Use of miR-133a-3p in preparation of a drug for treating UVB acute skin injury
By restoring miR-133a-3p levels through intradermal injection or cell overexpression, the problem of numerous adverse reactions to topical corticosteroids has been solved, achieving effective relief of acute UVB skin damage and providing a new therapeutic target.
Patent Information
- Application Number
- CN202211417935.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-14
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2042-11-14
AI Technical Summary
Existing topical corticosteroids have numerous adverse reactions and are often misused in the treatment of acute UVB skin damage, and there are no reports on the application of miR-133a-3p in relieving acute UVB skin damage.
Restore miR-133a-3p levels in acute UVB injury by intradermal injection of agomir miR-133a-3p or by overexpression of miR-133a-3p in human keratinocyte line HaCaT cells to alleviate UVB-induced skin damage.
It significantly reduces skin erosion, ulceration, thickening, and necrosis caused by acute UVB irradiation, decreases epidermal thickness increase, and reduces cell death and apoptosis, providing a new and important target for the treatment of acute UVB skin injury.
Smart Images

Figure CN116077518B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to the application of miR-133a-3p in the preparation of drugs for treating acute UVB skin damage. Background Technology
[0002] Ultraviolet (UV) radiation from sunlight is a significant contributing factor to photosensitive skin diseases, closely related to the onset and exacerbation of various skin conditions such as chronic actinic dermatitis, polymorphic photokeratosis, lupus erythematosus, photoaging, and photocarcinogenesis. Based on wavelength, UV radiation is classified into UVC, UVB, and UVA. Due to its lower penetrating power, UVB exposure primarily causes tissue damage in the epidermis. Short-term exposure to high doses of UVB radiation can cause acute skin damage, leading to symptoms such as blisters, redness, swelling, and desquamation. Therefore, preventing and treating acute photodamage caused by UVB and discovering new drug targets are major challenges currently facing experimental research and clinical practice.
[0003] Topical corticosteroids remain the primary treatment for UVB-induced skin damage (such as sunburn and photoallergic dermatitis). However, they also have a range of adverse effects, including skin thinning and atrophy, telangiectasia and flushing, bacterial and fungal infections, acne, and hirsutism. On one hand, the wide variety of topical corticosteroids, many of which are over-the-counter, often leads to misuse and abuse, worsening of the condition and adverse reactions. On the other hand, the lack of widespread medical knowledge contributes to some patients' fear and aversion to topical corticosteroids, limiting their rational use in clinical practice.
[0004] 98% of the DNA sequence in the human genome is transcribed into non-coding RNA, far exceeding the number of genes encoding proteins. These RNAs do not translate into proteins but play important biological functions. Recent studies have discovered an increasing number of non-coding RNAs, such as microRNAs (miRNAs), as therapeutic targets for diseases. Compared to the hundreds of existing protein drug targets, non-coding RNAs significantly expand the existing therapeutic targets for diseases, opening up a broader scope for new drug development. Currently, some RNA therapies have been approved for clinical trials by the US Food and Drug Administration and the European Medicines Agency, while others are in clinical trials. There are currently no reports on miR-133a-3p (a miRNA) alleviating acute UVB damage. Summary of the Invention
[0005] To overcome the shortcomings of the aforementioned technologies, this invention provides a novel use of miR-133a-3p in the preparation of drugs for treating acute UVB skin damage. We found that miR-133a-3p levels were decreased in mouse epidermis and human keratinocytes (HaCaT cells) with acute UVB damage compared to normal epidermis or cells. Restoring miR-133a-3p levels can alleviate acute UVB-induced damage; therefore, miR-133a-3p is one of the important therapeutic targets for acute UVB-induced skin damage.
[0006] This invention investigates the effect of intradermal injection of agomir miR-133a-3p on alleviating acute photodamage to the skin in mice induced by UVB irradiation.
[0007] This invention further explores the therapeutic effect of overexpression of miR-133a-3p in human keratinocyte HaCaT cells on alleviating UVB-induced cell death.
[0008] On the one hand, the present invention provides the application of MiR-133a-3p in the preparation of a drug for treating acute UVB skin damage.
[0009] The specific sequence of miR-133a-3p is as follows:
[0010] agomir-133 sense sequence: uuugguccccuucaaccagcug;
[0011] agomir-133 antisense sequence: gcugguugaaggggaccaaauu;
[0012] agomir negative control (NC) sense sequence: uucuccgaacgugucacgutt;
[0013] agomir NC antisense sequence: acgugacacguucggagaatt.
[0014] The miR-133a-3p described in this invention is derived from isolated cells or can be obtained through artificial synthesis.
[0015] On the other hand, the drug provided by the present invention includes any of the following:
[0016] (1) miR-133a-3p;
[0017] (2) Recombinant vectors containing the miR-133a-3p encoding gene;
[0018] (3) Recombinant viruses containing the miR-133a-3p encoding gene;
[0019] (4) Recombinant viral vectors containing the miR-133a-3p encoding gene;
[0020] (5) Chemically synthesized miR-133a-3p-like sequences;
[0021] (6) Other chemical substances with activity equivalent to miR-133a-3p.
