Primer set, kit and method for detecting transgenic soybean transformation event CAL16

Abstract

The present invention provides a primer set, a kit and a method for detecting the transgenic soybean CAL16 transformation event, which relates to the technical field of molecular biology. The primer set of the present invention includes an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2. The present invention discloses for the first time the PCR detection primers for the qualitative detection of transgenic soybean CAL16, which can specifically detect transgenic soybean CAL16 and its derivative lines, with high specificity and high sensitivity, and the detection limit can reach 0.1%.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a primer set, a kit and a method for detecting a transgenic soybean CAL16 transformation event. Background Art

[0002] Genetically modified crops are developing rapidly around the world, with the pace of research and development of different types of genetically modified crops accelerating. As more and more genetically modified crops are approved for use, effective regulatory methods for these crops are needed. Among these methods, the development of transformant detection methods is crucial.

[0003] Since the conventional qualitative PCR detection method has low requirements for instruments and equipment and has high detection sensitivity and accuracy, it is still the main method used for genetically modified crop detection in many places. Therefore, corresponding transformant-specific PCR detection methods have been established for genetically modified crops currently in commercial application. The state also requires the establishment of corresponding qualitative PCR detection methods for genetically modified crops that have been approved to enter the production trial stage or the safety certificate stage.

[0004] In recent years, significant progress has been made in the research and development of genetically modified soybeans, resulting in a large number of high-quality transformants with promising commercial applications. Currently, these transformants are undergoing various stages of safety evaluation. As the commercialization of genetically modified soybeans in my country progresses, it is necessary to establish accurate PCR detection methods for these new genetically modified soybean materials. Specific PCR detection methods need to be developed for different transformants.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The present invention aims to provide a primer set, kit, and method for detecting CAL16 transformation events in transgenic soybeans. This invention provides, for the first time, a PCR primer set capable of specifically detecting CAL16 transformation events in transgenic soybeans. The primer set and detection method of the present invention are highly specific and sensitive, with a detection limit of 0.1%.

[0007] The technical solutions provided by the present invention are as follows:

[0008] In one aspect, the present invention provides a primer set for detecting a transformation event of transgenic soybean CAL16, comprising an upstream primer as shown in SEQ ID No. 1 and a downstream primer as shown in SEQ ID No. 2.

[0009] In one embodiment, the primer set specifically amplifies the flank of the cry1Ab / vip3Da gene of the insect-resistant soybean CAL16 transformant, and the target fragment length is 238 bp.

[0010] The present invention provides a pair of specific primer combinations suitable for qualitative detection of transgenic soybean CAL16 and its derivatives. The primer set of the present invention amplifies the right border flanking sequence of the exogenous insert fragment of transgenic insect-resistant soybean CAL16, and the sequence of the right border flanking nucleic acid molecule is shown in SEQ ID No. 3.

[0011] The transgenic soybean CAL16 mentioned in the invention is an insect-resistant soybean with cry1Ab / vip3Da genes developed by Zhejiang University, and has now entered the production trial stage.

[0012] In another aspect, the present invention provides a kit for detecting a transgenic soybean CAL16 transformation event, the kit comprising the aforementioned primer set;

[0013] Preferably, the kit further comprises one or more of a buffer, a DNA polymerase, and salt ions.

[0014] In one embodiment, the kit further comprises other reagents, including but not limited to one or more of dNTPs, positive controls, and negative controls.

[0015] In one embodiment, the DNA polymerase is selected from Taq, Bst, Pfu, Tru, Kod, Sac, Sso, Poc, Pab, Mth, Pho and the like, preferably a hot-start Taq DNA polymerase.

[0016] In another aspect, the present invention provides a use of the primer set or the kit in detecting transgenic soybeans. The specific primers of the present invention are used to qualitatively detect whether transgenic soybeans and related products contain soybean CAL16 transformation events.

