAMAM, and then freeze-dry the precipitate to obtain a black powder solid sample of PAMAM / rGO; Take 300 μL of a 0.5 mg / mL CDs solution, add 60 μL of the EDC and NHS mixed solution, stir and react at room temperature for 0.5 h, then add 180 μL of a 0.5 mg / mL PAMAM / rGO solution, and continue to stir and react for 12 h; Finally, centrifuge and wash the obtained precipitate to prepare the CDs / PAMAM / rGO material.

3. The preparation method of an electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer according to claim 1 or 2, characterized in that, The preparation of the Au@Ag2S NPs-labeled auxiliary DNA probe includes the following steps: 0.75 mL of Au@Ag2S NPs with a particle size of 65 nm is added to a 2 mL EP tube, 0.25 mL of 0.2 μM auxiliary DNA solution is added, and the mixture is left standing overnight at 4 °C; then it is washed with 10 mM Tris-HCl buffer solution and centrifuged at 10,000 rpm to obtain the Au@Ag2S NPs-labeled auxiliary DNA probe. Finally, the Au@Ag2S NPs-labeled auxiliary DNA probe is dispersed in Tris-HCl buffer solution for standby.

4. An electrochemiluminescence sensor for detecting the acute promyelocytic PML / RARα fusion gene based on carbon dots and Au@Ag2S resonance energy transfer, prepared by the method according to any one of claims 1-3, characterized in that, It includes carbon dots / PAMAM / reduced graphene CDs / PAMAM / rGO as the donor in electrochemiluminescence resonance energy transfer, gold-silver sulfide core-shell nanoparticles Au@Ag2S NPs as the acceptor in resonance energy transfer. By using the high-efficiency quenching of the ECL of carbon dots by Au@Ag2S NPs, combined with the hybridization of the capture DNA probe with the target DNA and the Au@Ag2S NPs-labeled auxiliary DNA probe, a "sandwich" structure is formed to establish an electrochemiluminescence sensor, which can be used for the quantitative detection of the PML / RARα fusion gene in acute promyelocytic leukemia.