[0022] Furthermore, the drug is used to alleviate skin erosion and ulceration caused by acute UVB irradiation and / or to alleviate skin thickening and necrosis caused by acute UVB irradiation and / or to alleviate increased epidermal thickness caused by acute UVB irradiation.
[0023] Beneficial effects: This invention reveals for the first time that restoring the level of miR-133a-3p in epidermal and human keratinocyte HaCaT cells can alleviate acute damage caused by UVB, providing an important therapeutic target for the treatment of acute skin damage caused by UVB. Attached Figure Description
[0024] Figure 1 Gross photographs of skin damage in mice after 96 hours of light exposure;
[0025] Figure 2 Microscopic photographs of sections of damaged skin tissue from mice;
[0026] Figure 3 Images of HaCaT cells stained with trypan blue after 24h and 48h of light exposure;
[0027] Figure 4 Western blot analysis of HaCaT cells after 8h / 24h / 48h of light exposure. Detailed Implementation
[0028] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, conditions described in Molecular Cloning: A Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0029] Example 1: Experiment on the relief of acute photodamage to the skin in mice induced by UVB irradiation by intradermal injection of agomir miR-133a-3p.
[0030] Experimental Sample: Fifteen C57BL / 6J mice, aged 6-12 weeks, were randomly divided into three groups: Group I: UVB group; Group II: UVB + agomir NC group; Group III: UVB + agomir-133 (agomir miR-133a-3p) group. agomir-133 sense sequence: uuugguccccuucaaccagcug; agomir-133 antisense sequence: gcugguugaaggggaccaaauu; agomir NC sense sequence: uucuccgaacgugucacgutt; agomir NC antisense sequence: acgugacacguucggagaatt.
[0031] Experimental conditions: All mice in all groups were exposed to UVB at 430 mJ / cm² 24 hours after their backs were shaved. 2 The backs were irradiated. At 0, 24, and 48 hours after UVB irradiation, mice in groups II and III were injected intradermally at the UVB irradiation sites on their backs. Mice in group II were injected with the control sequence agomir NC, and mice in group III were injected with agomir-133.
[0032] Skin damage evaluation: Skin damage in mice was scored according to the 2015 Expert Consensus on Clinical Application of Photopatch Testing, using indicators such as erythema and edema for quantitative evaluation. Based on evaluation methods adopted in relevant domestic and international studies, the scoring items included erythema, edema, and ulceration. Each score was divided into 0-3 according to the degree of damage: none = 0, mild = 1, moderate = 2, severe = 3. The sum of the scores for the three indicators was taken, with a maximum score of 9 points. Experimental statistical results are shown in Table 1. Data analysis was performed using SPSS statistical software. Data are expressed as mean ± standard deviation (X±s). One-way ANOVA was used for comparisons between groups, and LSD test was used for pairwise comparisons. P < 0.05 was considered statistically significant. Mice were sacrificed 96 hours after photoexposure, and changes in the skin on the back of the mice were observed and photographed, as shown in the attached table. Figure 1 As shown.
[0033] Table 1. Skin Injury Scoring Table for C57BL / 6J Mice (X±s)
[0034] Group Number of examples Skin lesion score UVB group 5 8.00±0.71* UVB+agomir NC group 5 8.40±0.55* UVB+agomir-133 group 5 4.20±1.48
[0035] *: Compared with the UVB+agomir-133 group, p<0.05
[0036] The results showed that, compared with UVB irradiation alone or injection of agomir NC after UVB irradiation, injection of agomir-133 significantly reduced skin erosion and ulceration caused by acute UVB irradiation, and the difference was statistically significant.
[0037] Evaluation of increased epidermal thickness: Skin tissue from the back of mice after modeling was collected, fixed, dehydrated, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (HE). The experimental results are attached. Figure 2 As shown in Table 2, compared with UVB irradiation alone or injection of agomir NC after UVB irradiation, injection of agomir-133 significantly reduced skin thickening and necrosis caused by acute UVB irradiation. Epidermal thickness was measured by HE staining, and the results are shown in Table 2. Data were analyzed using SPSS statistical software, and the data are expressed as mean ± standard deviation (X±s). One-way ANOVA was used for comparisons between groups, and LSD test was used for pairwise comparisons. P < 0.05 was considered statistically significant.
[0038] Table 2. Epidermal thickness of C57BL / 6J mice (X±s)
[0039] Group Number of examples Skin thickness (μm) UVB group 5 <![CDATA[147.23±2.74 * ]]> UVB+agomir NC group 5 <![CDATA[135.64±4.93 * ]]> UVB+agomir-133 group 5 81.71±6.14
[0040] *: Compared with the UVB+agomir-133 group, p<0.05
[0041] The results showed that, compared with UVB irradiation alone or injection of agomir NC after UVB irradiation, injection of agomir-133 significantly reduced the increase in epidermal thickness caused by acute UVB irradiation, and the difference was statistically significant.