[0017] In another aspect, the present invention provides a PCR detection method for a transgenic soybean CAL16 transformation event, the method comprising the following steps:

[0018] (a) extracting genomic DNA from a sample to be tested;

[0019] (b) performing a PCR reaction using the aforementioned primer set to obtain a PCR amplification product;

[0020] (c) Qualitative detection of PCR amplification products by agarose gel electrophoresis.

[0021] In one embodiment, when the PCR detection method can amplify an amplicon of 238 bp, it indicates that the transgenic soybean CAL16 transformation event exists in the sample.

[0022] In the present invention, the sample to be tested may include a plant or tissue, such as a seed or cell, containing the transgenic soybean event CAL16. The test object includes soybean parents, derivative lines or varieties, and products thereof.

[0023] In one embodiment, in the reaction system of the PCR reaction, the concentration of the primers is 0.15-0.25 μmol / L, preferably 0.2 μmol / L.

[0024] In one embodiment, the annealing temperature of the PCR reaction is 56-58°C; preferably 58°C.

[0025] In a specific embodiment, the PCR reaction procedure includes: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles, and finally extension at 72°C.

[0026] Beneficial effects:

[0027] The primer set and detection method provided by the present invention have the advantages of good specificity, high sensitivity, and good repeatability;

[0028] The present invention enriches the identification methods of genetically modified soybeans, improves the identification efficiency, and provides a guarantee for the safety of genetically modified soybeans. The present invention is of great significance for the product management and identification of germplasm resources of genetically modified soybeans.

[0029] The present invention is suitable for qualitative PCR analysis of transgenic soybean lines, has low detection cost, is easy to promote, and is easy to apply on a large scale. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 Agarose gel electrophoresis diagram of specific PCR amplification of CAL16 transformants provided in an embodiment of the present invention (wherein M: DNA Marker; 1: CAL16; 2: non-transgenic control; 3: blank control; 4: other transgenic corn mixtures; 5: transgenic rapeseed mixtures; 6: transgenic rice mixtures; 7: transgenic cotton mixtures; 8: transgenic soybean mixtures);

[0032] Figure 2Agarose gel electrophoresis diagram of specific PCR amplification of transgenic soybean CAL16 transformants provided in an embodiment of the present invention (M: DNA Marker; 1: 10%; 2: 1%; 3: 0.5%; 4: 0.1%; 5: 0.05%; 6: 0%);

[0033] Figure 3 Verification of the limit of detection (LOD) of the specific qualitative PCR detection method for the transgenic soybean CAL16 transformation event provided in the embodiment of the present invention (M: DNA Marker; 1-60: 0.1% (w / w) CAL16 genomic DNA sample);

[0034] Figure 4 The repeatability of the sensitivity of the qualitative PCR detection method for CAL16 transformation events using CAL16 genomic DNA samples with different mass fractions provided in the embodiment of the present invention (M: DNA Marker; 1: 10%; 2: 1%; 3: 0.5%; 4: 0.1%; 5: 0.05%; 6: 0%) was verified.

[0035] Figure 5 The amplification effects of the six pairs of primers provided in the embodiment of the present invention;

[0036] Figure 6 This is a graph showing the optimization results of the PCR reaction system (especially primer concentration) and reaction procedure (especially annealing temperature) provided for the comparative example of the present invention. DETAILED DESCRIPTION

[0037] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0038] Example 1. Detection method

[0039] 1.1 Sample processing and DNA extraction methods

[0040] 1.1.1 Sample

[0041] Test sample: The test sample of the present invention is the grain of insect-resistant soybean CAL16 transgenic for cry1Ab / vip3Da gene.

[0042] Control sample: The non-transgenic control sample is the non-transgenic control grain corresponding to the transgenic soybean CAL16.

[0043] The methods used for specificity testing were:

[0044] 1. A mixture of genetically modified soybeans (GTS40-3-2, MON89788, CV127, A5547-127, A2704-12, 305423, 356043, MON88302, 73496, MON87769, MON87705, FG72, DAS68416-4, and SHZD32-1), with each transformant having a mass fraction of 1%;

[0045] 2. A mixture of genetically modified corn (Bt11, Bt176, MON810, MON863, GA21, NK603, T25, TC1507, MON89034, MON88017, 59122, MIR604, 3272, MON87460, MIR162, DAS40278-9, Shuangkang12-5, IE09S034, C0030.3.5, C0010.3.7, 4114, MON87427, 5307), with each transformant having a mass fraction of 1%;

[0046] 3. A mixture of genetically modified cotton (MON531, MON1445, MON15985, LLCOTON25, MON88913, GHB614, COT102), with each transformant having a mass fraction of 1%;

[0047] 4. A mixture of transgenic rapeseed (MS1, MS8, RF1, RF2, RF3, T45, OXY235, Topas19 / 2, MON88302, 73496), with each transformant having a mass fraction of 1%;

[0048] 5. A transgenic rice mixture (TT51-1, Kefeng No. 6, Kemingdao, M12, Kefeng No. 8, Kefeng No. 2, G6H1, T1C-19), with the mass fraction of each transformant being 1%.

[0049] 1.1.2 Methods

[0050] The DNA extraction method is suitable for extracting genomic DNA from ground soybean seeds. The Tiangen Biochemical Technology (Beijing) Co., Ltd. Plant Genomic DNA Extraction Kit (Cat. # DP305-03) was used. The specific extraction process was described in the kit instructions.

[0051] 1.2 Primer design

[0052] Primers CAL16-R-F2 / CAL16-R-R2 were used to amplify the CAL16 transformant-specific DNA with a target fragment length of 238 bp, which spanned the junction region between soybean genomic DNA and the right border of the CAL16 soybean transgenic T-DNA insertion fragment.

[0053] The specific primer sequences are shown in Table 1 below.

[0054] Table 1. Primer information

[0055]

[0056] The sequence of the qualitative PCR amplified fragment specific to the soybean CAL16 transformation event is shown below as SEQ ID No. 14.

[0057] agggtttcgctcatgtgttga gcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaatccagatcccccgaatta attcggcgttaatccagtacattaaaaacgtccgcaatgtgttattaagttgtccactattattgtttttgtattatattttcccaggcttatcttttatcaatgag(SEQ ID No.14).

[0058] 1.3 Reaction system and reaction procedure

[0059] The PCR reaction system is shown in Table 2.

[0060] Table 2. Qualitative PCR reaction system

[0061]

[0062]

[0063] The reaction program was as follows: denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles, and finally extension at 72°C for 7 min.

[0064] Example 2. Quality verification of the detection method

[0065] 2.1 Specificity

[0066] The transgenic corn, soybean, rice, cotton and rapeseed materials used for method specific detection were prepared into mixed samples with a content of 1% (w / w) and genomic DNA was extracted. The established CAL16 transformant specific detection method was used to perform specific detection on the DNA of transgenic soybean CAL16 and the other five groups of mixed samples, non-transgenic control samples and blank controls.

[0067] The results showed that only transgenic soybean CAL16 obtained a typical amplification curve, while all other five groups of transgenic materials had no amplification signals ( Figure 1 ), indicating that the established CAL16 transformant-specific PCR detection method can specifically amplify transgenic soybean CAL16.

[0068] 2.2 Sensitivity

[0069] In order to determine the detection limit of the qualitative PCR detection method, PCR amplification was performed using CAL16 transformant DNA at mass fractions of 10%, 1%, 0.5%, 0.1%, 0.05% and 0% (w / w).

[0070] The results showed that a 238 bp product was amplified in all systems containing CAL16 genomic DNA ( Figure 2 ). This result indicates that the specific qualitative PCR detection method for this transformation event can detect as low as 0.05% of transgenic soybean CAL16 genomic DNA.

[0071] 2.3 Detection limit

[0072] To test the detection limit (LOD) of the assay, samples containing 0.1% (w / w) GM soybean CAL16 genomic DNA in a non-GM control soybean background were used for the assay. The assay was performed three times with 20 parallel reactions each time.