[0042] Example 2: Overexpression of miR-133a-3p in human keratinocyte HaCaT cells alleviates UVB-induced cell death.
[0043] Experimental conditions: HaCaT cells were seeded in 6-well plates and divided into groups I, II, III, and IV. Group I: transfected with miR-133a-3p mimic control sequence (NC); Group II: transfected with miR-133a-3p mimic (i.e., miR-133a-3p mimic); Group III: mimic NC + UVB group; Group IV: miR-133a-3p mimic + UVB group. Transfection was performed when the cells reached a density of 30-50%. The reagents and steps required for each well were as follows: 2.2 pmol mimic NC or miR-133a-3p mimic was added to 200 μL of serum-free culture medium and mixed well. Then, 8 μL of transfection reagent INTERFERin was added, followed by vortexing and centrifugation. After incubation at room temperature for 10 min, the mixture was added dropwise to the cells.
[0044] miR-133a-3p mimic sense sequence: uuugguccccuucaaccagcug;
[0045] miR-133a-3p mimic antisense sequence: gcugguugaaggggaccaaauu;
[0046] mimic NC sense:uucuccgaacgugucacgutt;
[0047] mimic NC antisense: acgugacacguucgggagaatt.
[0048] Cell death rate assessment: 48 h after cell transfection, cells in groups III and IV were treated with UVB 50 mJ / cm². 2 Irradiation. Trypan blue staining experiments were performed 24 and 48 hours after irradiation, and the cell death rate (= trypan blue positive cells / total cell count) was calculated. The specific procedures for each well were as follows: Suspended cells (dead cells and their fragments) in the cell supernatant were collected in centrifuge tubes. Adherent cells (mainly live cells) were digested with trypsin and collected in the same centrifuge tube. The cells were resuspended in PBS. An equal volume of trypan blue solution was added to the cell resuspended cells and gently mixed. Trypan blue positive cells were counted using a Corning CytoSMART cell counter. The experimental results are shown in Table 3. Data analysis was performed using SPSS statistical software. Data are expressed as mean ± standard deviation (X±s). One-way ANOVA was used for comparisons between groups, and LSD test was used for pairwise comparisons. P < 0.05 was considered statistically significant. Photos were taken as attached. Figure 3 As shown, 3a represents the results after 24 hours of irradiation, and 3b represents the results after 48 hours of irradiation.
[0049] Table 3. Cell mortality rate of HaCaT cells under UVB irradiation (X±s)
[0050]
[0051] *: Compared with the miR-133a-3p mimic+UVB group, p < 0.05
[0052] The results showed that, compared with HaCaT cells transfected with the mimic NC sequence, cells transfected with miR-133a-3p mimic had a lower cell death rate after UVB irradiation, suggesting that overexpression of miR-133a-3p alleviated the overall cell death level induced by UVB irradiation.
[0053] Evaluation of marker molecular changes in apoptosis and pyroptosis: 48 h after cell transfection, cells in groups III and IV were treated with UVB 50 mJ / cm². 2 Cell proteins were extracted at 8 h, 24 h, and 48 h after irradiation for Western blotting experiments. After BCA protein concentration determination, equal volumes of samples were loaded for SDS-PAGE gel electrophoresis. Following membrane transfer, antigen blocking, primary antibody incubation, and secondary antibody incubation, the cells were exposed and photographed using chemiluminescence. Changes in the cleavage level of caspase-3, a common upstream marker molecule for both apoptosis and GSDME-mediated pyroptosis, were observed. The experimental results are attached. Figure 4 As shown.
[0054] The results showed that, compared with HaCaT cells transfected with the mimic NC sequence, cells transfected with miR-133a-3p mimic had reduced levels of caspase-3 cleavage, the upstream marker molecule for both apoptosis and GSDME-mediated pyroptosis after UVB irradiation, suggesting that overexpression of miR-133a-3p alleviated UVB irradiation-induced apoptosis and GSDME-mediated pyroptosis.
[0055] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Those skilled in the art, under the guidance of the present invention, can make various similar representations without departing from the spirit and claims of the present invention, and such modifications all fall within the protection scope of the present invention.
Claims
1. Application of miR-133a-3p in the preparation of drugs for treating acute UVB skin damage.
2. The application according to claim 1, wherein the drug is used to alleviate skin erosion and ulceration caused by acute UVB irradiation and / or to alleviate skin thickening and necrosis caused by acute UVB irradiation and / or to alleviate epidermal thickening caused by acute UVB irradiation.
3. In the application according to claim 1, the miR-133a-3p is derived from the isolated cells or can be obtained through artificial synthesis.
4. The application according to claim 1, wherein the drug comprises any of the following: (1) miR-133a-3p; (2) Recombinant vectors containing the miR-133a-3p encoding gene; (3) Recombinant viruses containing the miR-133a-3p encoding gene.
Citation Information
Patent Citations
Therapeutic compositions and methods using exosomes derived from human dermal fibroblasts
US20210186831A1
KR20200003453A