[0073] The results showed that all 60 replicates amplified the amplified fragment specific to the transgenic soybean CAL16 transformation event ( Figure 3 Therefore, the limit of detection (LOD) of this transformant-specific detection method was estimated to be 0.1%.

[0074] 2.4 Repeatability

[0075] To evaluate the reproducibility of the qualitative PCR method for detecting CAL16 transformation events, reproducibility tests were conducted in the laboratory using different personnel and instruments with different mass fractions of the above samples.

[0076] The results showed that all CAL16 transgenic samples obtained the target fragments after PCR amplification ( Figure 4 ), so the established CAL16 transformant-specific qualitative PCR detection method has good repeatability.

[0077] Comparative Example 1

[0078] During the process of the present invention, different primer pairs were also tried in the screening and optimization of primers, as shown in Table 3 below.

[0079] Table 3. Primer screening

[0080]

[0081]

[0082] The primer pairs and target product lengths are as follows:

[0083] 1 L-F3 / R3 194bp 2 L-F4 / R4 249bp 3 L-F3 / R4 224bp 4 L-F4 / R3 219bp 5 R-F2 / R2 238bp 6 R-F3 / R2 225bp

[0084] The amplification effects of the 6 pairs of primers are as follows Figure 5 As shown in the results, it can be seen that the amplification effect of R-F2 / R2 is better, the bands are relatively clean, and there is no nonspecific band and primer dimer generation. Therefore, the CAL-R-F2 / CAL-R-R2 primer pair was finally selected for CAL16 transformant-specific DNA amplification.

[0085] Comparative Example 2

[0086] In the process of the present invention, the reaction system (especially the primer concentration) and reaction procedure (especially the annealing temperature) of PCR were optimized.

[0087] With 1% positive material as the test object, the concentration gradient was set to 0.1μmol / L, 0.2μmol / L, 0.4μmol / L, 0.6μmol / L, 0.8μmol / L, and the annealing temperature was set to 54℃, 56℃, 58℃, and 60℃ for PCR amplification (see the results). Figure 6 ,in).

[0088] The results showed that the optimal PCR reaction conditions were: annealing temperature of 58℃ and primer concentration of 0.2μmol / L.

[0089] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Primer set for detecting transgenic soybean CAL16 transformation event, characterized in that, it includes an upstream primer shown in SEQ ID No. 1 and a downstream primer shown in SEQ ID No.

2.

2. Kit for detecting transgenic soybean CAL16 transformation event, characterized in that, the kit contains the primer set described in claim 1.

3. Kit according to claim 2, characterized in that, the kit further contains one or more of buffer, DNA polymerase, and salt ions.

4. Kit according to claim 2, characterized in that, the kit further includes a positive control.

5. Use of the primer set according to claim 1 or the kit according to any one of claims 2 to 4 in detecting transgenic soybean CAL16 transformation event.

6. PCR detection method for transgenic soybean CAL16 transformation event, characterized in that, the method includes the following steps: (a) Extract genomic DNA of the sample to be tested; (b) Perform PCR reaction with the primer set described in claim 1 to obtain a PCR amplification product; (c) Qualitatively detect the PCR amplification product by agarose gel electrophoresis.

7. Method according to claim 6, characterized in that, when the PCR detection method can amplify an amplicon of 238 bp, it indicates the presence of transgenic soybean CAL16 transformation event in the sample.

8. Detection method according to claim 6 or 7, characterized in that, in the reaction system of the PCR reaction, the concentration of the primer is 0.15 - 0.25 μmol / L.

9. Detection method according to claim 8, characterized in that, in the reaction system of the PCR reaction, the concentration of the primer is 0.2 μmol / L.

10. Detection method according to claim 6 or 7, characterized in that, the annealing temperature of the PCR reaction is 56 - 58 °C.

11. Detection method according to claim 10, characterized in that, the annealing temperature of the PCR reaction is 58 °C.

12. Detection method according to claim 6 or 7, characterized in that, the program of the PCR reaction includes: denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, a total of 35 cycles, and finally extension at 72 °C.

Images